Use of Bisection to Reduce Mitochondrial DNA in the Bovine Oocyte

Summary

Here, we present a protocol to significantly reduce the mitochondrial DNA copy numbers in a bovine oocyte (P < 0.0001). This method utilizes centrifugation and bisection to substantially reduce oocyte mitochondria and may allow for an increased chance of development in the reconstructed interspecies somatic cell nuclear transfer embryos.

Abstract

Interspecies somatic cell nuclear transfer (iSCNT) may be used to rescue endangered species, but two distinct populations of mitochondrial DNA (mtDNA) exist within the reconstructed embryo: one within the recipient ooplasm and one within the donor somatic cell. This mitochondrial heteroplasmy can lead to developmental issues in the embryo and the fetus. Handmade cloning protocols include oocyte bisection, which can be used to decrease the mtDNA copy number, reducing the degree of mitochondrial heteroplasmy in a reconstructed embryo. Centrifugation of denuded, mature bovine oocytes produced a visible mitochondria-dense fraction at one pole of the oocyte. Oocytes' zonae pellucidae were removed by exposure to a pronase solution. Bisection was performed using a microblade to remove the visible mitochondria fraction. qPCR was used to quantify the mtDNA present in DNA samples extracted from whole oocytes and bisected ooplasts, providing a comparison of mtDNA copy numbers before and after bisection. Copy numbers were calculated using cycle threshold values, a standard curve's regression line formula, and a ratio that included the respective sizes of mtDNA PCR products and genomic PCR products. One bovine oocyte had an average mtDNA copy number (± standard deviation) of 137,904 ± 94,768 (n = 38). One mitochondria-depleted ooplast had an average mtDNA copy number of 8,442 ± 13,806 (n = 33). Average mtDNA copies present in a mitochondria-rich ooplast were 79,390 ± 58,526 mtDNA copies (n = 28). The differences between these calculated averages indicate that the centrifugation and subsequent bisection can significantly decrease the mtDNA copy numbers present in the mitochondria-depleted ooplast when compared to the original oocyte (P < 0.0001, determined by one-way ANOVA). The reduction in mtDNA should decrease the degree of mitochondrial heteroplasmy in a reconstructed embryo, possibly fostering standard embryonic and fetal development. Supplementation with mitochondrial extract from the somatic donor cell may also be essential to achieve successful embryonic development.

Introduction

Somatic cell nuclear transfer (SCNT) includes the fusion of an enucleated oocyte from one animal and a somatic cell from an animal of the same species. In most cases, the oocyte and somatic cell originate from the same species, and live birth rates are below 6%¹. Some research involves the use of interspecies SCNT (iSCNT), which includes the fusion of a somatic cell and oocyte that originate from two different species. In these studies, live birth rates are even lower than in SCNT-typically less than 1%¹. However, iSCNT has the capacity to be used as a method of rescuing endangered species, since somatic cells from these....

Protocol

The following protocol follows the animal care and ethics guidelines provided by Utah State University.

1. Media preparation

1. Prior to oocyte handling, prepare the following solutions, as described in Table 1: 400 µL of Hyaluronidase Solution, 500 µL of T2 media, 1,020 µL of T20 media, and 800 µL of T10 media.
2. Divide the T10 media into two wells of a four-well plate, 400 µL per well. Label one well with "M" and the second well with "MR." Place in a 5% CO₂ incubator until after bisection.
3. Prepare 500 µL of Cytochalasin B ....

Results

Quantitative PCR (qPCR) results are used to determine the relative quantities of mtDNA present in each ooplast. The described reaction is designed to amplify the 12S region of bovine mtDNA.

If the bisection was successful, the samples from whole oocytes and mitochondria-dense ooplasts will have similar C_t values. The samples from mitochondria-reduced ooplasts will have higher C_t values when compared to the samples from the other two groups. A C_t graph showing s.......

Discussion

Methods previously used to decrease mtDNA copy numbers in oocytes have their respective disadvantages. Micromanipulation-based removal of mitochondria from oocytes decrease mtDNA copy numbers by an average of 64%²⁷. A unique method, previously used for enucleation, involves the use of small diameter Pasteur pipettes and the splitting of a zona pellucida-free oocyte at the border between a microdrop of media and the surrounding mineral oil. Along with the utilization of oocyte centrifugation, this .......

Materials

Name	Company	Catalog Number	Comments
1.5 mL centrifuge tubes	Fisher Scientific	5408129
60 mm dish	Sigma-Aldrich	D8054
Centrifuge	Eppendorf	5424
Cytochalasin B	Sigma-Aldrich	C6762
Fetal Bovine Serum	Sigma-Aldrich	F2442
M199 Media	Sigma-Aldrich	M4530
Mineral Oil	Sigma-Aldrich	M8410
Mini Centrifuge	SCILOGEX	D1008
mtDNA Primer: Forward (12S)			GGGCTACATTCTCTACACCAAG
mtDNA Primer: Reverse (12S)			GTGCTTCATGGCCTAATTCAAC
NanoDrop Spectrophotometer	Thermo Scientific	ND2000
Opthalmic Scalpel with Aluminum Handle	PFM Medical	207300633	Microblade for bisection
Protease/pronase	Sigma-Aldrich	P5147
QIAamp DNA Micro Kit	Qiagen	56304
QuantStudio™ 3 - 96-Well 0.2-mL	ThermoFisher	A28567
Search plate	Fisher Scientific	FB0875711A
SYBR Green qPCR Master Mix	ThermoFisher	K0221	qPCR master mix
Synthetic Oviductal Fluid with HEPES (HSOF)
ThermoPlate	Tokai Hit	TPi-SMZSSX	Heating stage