Method Article
The CRISPR/Cas12a system in combination with a single crRNA array enables efficient multiplex editing of the S. cerevisiae genome at multiple loci simultaneously. This is demonstrated by constructing carotenoid producing yeast strains which are subsequently used to create yeast pixel art.
High efficiency, ease of use and versatility of the clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9 (CRISPR/Cas9) system has facilitated advanced genetic modification of Saccharomyces cerevisiae, a model organism and workhorse in industrial biotechnology. CRISPR-associated protein 12a (Cas12a), an RNA-guided endonuclease with features distinguishable from Cas9 is applied in this work, further extending the molecular toolbox for genome editing purposes. A benefit of the CRISPR/Cas12a system is that it can be used in multiplex genome editing with multiple guide RNAs expressed from a single transcriptional unit (single CRISPR RNA (crRNA) array). We present a protocol for multiplex integration of multiple heterologous genes into independent loci of the S. cerevisiae genome using the CRISPR/Cas12a system with multiple crRNAs expressed from a single crRNA array construct. The proposed method exploits the ability of S. cerevisiae to perform in vivo recombination of DNA fragments to assemble the single crRNA array into a plasmid that can be used for transformant selection, as well as the assembly of donor DNA sequences that integrate into the genome at intended positions. Cas12a is pre-expressed constitutively, facilitating cleavage of the S. cerevisiae genome at the intended positions upon expression of the single crRNA array. The protocol includes the design and construction of a single crRNA array and donor DNA expression cassettes, and exploits an integration approach making use of unique 50-bp DNA connectors sequences and separate integration flank DNA sequences, which simplifies experimental design through standardization and modularization and extends the range of applications. Finally, we demonstrate a straightforward technique for creating yeast pixel art with an acoustic liquid handler using differently colored carotenoid producing yeast strains that were constructed.
CRISPR/Cas enzymes have unquestionably revolutionized molecular biology and been widely adopted as tools for engineering genomes at a speed that was previously unfeasible1. The first modification of a Saccharomyces cerevisiae genome by the CRISPR/Cas9 genome editing system was reported by DiCarlo et al.2, demonstrating successful gene knock-out and making point mutations using externally introduced oligonucleotides. Further yeast CRISPR toolbox developments included: transcriptional regulation by fusion of catalytically inactive dead Cas9 (dCas9) with transcriptional effector domains to enable activation and silencing of transcription3, application for both genome editing and regulatory functions for metabolic pathway engineering by simultaneous activation, repression and deletion4, deletion of large fragments from the S. cerevisiae genome5, and multiple-chromosome fusions6.
CRISPR/Cas genome editing systems find their origin in adaptive immune systems of bacteria and archaea and these systems have been adapted by molecular biologists for genome editing. Their functionality is based on the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) DNA regions encoding RNA responsible for the recognition of the foreign DNA or RNA and the CRISPR associated genes (Cas) which encodes RNA-guided endonucleases1,7,8,9. Based on the recent genome analysis of CRISPR/Cas systems it was proposed to divide the CRISPR/Cas systems into two classes, five types and 16 subtypes10. The two classes are distinguished based on the organization of effector complexes involved in target cleavage. Typically, CRISPR/Cas systems with a multi-subunit organisation are categorized as class 1, whereas single subunit effector complexes belong to class 210,11. In this paper, we explore the class 2 type V Cas12a, formerly called Cpf110,12, which is an alternative to the class 2 type II Cas9. Although Cas9 is well-characterized and widely used in research, Cas12a offers additional features12. Firstly, Cas12a forms a complex with CRISPR RNA (crRNA) of 42 to 44 nucleotides without requiring an additional trans-activating CRISPR RNA (tracrRNA). Therefore, a shorter guide RNA can be utilized in genome editing with CRISPR/Cas12a systems compared to CRISPR/Cas9. Secondly, the unique endonuclease and endoribonuclease activity of Cas12a enables maturation of its pre-crRNA13. This RNase activity allows for the encoding of multiple crRNAs on a single CRISPR crRNA array, whereas Cas9 requires the separate expression of each so-called single-guide RNA (sgRNA) or alternatively for example expression of an additional endonuclease (e.g., Csy4) in combination with recognition motifs for Csy4 surrounding each sgRNA14,15. Thirdly, Cas12a target site recognition requires a protospacer adjacent motif (PAM) at the 5’ end from the target and cleaves after the +18/+23 position from its PAM resulting in cleaved DNA with sticky ends, whereas Cas9 requires a PAM located on the 3’ end from the target and cleaves after the -3 position creating blunt end cuts in the DNA12. Fourthly, the consensus nucleotide sequence of the PAM differs between Cas12a ((T)TTV) and Cas9 (NGG), which makes Cas12a a promising candidate for targeting T-rich promoter and terminator sequences16. Finally, a recent study reported greater target specificity for Cas12a than for the native Cas917.
We present a protocol for using the CRISPR/Cas12a system for genome editing of S. cerevisiae with a particular focus on the introduction of multiple DNA expression cassettes into independent genomic loci simultaneously (multiplex genome editing) using a single crRNA array. The key steps of the protocol are depicted in Figure 1. As a proof of concept, the CRISPR/Cas12a system was applied for introduction of three expression cassettes into the genome of S. cerevisiae which enable the production of β-carotene18 as schematically shown in Figure 2. Production of β-carotene affects the phenotype of S. cerevisiae: i.e., upon successful introduction of all three heterologous genes required for carotenoids biosynthesis, the white S. cerevisiae cells turn yellow or orange, depending on the expression strength of each gene’s promoter. Due to the simple visual read-out of this pathway, it has been introduced to develop advanced CRISPR-based systems and methods for genome editing19,20. In this work, expression cassettes encoding the carotenoid genes crtE, crtYB and crtI have been constructed using a Golden Gate cloning (GGC) approach21 with heterologous promoters and homologous terminators used to drive expression of the genes. The expression cassettes are surrounded by unique 50-base pairs (bp) sequences, called connectors, that allow for in vivo assembly with integration flank DNA sequences (flanking regions) with the same 50-bp sequences, and subsequent integration into the genomic DNA of yeast at the position determined by the flanking regions. By using different promoter strengths, strains with different levels of carotenoids production were obtained resulting in variation in color of the cells. These strains - inspired by the “Yeast Art Project”22 - were used in a spotting setup with an acoustic liquid handler to create a 4-color high-resolution “yeast photograph” of Rosalind Franklin. Franklin (1920-1958) was an English chemist and X-ray crystallographer well known for her contribution to the discovery of the DNA structure by Photo 5123,24,25.
1. Preparation of the Cas12a plasmids
NOTE: The plasmid containing the Lachnospiraceae bacterium ND2006 Cas12a (LbCpf1, pCSN067) codon optimized for expression in S. cerevisiae, was previously constructed19, deposited at a plasmid repository (see the Table of Materials). This is a single-copy episomal S. cerevisiae/E. coli shuttle plasmid containing a KanMX resistance marker gene to allow for selection of S. cerevisiae transformants on geneticin (G418).
2. Preparation of the single crRNA array expression cassette
3. Preparation of Promoter-ORF-Terminator (POT) donor DNA constructs
4. Preparation of integration flank DNA sequences containing connectors sequences
5. Transformation to S. cerevisiae
NOTE: Perform transformation using a protocol based on the methods developed by Gietz et al. (1995)30 and Hill et al.31 which can be used for various strains of S. cerevisiae. The protocol described below is sufficient for 1 transformation.
6. Evaluation of the genome editing efficiency
7. Confirmation of integration of donor DNA at the intended loci
8. Creation of yeast pixel art using an acoustic liquid handler
The protocol for multiplex genome editing using CRISRP/Cas12a was demonstrated by constructing three carotenoid producing S. cerevisiae strains expressing the crtE, crtYB and crtI genes using heterologous promoters of high, medium and low strength: strain 1, 2 and, 3 respectively (Supplementary Table 3). Construction of these strains required generation of three donor DNA expression cassettes and six flanking regions per strain for targeting to three different loci in genomic DNA (shown in Figure 2B). As described herein, promoter, open reading frame, terminator and two contiguous 50-bp connectors sequences were assembled into an expression cassette via a Golden Gate Cloning reaction and the assembly was verified by PCR (Figure 3A). The single crRNA array was ordered as a synthetic DNA fragment and was amplified by PCR (Figure 3B). The recipient plasmid for the single crRNA array (plasmid pRN1120) was linearized with EcoRI-HF and XhoI and linearization was confirmed by electrophoresis (Figure 3C). The design and nucleotide sequences of the introduced donor DNA expression cassettes and flanking regions are shown in Supplementary Table 3 and Supplementary Table 4. The sequence of single crRNA array expression cassettes is provided in Supplementary Table 1. Functionality of the spacers included in the single crRNA array was tested beforehand by singleplex genome editing with individual crRNAs19.
The efficiency of genome editing using Cas12a was firstly evaluated based on the number of colored colonies obtained after transformation (Table 1, Figure 4). The editing efficiency of the three constructed strains varied from 50% to 94%. Notably, introduction of expression cassettes used to generate strain 1 displayed the lowest editing efficiency, possibly caused by the nature of the donor DNA (i.e., these expression cassettes encode crtE, crtYB and crtI from three high strength promoters). Secondly, correct integration of the three donor DNA expression cassettes at the intended loci on the genomic DNA was confirmed by PCR (Figure 5). Primers were designed in such a way that PCR products were obtained when correct integration of donor DNA at the intended locus occurred. For each transformation experiment, eight colonies were picked from the transformation plate and tested (note that only three are presented in Figure 5). In general, out of 8 colonies tested per donor DNA, correct integration of the crtE donor DNA at the INT1 locus, crtYB at the INT2 locus and crtI at the INT3 locus was confirmed in >90% of the transformants. These results demonstrate the CRISPR/Cas12a system in combination with a single crRNA array enables efficient multiplex editing of the S. cerevisiae genome at multiple loci simultaneously.
Additionally, we demonstrate the creation of “yeast pixel art” using the three carotenoid producing strains that were constructed together with a non-colored wild-type strain. Starting from a black and white picture of Rosalind Franklin (Figure 6A), a 4-color picture (Figure 6B) and spotting list was created which was then used to spot the four different yeast strains on an agar microplate using an acoustic liquid handler, resulting in a high-resolution “yeast painting” of Rosalind Franklin (Figure 6C,D,E).
Figure 1: Workflow of the protocol for CRISPR/Cas12a multiplex genome editing in S. cerevisiae. The workflow includes crucial steps of the presented method. For details see the Protocol. Please click here to view a larger version of this figure.
Figure 2: Scheme of CRISPR/Cas12a multiplex genome editing using a single crRNA array. (A) The single crRNA array is composed of three crRNAs units in their mature form, a 20-bp direct repeat specific for LbCas12a (grey squares) with a 23-bp guide sequence (colored diamonds). Expression of the crRNA array is enabled by the SNR52 promoter and SUP4 terminator. Transformation of S. cerevisiae with a linearized pRN1120 and the single crRNA array expression cassette containing homology with pRN1120 (diagonal stripes) allows for in vivo recombination into a circular plasmid in cells pre-expressing LbCas12a. The single crRNA array is subsequently processed by Cas12a. (B) Cas12a is directed to the intended INT1, INT2 and INT3 genomic target sites and creates double stranded breaks. In the transformation mixture, donor DNA consisting of flanking regions and the carotenoid gene expression cassette were included. Donor DNA assemblies were targeted to one stretch of DNA in genomic DNA around the INT1 (crtE), INT2 (crtYB) and INT3 (crtI) loci by in vivo recombination due to the presence of 50-bp homologous connectors sequences, indicated as 5, A, B, C, D or E. P1–P3, different promoters; T1–T3, different terminators. This figure has been modified from Verwaal et al. 201819. Genetic constructs shown using Synthetic Biology Open Language (SBOL) Visual symbols40. Please click here to view a larger version of this figure.
Figure 3: PCR verifying the genome editing experiments. (A) Verification of Golden Gate Cloning reactions of assembled donor DNA cassettes. Obtained results are in agreement with expected lengths. (B) PCR of the single crRNA array. (C) Linearization of plasmid pRN1120. Please click here to view a larger version of this figure.
Figure 4: Plates of S. cerevisiae transformations using the multiplex genome editing approach. (A) Strain 1 expressing crtE, crtYB and crtI from three strong promoters (dark orange colonies). (B) Strain 2 expressing crtE, crtYB and crtI from three medium strength promoters (orange colonies). (C) Strain 3 expressing crtE, crtYB and crtI from three low strength promoters (yellow colonies). Please click here to view a larger version of this figure.
Figure 5: PCR verifying integration of the donor DNA expression cassettes at the intended loci within the genomic DNA. (A) Verification of three colonies of the strain 1. (B) Verification of three colonies of the strain 2. (C) Verification of three colonies of the strain 3. Please click here to view a larger version of this figure.
Figure 6: Yeast pixel art of Rosalind Franklin. (A) Black and white RGB photo of 220 × 280 pixels of Rosalind Franklin that was used as a template. (B) Computer conversion of the black and white photo of Rosalind Franklin into a 4-color 64 × 96 pixel list. (C) Photo of yeast pixel art with 64 × 96 yeast colonies with a zoomed-in section. (D) Photo of an acoustic liquid handler with two full grown plates. (E) Photo of a full grown microplate with 64 × 96 yeast colonies. Please click here to view a larger version of this figure.
Strain 1 | Strain 2 | Strain 3 | |
Colored colonies | 16 | 279 | 220 |
White colonies | 16 | 18 | 18 |
Total colonies | 32 | 297 | 238 |
Efficiency | 50% | 94% | 92% |
Table 1: Editing efficiency of the multiplex genome editing approach.
crRNA array sequencea,b,c,d,e,f |
CATGTTTGACAGCTTATCATCGATAATCCGGAGCTAGCATGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGTCTTTGAAAA GATAATGTATGATTATGCTTTCACTCATATTTATACAGAAACTTGATGTTTTCTTTCGAGTATATACAAGG TGATTACATGTACGTTTGAAGTACAACTCTAGATTTTGTAGTGCCCTCTTGGGCTAGCGGTAAAGGTGCGCA TTTTTTCACACCCTACAATGTTCTGTTCAAAAGATTTTGGTCAAACGCTGTAGAAGTGAAAGTTGGTGCGC ATGTTTCGGCGTTCGAAACTTCTCCGCAGTGAAAGATAAATGATCAATTTCTACTAAGTGTAGAT CTGGTGGGAGAGAAAGCTTATGAAATTTCTACTAAGTGTAGATGTGCCGTAC GCCGGAGCCGACGGAATTTCTACTAAGTGTAGATTGCCCCTCTTATACGATTATATTTT TTTTTGTTTTTTATGTCTGGGGGGCCCGGTACCCAGCTTTTGTTCCCTTTAGTGAGG GTTAATTCCGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTG |
a. Homology to pRN1120 (bold). b. SNR52 promoter (italics). c. Genomic target sequences (underlined). d. Guide direct repeats specific for LbCas12a (italics, bold). e. SUP4 terminator (italics). f. Homology to pRN1120 (bold). |
Supplementary Table 1: Single crRNA array for LbCas12a containing homology with plasmid pRN1120.
Name | Sequencea | Descriptionb | Used in point |
KC-101 | CATGTTTGACAGCTTATCATC | FW primer for amplification of single crRNA array | 2.1.4 |
KC-102 | CACACAGGAAACAGCTATGAC | RV primer for amplification of single crRNA array | 2.1.4 |
KC-103 | AAGCGACTTCCAATCGCTTTGC | FW primer for amplification of donor DNA with connector 5 | 3.6.1 |
KC-104 | AAAGCAAAGGAAGGAGAGAAC | RV primer for amplification of donor DNA with connector A | 3.6.1 |
KC-105 | CGGATCGATGTACACAACCG | FW primer for amplification of donor DNA with connector B | 3.6.1 |
KC-106 | CAACAGGAGGCGGATGGATATAC | RV primer for amplification of donor DNA with connector C | 3.6.1 |
KC-107 | AACGTTGTCCAGGTTTGTATCC | FW primer for amplification of donor DNA with connector D | 3.6.1 |
KC-108 | AGGTACAACAAGCACGACCG | RV primer for amplification of donor DNA with connector E | 3.6.1 |
KC-109 | CACTATAGCAATCTGGCTATATG | FW primer for amplification of INT1 5' with connector 5 | 4.4 |
KC-110 | AAACGCCTGTGGGTGTGGTAC TGGATATGCAAAGCGATTGGAA GTCGCTTGACTCCTCTGCCGTC ATTCC | RV primer for amplification of INT1 5' with connector 5 | 4.4 |
KC-111 | TTGCCCATCGAACGTACAAG TACTCCTCTGTTCTCTCCTTCCTT TGCTTTAAGCGTTGAAGTTTCCTC TTTG | FW primer for amplification of INT1 3' with connector A | 4.4 |
KC-112 | TGTCAACTGGAGAGCTATCG | RV primer for amplification of INT1 3' with connector A | 4.4 |
KC-113 | AGAAGATTTCTCTTCAATCTC | FW primer for amplification of INT2 5' with connector B | 4.4 |
KC-114 | TGCTAAGATTTGTGTTCGTT TGGGTGCAGTCGGTTGTGTACAT CGATCCGCCCTTATCAAGGATACC TGGTTG | RV primer for amplification of INT2 5' with connector B | 4.4 |
KC-115 | ACGCTTTCCGGCATCTTCCA GACCACAGTATATCCATCCGCCT CCTGTTGGGCGATTACACAAGCG GTGG | FW primer for amplification of INT2 3' with connector C | 4.4 |
KC-116 | TCTCCTCTTCGATGACCGGG | RV primer for amplification of INT2 3' with connector C | 4.4 |
KC-117 | GGTCGTTTTTGTGCAGCATATTG | FW primer for amplification of INT3 5' with connector D | 4.4 |
KC-118 | GCGGAATATTGGCGGAACGG ACACACGTGGATACAAACCTG GACAACGTTTTCCAAGGAGGTG AAGAACG | RV primer for amplification of INT3 5' with connector D | 4.4 |
KC-119 | AAATAACCACAAACATCCTT CCCATATGCTCGGTCGTGCTTGTT GTACCTGATGGGACGTCAGCACT GTAC | FW primer for amplification of INT3 3' with connector E | 4.4 |
KC-120 | GAGCTTACTCTATATATTCATTC | RV primer for amplification of INT3 3' with connector E | 4.4 |
KC-121 | GTTACTAAACTGGAACTGTCCG | FW primer for verification of integration of con5-crtE-conA to INT1 5' | 7.4.1 |
KC-122 | CACTGCTAACTACGTTTACTTC | FW primer for verification of integration of con5-crtE-conA to INT1 3' | 7.4.1 |
KC-123 | CACTGGAACTTGAGCTTGAG | FW primer for verification of integration of conB-crtYB-conC to INT2 5' | 7.4.1 |
KC-124 | GTCTCCAGCTGAATTGGTCC | FW primer for verification of integration of conB-crtYB-conC to INT2 3' | 7.4.1 |
KC-125 | CTCTCATGAAGCAGTCAAGTC | FW primer for verification of integration of conD-crtI-conE to INT3 5' | 7.4.1 |
KC-126 | GATCGGTCAATTAGGTGAAG | FW primer for verification of integration of conD-crtI-conE to INT3 3' | 7.4.1 |
KC-127 | CCTTGTCCAAGTAGGTGTCC | RV primer for verification of integration of con5-crtE-conA to INT1 5' | 7.4.1 |
KC-128 | GCTGTCATGATCTGTGATAAC | RV primer for verification of integration of con5-crtE-conA to INT1 3' | 7.4.1 |
KC-129 | CTGGCAATGTTGACCAATTGC | RV primer for verification of integration of conB-crtYB-conC to INT2 5' | 7.4.1 |
KC-130 | CCAACGTGCCTTAAAGTCTG | RV primer for verification of integration of conB-crtYB-conC to INT2 3' | 7.4.1 |
KC-131 | CCTTACCTTCTGGAGCAGCAG | RV primer for verification of integration of conD-crtI-conE to INT3 5' | 7.4.1 |
KC-132 | CTGGTTACTTCCCTAAGACTG | RV primer for verification of integration of conD-crtI-conE to INT3 3' | 7.4.1 |
a. Bold sequences denote connector sequences. b. Forward and reverse primers are designated as FW and RV, respectively. |
Supplementary Table 2: Primer sequences.
Supplementary Table 3: Design of constructed strains.
Supplementary Table 4: Sequences of donor DNA expression cassettes and flaking regions. Please click here to download this file.
The provided protocol describes multiplex genome editing of S. cerevisiae using Cas12a from Lachnospiraceae bacterium ND2006 in combination with a single crRNA array and donor DNA. Design of the single crRNA array and donor DNA is explained in detail. In contrast to the well-established CRISPR/Cas9 system, the CRISPR/Cas12a has the unique additional ability of processing multiple crRNAs expressed from a single crRNA array13,33. Due to this feature, simultaneous editing of multiple targets is easier to set up and can be achieved in a single transformation. This single crRNA array approach was demonstrated before by Zetsche et al.34 who simultaneously edited up to four genes in mammalian cells using AsCas12a, and by Swiat et al.35 who introduced four DNA fragments into a yeast genome using FnCas12a. To our knowledge, a higher number of simultaneous genomic modifications using a Cas12a system has not been reported and the maximal limit of targets per single array for Cas12a is yet to be determined. Further research utilizing single crRNA arrays in combination with Cas12a includes multiplex transcriptional regulation in a wide range of organisms33,36,37.
There are some critical steps in the presented protocol. Carefully design all DNA sequences that are involved in the Cas12a genome editing experiment, especially in case when novel DNA sequences are introduced. Determine the functionality of new spacer sequences part of a crRNA, for example by a singleplex genome editing experiment as described by Verwaal et al.19 before combining them into a single crRNA array. Follow the recommendations for the preparation of transformation buffer solutions used in the Cas12a editing experiment to achieve a good transformation efficiency of yeast.
There are some optional modifications of the technique. It is recommended to use 1 µg of each donor DNA, linearized pRN1120 or single crRNA array expression cassette in the transformation, although the use of a lower DNA amount is also expected to result in a satisfactory transformation efficiency. Perform a test transformation to determine whether lower DNA amounts can be used. The transformation of S. cerevisiae might be performed using a different method than the one described in this protocol, for example the protocol described by Gietz et al. (2007)38. The guide RNA recipient plasmid pRN1120 is suitable for the expression of a single crRNA and single crRNA array of different Cas12a variants (e.g., from Acidaminococcus spp. BV3L6 or Francisella novicida U112) as well as for expression of sgRNA in combination with Cas919. The donor DNA does not need to be limited to carotenoid gene expression cassettes and flanking regions that target donor DNA to the described INT1, INT2 and INT3 sites in genomic DNA. Any DNA of interest can be introduced, in a multiplex manner, into genomic DNA of the host by the design principles described in this protocol, or alternatively donor DNA can be used to delete DNA from a host genome. The modular structure of single crRNA array facilitates easy adjustment of spacer and direct repeat sequences. Modification of spacer sequences allows for a change of the intended integration locus which can be designed by one of the tools for identification of a genomic target site, e.g. GuideScan software 1.039. Instead of using large flanking sequences that contain connectors sequences, 50-bp of the flanking region can be included in the donor DNA sequences by incorporating these 50-bp flanking region sequences in the primers used in the PCR. In this case, in total just three instead of nine donor DNA fragments are required for a successful multiplex genome editing experiment.
In summary, this protocol provides step-by-step directions to perform multiplex genome editing in S. cerevisiae using Cas12a in combination with a single crRNA array approach. The protocol was demonstrated by multiplex genome editing using 9 donor DNA fragments and single crRNA array coding for three gRNAs. We show high overall editing frequencies between 50% and 94% for the three strain designs reported here. Concluding, the unique feature of Cas12a is the ability to process a single crRNA array into individual crRNAs in a cell, which makes Cas12a an excellent tool to enable multiplex genome editing and develop transcriptional regulation modules targeting multiple expression cassettes in one go. In the end, three strains were obtained producing carotenoids at a different level and colors in shades between yellow and orange. With those strains and a wild-type strain, we showed how an acoustic liquid handler can be used straightforwardly to make yeast pixel art – this in honor of Rosalind Franklin who contributed to the discovery of the DNA structure 65 years ago by her famous photo 5123.
The authors declare that there is a conflict of interest. The authors have filed IP related to presented methods.
This project received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement no. 686070 (DD-DeCaf) and 764591 (SynCrop), and from the research programme Building Blocks of Life with project number 737.016.005 by the Netherlands Organisation for Scientific Research (NWO). T.E.G. was supported by the Royal Society (grant UF160357) and BrisSynBio, a BBSRC/EPSRC Synthetic Biology Research Centre (grant BB/L01386X/1). We thank Zi Di and Jeffrey van Wijk for their contribution to the yeast spotting experiments for creating the yeast pixel art.
Name | Company | Catalog Number | Comments |
Chemicals specific for the protocol | |||
1 Kb Plus DNA Ladder | Thermo Fisher Scientific | 10787018 | Electrophoresis |
Ampicillin sodium salt | Sigma Aldrich | A9518 | Selection of E. coli transformants |
BsaI-HF (20 U/µl) | New England BioLabs | R353L | Golden Gate Cloning |
Cell Lysis Solution (from kit Puregene Yeast/Bact. Kit B) | QIAGEN | 854016 | Isolation of genomic DNA from S. cerevisiae |
CutSmart Buffer | New England BioLabs | B7204S | Linearization of pRN1120 |
Deoxyribonucleic acid sodium salt from salmon testes | Sigma Aldrich | D1626 | Transfromation of S. cerevisiae (carrier DNA) |
dNTPs | Invitrogen | 10297018 | PCRs |
EcoRI-HF | New England BioLabs | R3101S | Linearization of pRN1120 |
Ethanol absolute for analysis | Merck | 100983 | Isolation of genomic DNA from S. cerevisiae |
Ethylenediamine-tetraacetic acid | Sigma Aldrich | ED | Transformation of S. cerevisiae |
G418 disulfate salt | Sigma Aldrich | A1720 | Selection of S. cerevisiae transformants |
Histodenz | Sigma Aldrich | D2158 | Yeast pixel art |
Isopropanol | Merck | 100993 | Isolation of genomic DNA from S. cerevisiae |
Lithium acetate dihydrate | Sigma Aldrich | L6883 | Transformation of S. cerevisiae |
Nancy-520 DNA Gel Stain | Sigma Aldrich | 1494 | Electrophoresis |
NEB10 competent E. coli cells | New England BioLabs | C3019H | Transformation of E. coli: dx.doi.org/10.17504/protocols.io.nkvdcw6 |
Nourseothricin | Jena Bioscience | AB102 | Selection of S. cerevisiae transformants |
Phusion buffer | New England BioLabs | M0530L | PCRs |
Phusion High-Fidelity DNA Polymerase | New England BioLabs | M0530L | PCRs |
Polyethylene glycol 4000 | Merck | 7490 | Transformation of S. cerevisiae |
Protein Precipitation Solution (10 M NH4AC) (from kit Puregene Yeast/Bact. Kit B) | QIAGEN | 854016 | Isolation of genomic DNA from S. cerevisiae |
Purple loading dye | New England BioLabs | B7024S | Electrophoresis |
QIAprep Spin Miniprep Kit | QIAGEN | 27106 | Purification of plasmids |
RNase coctail enzyme mix | Thermo Fisher Scientific | AM2286 | Isolation of genomic DNA from S. cerevisiae |
T4 DNA ligase buffer | Invitrogen | 46300-018 | Golden Gate Cloning |
T4 DNA Ligase (1 U/µl) | Invitrogen | 1705218 | Golden Gate Cloning |
UltraPure Agarose | Invitrogen | 16500500 | Electrophoresis |
Wizard SV Gel and PCR Clean-Up System Kit | Promega | A9282 | Purification of PCR products and linearized pRN1120 |
Xhol | New England BioLabs | R0146S | Linearization of pRN1120 |
Zymolyase 50 mg/ml (5 units/µL) | Zymo Research | E1006 | Isolation of genomic DNA from S. cerevisiae (yeast lysis enzyme) |
Zymolyase storage buffer | Zymo Research | E1004-B | Isolation of genomic DNA from S. cerevisiae (necessary for the preparation of yeast lysis enzyme) |
Chemicals of general use | |||
2*Peptone-Yeast extract (PY) agar | Plate growth of E. coli | ||
2*PY medium | Cultivation of E. coli | ||
Demineralized water | Transformation of S. cerevisiae | ||
ELFO buffer | Electrophoresis | ||
MQ | Multiple steps | ||
Physiological salt solution | Transformation of S. cerevisiae | ||
TE buffer | Storage of DNA, transformation of S. cerevisiae | ||
Yeast extract-peptone-dextrose (YEPD; 2% glucose) medium | Cultivation of S. cerevisiae | ||
YEPD (2% glucose) agar | Plate growth of S. cerevisiae | ||
Consumables | |||
Eppendorf tubes | |||
Falcon tubes (50 mL) | |||
Microplate 96 wells | |||
Petri dishes | |||
Pipette tips 0.5 - 10 µL | |||
Pipette tips 10 - 200 µL | |||
Pipette tips 100 - 1000 µL | |||
Shake flasks (500 mL) | |||
Sterile filters | |||
Equipment | |||
Centrifuge (Falcon tubes) | |||
Echo 525 acoustic liquid handler | |||
Incubator | |||
NanoDrop | |||
Set for eletrophoresis | |||
Spectrophotometer | |||
Table centrifuge (Eppendorfs tubes) | |||
Thermocycler | |||
Plasmids | |||
pCSN067 | Addgene | ID 101748 | https://www.addgene.org/ |
pRN1120 | Addgene | ID 101750 | https://www.addgene.org/ |
Strains | |||
S. cerevisiae strain CEN.PK113-7D | EUROSCARF collection | http://www.euroscarf.de |
Request permission to reuse the text or figures of this JoVE article
Request PermissionThis article has been published
Video Coming Soon
Copyright © 2025 MyJoVE Corporation. All rights reserved