A subscription to JoVE is required to view this content. Sign in or start your free trial.
* These authors contributed equally
Here, we present a protocol to significantly reduce the mitochondrial DNA copy numbers in a bovine oocyte (P < 0.0001). This method utilizes centrifugation and bisection to substantially reduce oocyte mitochondria and may allow for an increased chance of development in the reconstructed interspecies somatic cell nuclear transfer embryos.
Interspecies somatic cell nuclear transfer (iSCNT) may be used to rescue endangered species, but two distinct populations of mitochondrial DNA (mtDNA) exist within the reconstructed embryo: one within the recipient ooplasm and one within the donor somatic cell. This mitochondrial heteroplasmy can lead to developmental issues in the embryo and the fetus. Handmade cloning protocols include oocyte bisection, which can be used to decrease the mtDNA copy number, reducing the degree of mitochondrial heteroplasmy in a reconstructed embryo. Centrifugation of denuded, mature bovine oocytes produced a visible mitochondria-dense fraction at one pole of the oocyte. Oocytes' zonae pellucidae were removed by exposure to a pronase solution. Bisection was performed using a microblade to remove the visible mitochondria fraction. qPCR was used to quantify the mtDNA present in DNA samples extracted from whole oocytes and bisected ooplasts, providing a comparison of mtDNA copy numbers before and after bisection. Copy numbers were calculated using cycle threshold values, a standard curve's regression line formula, and a ratio that included the respective sizes of mtDNA PCR products and genomic PCR products. One bovine oocyte had an average mtDNA copy number (± standard deviation) of 137,904 ± 94,768 (n = 38). One mitochondria-depleted ooplast had an average mtDNA copy number of 8,442 ± 13,806 (n = 33). Average mtDNA copies present in a mitochondria-rich ooplast were 79,390 ± 58,526 mtDNA copies (n = 28). The differences between these calculated averages indicate that the centrifugation and subsequent bisection can significantly decrease the mtDNA copy numbers present in the mitochondria-depleted ooplast when compared to the original oocyte (P < 0.0001, determined by one-way ANOVA). The reduction in mtDNA should decrease the degree of mitochondrial heteroplasmy in a reconstructed embryo, possibly fostering standard embryonic and fetal development. Supplementation with mitochondrial extract from the somatic donor cell may also be essential to achieve successful embryonic development.
Somatic cell nuclear transfer (SCNT) includes the fusion of an enucleated oocyte from one animal and a somatic cell from an animal of the same species. In most cases, the oocyte and somatic cell originate from the same species, and live birth rates are below 6%1. Some research involves the use of interspecies SCNT (iSCNT), which includes the fusion of a somatic cell and oocyte that originate from two different species. In these studies, live birth rates are even lower than in SCNT-typically less than 1%1. However, iSCNT has the capacity to be used as a method of rescuing endangered species, since somatic cells from these....
The following protocol follows the animal care and ethics guidelines provided by Utah State University.
1. Media preparation
Quantitative PCR (qPCR) results are used to determine the relative quantities of mtDNA present in each ooplast. The described reaction is designed to amplify the 12S region of bovine mtDNA.
If the bisection was successful, the samples from whole oocytes and mitochondria-dense ooplasts will have similar Ct values. The samples from mitochondria-reduced ooplasts will have higher Ct values when compared to the samples from the other two groups. A Ct graph showing s.......
Methods previously used to decrease mtDNA copy numbers in oocytes have their respective disadvantages. Micromanipulation-based removal of mitochondria from oocytes decrease mtDNA copy numbers by an average of 64%27. A unique method, previously used for enucleation, involves the use of small diameter Pasteur pipettes and the splitting of a zona pellucida-free oocyte at the border between a microdrop of media and the surrounding mineral oil. Along with the utilization of oocyte centrifugation, this .......
The authors wish to thank their colleagues at Utah State University, the Reproductive Science researchers at the San Diego Zoo, and Dr. Rebecca Krisher at Genus PLC.
....Name | Company | Catalog Number | Comments |
1.5 mL centrifuge tubes | Fisher Scientific | 5408129 | |
60 mm dish | Sigma-Aldrich | D8054 | |
Centrifuge | Eppendorf | 5424 | |
Cytochalasin B | Sigma-Aldrich | C6762 | |
Fetal Bovine Serum | Sigma-Aldrich | F2442 | |
M199 Media | Sigma-Aldrich | M4530 | |
Mineral Oil | Sigma-Aldrich | M8410 | |
Mini Centrifuge | SCILOGEX | D1008 | |
mtDNA Primer: Forward (12S) | GGGCTACATTCTCTACACCAAG | ||
mtDNA Primer: Reverse (12S) | GTGCTTCATGGCCTAATTCAAC | ||
NanoDrop Spectrophotometer | Thermo Scientific | ND2000 | |
Opthalmic Scalpel with Aluminum Handle | PFM Medical | 207300633 | Microblade for bisection |
Protease/pronase | Sigma-Aldrich | P5147 | |
QIAamp DNA Micro Kit | Qiagen | 56304 | |
QuantStudio™ 3 - 96-Well 0.2-mL | ThermoFisher | A28567 | |
Search plate | Fisher Scientific | FB0875711A | |
SYBR Green qPCR Master Mix | ThermoFisher | K0221 | qPCR master mix |
Synthetic Oviductal Fluid with HEPES (HSOF) | |||
ThermoPlate | Tokai Hit | TPi-SMZSSX | Heating stage |
This article has been published
Video Coming Soon
ISSN 2578-2746
ABOUT JoVE
Copyright © 2025 MyJoVE Corporation. All rights reserved
We use cookies to enhance your experience on our website.
By continuing to use our website or clicking “Continue”, you are agreeing to accept our cookies.