Tüm hayvan kullanım prosedürleri yerel yönetim organı (Regierungspräsidium Karlsruhe, Karlsruhe, Almanya) tarafından belirlenen etik kurallara uygun idi. 1.. SiRNA / PEI Kompleksi hazırlanması SiRNA / PEI kompleks çözeltisi aşağıdaki gibi üreticinin talimatlarını kullanarak hazırlanır: <ol><li> Çözelti A: uç hacminin dörtte birine kadar steril su ile siRNA istenilen miktarda (eğer gerekli ise) seyreltin ve son hacminin yarısına% 10 glükoz çözeltisi ile daha da bu seyreltin. Vortex hafifçe yukarı veya aşağı pipetleme karıştırın. SiRNA optimal miktarı deneysel olarak tespit edilmesi gerekmektedir, ancak, hayvan başına 10 ul kompleksi çözeltisi içinde 1 | ig siRNA optimizasyonu için iyi bir başlangıç ​​noktasıdır. </li><li> Çözelti B: uç hacminin dörtte birine kadar steril su ile PEI reaktifinin gerekli hacmi seyreltin ve uç hacminin yarısına% 10 glükoz çözeltisi kadar bu daha fazla seyreltilir. Vortex gently veya aşağı yukarı pipetleme karıştırın. Not: PEI maddesi miktarı, transfeksiyon verimini etkilemektedir kompleks içindeki iyonik denge belirler. Aynı şekilde PEI solüsyonu optimal miktarı deneysel olarak tespit edilmelidir. Bizim ellerde, optimal miktarı 1 mikrogram siRNA&#39;nın başına PEI çözeltisinin 0.12 ul. </li><li> B çözeltisi ile çözüm A karıştırın seferde, vorteks nazikçe. </li><li> Kullanmadan önce, oda sıcaklığında 15 dakika boyunca karıştırılmış çözelti inkübe edin. Bu kompleks, 4 ° C&#39;de, oda sıcaklığında 2 saat boyunca ve 24 saat boyunca stabildir </li></ol> 2. Intratekal Enjeksiyon <ol><li> Bu refleksi hiçbir belirti gösterir kadar,% 3 izofluran ile fare anestezisi. Buna ek olarak, ayrıca anestezi sağlamak için devlet kuyruk ve / veya pençe tutam refleksi kontrol edin. </li><li> Iğne yerleştirilmesi sırasında daha iyi bir görüntü sağlamak için kuyruğun tabanına yakın hayvanın arka ucunda kürk yaklaşık 2 cm 2 tıraş. </li><li> Içinde fare yerleştirinişlem sırasında sürekli bir izofluran uygulanması için bir burun konisi,% 1.5 izofluran azaltmak ve göz yağ ile fare gözleri kapsamaktadır. </li><li> Iğne, bir 30 G 0.5 bağlanmış bir 25 ul Hamilton şırıngası kullanılarak siRNA karışık çözelti, kullanıma hazır hazırlayın. </li><li> En önemli biri ve hafifçe basarak bu alanı çevresinde omurgalı sütun düzeltmek gerekir L6 spinöz süreci bulun. </li><li> Dikkatli L5 ve L6 vertebra yiv arasında iğne yerleştirin ve bu işareti intradural uzayda iğnenin başarılı bir giriş anlaşılacağı gibi bir kuyruk hareketiyle gözleyin. İpucu: tırnağınızı kullanarak, bir de oluk bulmak gerekir. </li><li> Tail flick görülmektedir kez, hemen, ama dikkatle, tek elle iğne konumunu güvenli ve diğer taraftan yavaş yavaş ile maddenin istenilen hacmi enjekte. İpucu: 5-10 arasında bir hacim ul hacim en az 5 olarak optimal &amp;# 181; l güvenilmez ve 10 ul daha büyük bir hacim çok fazla baskı yol açar. </li><li> Enjeksiyonu yapılır sonra, anestezi kurtarmak için kafesine geri fareyi hareket ettirin. </li><li> Hedeflenen genin optimum infekte elde etmek için bu enjeksiyon en az 2 defa daha, her 24 saat tekrarlayın. </li></ol>

<ol>
	<li>Hylden, J. L., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrathecal+morphine+in+mice:+a+new+technique.">Intrathecal morphine in mice: a new technique.</a> Eur. J. Pharmacol. 67, 313-316 (1980).</li><li>Stokes, J. A., Corr, M., Yaksh, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+tactile+allodynia+following+intrathecal+puncture+in+mouse:+contributions+of+Toll-like+receptor+signaling.">Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling.</a> Neurosci. Lett. 504, 215-218 (2011).</li><li>Goula, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyethylenimine-based+intravenous+delivery+of+transgenes+to+mouse+lung.">Polyethylenimine-based intravenous delivery of transgenes to mouse lung.</a> Gene Ther. , 1291-1295 (1998).</li><li>Fairbanks, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spinal+delivery+of+analgesics+in+experimental+models+of+pain+and+analgesia.">Spinal delivery of analgesics in experimental models of pain and analgesia.</a> Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).</li><li>Hohmann, A. G., Tsou, K., Walker, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cannabinoid+modulation+of+wide+dynamic+range+neurons+in+the+lumbar+dorsal+horn+of+the+rat+by+spinally+administered+WIN55,212-2.">Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2.</a> Neurosci. Lett. 257, 119-122 (1998).</li><li>Song, Z. H., Takemori, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+spinal+kappa+opioid+receptors+in+the+antinociception+produced+by+intrathecally+administered+corticotropin-releasing+factor+in+mice.">Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice.</a> J. Pharmacol. Exp. Ther. 254, 363-368 (1990).</li><li>Trang, T., Sutak, M., Jhamandas, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+cannabinoid+(CB1)-receptors+in+the+development+and+maintenance+of+opioid+tolerance.">Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance.</a> Neuroscience. , 1275-1288 (2007).</li><li>Yaksh, T. L., Rudy, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chronic+catheterization+of+the+spinal+subarachnoid+space.">Chronic catheterization of the spinal subarachnoid space.</a> Physiol. Behav. 17, 1031-1036 (1976).</li><li>Tappe, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synaptic+scaffolding+protein+Homer1a+protects+against+chronic+inflammatory+pain.">Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain.</a> Nat. Med. , 677-681 (2006).</li><li>Bourinet, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+of+the+Cav3.2+T-type+calcium+channel+gene+in+sensory+neurons+demonstrates+its+major+role+in+nociception.">Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception.</a> EMBO J. 24, 315-324 (2005).</li><li>Wang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+transfer+to+dorsal+root+ganglia+by+intrathecal+injection:+effects+on+regeneration+of+peripheral+nerves.">Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves.</a> Mol. Ther. 12, 314-320 (2005).</li><li>Wigdor, S., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+and+systemic+morphine-induced+antinociception+in+mice:+contribution+of+descending+serotonergic+and+noradrenergic+pathways.">Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways.</a> J. Pharmacol. Exp. Ther. 242, 90-95 (1987).</li></ol>

Yazarlar herhangi bir mali çıkarlarını beyan.

Bu nedenle, iğne intratekal enjeksiyonlar yukarıda tarif edilen teknik, etkili, hızlı, spesifik olarak lokalize edilmiş ve geri dönüşlü bir. Teknik olarak, bu prosedür, en kritik yönü oluk içine iğne sokulması noktasıdır. Bu prosedür çok sakin elleri ve sabır ile yapılır önemlidir. Birçok cerrahi işlemler gibi, eğitim başarılı enjeksiyon oranını artırır. Gerçek bir deney sırasında, bu teknik, doğrudan enjeksiyon başarılı olup olmadığını teyit etmek için açık bir göstergesi...

Omurilik işleme ve ağrılı (nosiseptif) girişlerine 4-7 iletim dahil kilit biyolojik süreçler ve fizyolojik fonksiyonları, çeşitli çok önemli bir merkezdir. Çeşitli deneysel teknikler, intratekal kateter 8 kronik implantasyonu, omurilik mikroenjeksiyon ve intratekal enjeksiyon iğne 9 ile omurilik, farmakolojik modülasyonuna kolaylaştırmak için geliştirilmiştir. Her teknik kendine özgü avantajları ve dezavantajları vardır, ve deney paradigma bağlı olarak bir teknik diğerlerine göre daha uygun olabilir. Intratekal kateter kronik implantasyonu sıçanda kolayca mümkün olduğu iken, bu yöntem, boyut kısıtlamaları göz önüne alındığında, fare çok zordur. Başarı oranı çok düşüktür ve motor açıkları nedeniyle sık sık fare ciddi sınırlı subdural alanda bir kateterin büyük varlığı nedeniyle meydana gelir. Ayrıca, ilaçların uzun süreli teslimat nedeniyle sık pıhtılaşma işlenirkronik kateter yerleştirildi. Son olarak, bağışıklık reaksiyonları yaygındır. Bu sorunlar, farelerde omurilik için ilaç ve reaktiflerin hızlı ve anatomik olarak sınırlı uygulama sağlayan bir preimplanted kateter yokluğunda bir iğne vasıtasıyla, akut intratekal enjeksiyon yöntemi kullanılarak atlatılabilir. Bu yöntem, tam olarak böyle spinal düşük dozajları ve sınır yan etkileri izin modülasyonu, hem de maddelerin yok sunmak için yeteneği özgüllük gibi diğer sistemik tatbikat yolları (örneğin, oral, intravenöz, intraperitonal vs) üzerinden teslim intratekal yararlarını muhafaza intratekal enjeksiyon sırasında iğne dura mater ve omurilik arasına sokulur olduğundan, normal olarak kan-beyin bariyerinden geçmezler. Önemli olarak, ancak, intratekal teslimat diğer yöntemlere kıyasla, intratekal enjeksiyon iğne yöntem olup, çok sayıda uygulama sağlayan, en az invazivHerhangi bir ciddi doku hasarına neden veya bağlı yabancı madde implantasyonuna bağışıklık reaksiyonunu çağrıştıran olmadan aynı hayvan. Ancak, bu etkinlik için izin iğnenin çok hassas hedefleme için teknik beceri gerektirir. Burada, özellikle görsel olarak lumbar spinal kordon hedeflenmesi için bir başarı oranı elde etmek için uygun bir yöntem göstermektedir. Bu deneyde seçilmiş enjeksiyonu site L5 ve omurga zarar olasılığını en aza indirmek için, spinal kordon uçları yere yakın L6 omurgalı kolonu arasındaki oluktur. Ayrıca, siRNA&#39;lar kullanarak omurilikte genleri yıkmak için bu tekniğin kullanımını göstermektedir.

<table border="0" cellpadding="0" cellspacing="0" width="1012">
	<colgroup>
		<col /> 
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:283px;">in vivo-jetPEI</td>
			<td style="width:255px;">Polyplus</td>
			<td style="width:288px;">201-10G</td>
			<td style="width:188px;"> </td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 siRNA</td>
			<td>Santa Cruz</td>
			<td>sc-36832</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Control siRNA-A</td>
			<td>Santa Cruz</td>
			<td>sc-37007</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Anti-&#223;-Tubulin III antibody</td>
			<td>Sigma</td>
			<td>T2200</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Anti-WAVE1 antibody</td>
			<td>R&#38;D Systems</td>
			<td>AF5514</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Fast green dye</td>
			<td>Sigma</td>
			<td>F-7252</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isoflurane</td>
			<td>Baxter</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isoflurane setup</td>
			<td>Dr&#228;ger L&#252;beck</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Shaver</td>
			<td>Wella</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Hamilton syringe Gastight 1702</td>
			<td>Hamilton</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">30G 1/2, 0,3 * 13mm Needle</td>
			<td>BD Microlance</td>
			<td>304000</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Microscope Leica MS5</td>
			<td>Leica</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 forward primer for qRT-PCR</td>
			<td>Sigma</td>
			<td></td>
			<td>cacagagcctcaggacagg</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 reversed primer for qRT-PCR</td>
			<td>Sigma</td>
			<td></td>
			<td>cttttcaccaacggcatctt</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">FastStart Essential DNA Green Master</td>
			<td>Roche</td>
			<td>6402712001</td>
			<td></td>
		</tr>
	</tbody>
</table>

in vivo sirna transfection and gene knockdown in spinal cord via rapid noninvasive lumbar intrathecal injections in mice

Bu rapor, non-invaziv bir şekilde akut intratekal iğne enjeksiyon tekniği, kateter implantasyonu yani bağımsız bir adım-adım kılavuz açıklanır. Bu cerrahi tekniğin teknik sınırlama ellerin incelik yatıyor. Enjeksiyon, özellikle eğitimli bir deneyci için, hızlı, ve bu teknikle doku bozulma az olduğundan, tekrarlanan enjeksiyonlar mümkündür; yabancı araçlara ayrıca bağışıklık reaksiyonu (. Örneğin kateter) oluşmaz, böylece daha iyi ve daha spesifik dışarı oku verme spinal kord modülasyon. Maddenin uygulanması büyük ölçüde omurilik hedef bölge ile sınırlı olduğu için, ilaçlar büyük dozlarda uygulanması gerekmez ve diğer dokusu üzerinde istenmeyen etkileri daha da önemlisi, bir sistemik uygulama ile gözlemlendiği üzere, 1 aşılabilir 2. Ayrıca, polyethylenim yardımıyla nükleik asidin in vivo transfeksiyonu ile bu teknik kombineine (PEI) farmakolojik maddelerin teslimi hem de gen, RNA ve protein modülatörleri ile spinal fonksiyonlarını incelemek için büyük bir çok yönlü ve çok reaktif 3.,.

Başarılı bir enjeksiyon örnekle açıklamak için, erişkin C57BL6 farelerde hızlı yeşil boya FCF (yaş, 8-10 haftalık) kullanarak bu tekniği uygulandı. Hayvan boya yayılmış ve daha sonra CO2 bir dozu ile öldürülmüş için yeterli zamanı sağlamak üzere enjeksiyon sonrası birkaç dakika geri bırakıldı. Daha sonra, omurgalı kolon kesitlere ayrılmıştır ve omurilik ortaya çıkmıştır. Dağınık boya karşılık gelen Mavi puncta, enjeksiyon yerinde oldu. Omurilik yaralanma izi yok...

Watch this Scientific Journal Video about In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice at JoVE.com

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

Bu rapor, kısa süreli hafif anestezi altında fare lumbar spinal kordda siRNA yerelleştirilmiş transfeksiyonu için intratekal iğne giriş basit ve hızlı bir yöntem açıklanır.

Farelerde Hızlı noninvaziv Lomber İntratekal enjeksiyon yoluyla Vivo siRNA&#39;nın Transfaksiyon ve Omurilik Gen demonte olarak

This report describes a step-by-step guide to the technique of acute intrathecal needle injections in a noninvasive manner, i.e. independent of catheter ...

in-vivo-sirna-transfection-gene-knockdown-spinal-cord-via-rapid

Research

JoVE Journal

Biology

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

46.1K Görüntüleme.  University of Heidelberg.  Bu rapor, kısa süreli hafif anestezi altında fare lumbar spinal kordda siRNA yerelleştirilmiş transfeksiyonu için intratekal iğne giriş basit ve hızlı bir yöntem açıklanır. 

Video: In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

Noninvasive In Vivo Small Animal MRI and MRS: Basic Experimental Procedures

Small animal Magnetic Resonance (MR) research has emerged as an important element of modern biomedical research due to its non-invasive nature and the richness of biological information it provides. MR does not require any ionizing radiation and can noninvasively provide higher resolution and better signal-to-noise ratio in comparison to other tomographic or spectroscopic modalities. In this protocol, we will focus on small animal MR imaging and MR spectroscopy (MRI/MRS) to noninvasively acquire relaxation weighted 1H images of mouse and to obtain 31P spectra of mouse muscle. This work does not attempt to cover every aspect of small animal MRI/MRS but rather introduces basic procedures of mouse MRI/MRS experiments. The main goal of this work is to inform researchers of the basic procedures for in vivo MR experiments on small animals. The goal is to provide a better understanding of basic experimental procedures to allow researchers new to the MR field to better plan for non-MR components of their studies so that both MR and non-MR procedures are seamlessly integrated.

Noninvasive In Vivo Small Animal MRI and MRS: Basic Experimental Procedures

This work describes basic procedures of noninvasive small animal MRI and MRS in vivo.

Noninvaziv In Vivo Küçük Hayvan MRG ve MRS: Temel Deneysel Prosedürler

Small animal Magnetic Resonance (MR) research has emerged as an important element of modern biomedical research due to its non-invasive nature and the ...

Biyoloji

Spinal Cord Electrophysiology

The neonatal mouse spinal cord is a model for studying the development of neural circuitries and locomotor movement. We demonstrate the spinal cord dissection and preparation of recording bath artificial cerebrospinal fluid used for locomotor studies. Once dissected, the spinal cord ventral nerve roots can be attached to a recording electrode to record the electrophysiologic signals of the central pattern generating circuitry within the lumbar cord.

A demonstration of the isolation of neonatal mouse spinal cord for electrophysiologic studies.

Omurilik Elektrofizyoloji

The neonatal mouse spinal cord is a model for studying the development of neural circuitries and locomotor movement. We demonstrate the spinal cord ...

Using an Automated Cell Counter to Simplify Gene Expression Studies: siRNA Knockdown of IL-4 Dependent Gene Expression in Namalwa Cells

The use of siRNA mediated gene knockdown is continuing to be an important tool in studies of gene expression.  siRNA studies are being conducted not only to study the effects of downregulating single genes, but also to interrogate signaling pathways and other complex interaction networks.  These pathway analyses require both the use of relevant cellular models and methods that cause less perturbation to the cellular physiology.  Electroporation is increasingly being used as an effective way to introduce siRNA and other nucleic acids into difficult to transfect cell lines and primary cells without altering the signaling pathway under investigation. There are multiple critical steps to a successful siRNA experiment, and there are ways to simplify the work while improving the data quality at several experimental stages.  To help you get started with your siRNA mediated gene knockdown project, we will demonstrate how to perform a pathway study complete from collecting and counting the cells prior to electroporation through post transfection real-time PCR gene expression analysis.  The following study investigates the role of the transcriptional activator STAT6 in IL-4 dependent gene expression of CCL17 in a Burkitt lymphoma cell line (Namalwa).  The techniques demonstrated are useful for a wide range of siRNA-based experiments on both adherent and suspension cells.  We will also show how to streamline cell counting with the TC10 automated cell counter, how to electroporate multiple samples simultaneously using the MXcell electroporation system, and how to simultaneously assess RNA quality and quantity with the Experion automated electrophoresis system.

This procedure describes a quick and easy workflow to introduce siRNA into difficult to transfect cell lines and follow gene expression by real-time PCR. Use of an automated cell counter, multi-well electroporation plate, and automated electrophoresis station provide quick and reliable results without the need for expensive robotic handling.

Gen İfadesi Çalışmaları basitleştirin Otomatik Hücre Sayıcı kullanma: Namalwa Hücreler IL-4 Bağımlı Gen İfadesi siRNA demonte

The use of siRNA mediated gene knockdown is continuing to be an important tool in studies of gene expression.  siRNA studies are being conducted not only ...

RNAi-mediated Gene Knockdown and In Vivo Diuresis Assay in Adult Female Aedes aegypti Mosquitoes

This video protocol demonstrates an effective technique to knockdown a particular gene in an insect and conduct a novel bioassay to measure excretion rate. This method can be used to obtain a better understanding of the process of diuresis in insects and is especially useful in the study of diuresis in blood-feeding arthropods that are able to take up huge amounts of liquid in a single blood meal. 
This RNAi-mediated gene knockdown combined with an in vivo diuresis assay was developed by the Hansen lab to study the effects of RNAi-mediated knockdown of aquaporin genes on Aedes aegypti mosquito diuresis1. 
The protocol is setup in two parts: the first demonstration illustrates how to construct a simple mosquito injection device and how to prepare and inject dsRNA into the thorax of mosquitoes for RNAi-mediated gene knockdown. The second demonstration illustrates how to determine excretion rates in mosquitoes using an in vivo bioassay.

RNAi-mediated Gene Knockdown and In Vivo Diuresis Assay in Adult Female Aedes aegypti Mosquitoes

In this protocol we combine RNAi-mediated gene silencing with an in vivo diuresis assay to study the effects knockdown of genes of interest has on mosquito fluid excretion.

RNAi-aracılı Gene Nakavt ve<em&gt; In Vivo</emYetişkin Kadınlar&gt; diürez Testi<em&gt; Aedes aegypti</em&gt; Sivrisinekler

This video protocol demonstrates an effective technique to knockdown a particular gene in an insect and conduct a novel bioassay to measure excretion ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the messagefor review see 1. However, it's now widely accepted that synonymous codon usage is the primary cause of non-uniform translational elongation rates1. Synonymous codons are not used with identical frequency. A bias exists in the use of synonymous codons with some codons used more frequently than others2. Codon bias is organism as well as tissue specific2,3. Moreover, frequency of codon usage is directly proportional to the concentrations of cognate tRNAs4. Thus, a frequently used codon will have higher multitude of corresponding tRNAs, which further implies that a frequent codon will be translated faster than an infrequent one. Thus, regions on mRNA enriched in rare codons (potential pause sites) will as a rule slow down ribosome movement on the message and cause accumulation of nascent peptides of the respective sizes5-8. These pause sites can have functional impact on the protein expression, mRNA stability and protein foldingfor review see 9. Indeed, it was shown that alleviation of such pause sites can alter ribosome movement on mRNA and subsequently may affect the efficiency of co-translational (in vivo) protein folding1,7,10,11. To understand the process of protein folding in vivo, in the cell, that is ultimately coupled to the process of protein synthesis it is essential to gain comprehensive insights into the impact of codon usage/tRNA content on the movement of ribosomes along mRNA during translational elongation.
Here we describe a simple technique that can be used to locate major translation pause sites for a given mRNA translated in various cell-free systems6-8. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA. The rationale is that at low-frequency codons, the increase in the residence time of the ribosomes results in increased amounts of nascent peptides of the corresponding sizes. In vitro transcribed mRNA is used for in vitro translational reactions in the presence of radioactively labeled amino acids to allow the detection of the nascent chains. In order to isolate ribosome bound nascent polypeptide complexes the translation reaction is layered on top of 30% glycerol solution followed by centrifugation. Nascent polypeptides in polysomal pellet are further treated with ribonuclease A and resolved by SDS PAGE. This technique can be potentially used for any protein and allows analysis of ribosome movement along mRNA and the detection of the major pause sites. Additionally, this protocol can be adapted to study factors and conditions that can alter ribosome movement and thus potentially can also alter the function/conformation of the protein.

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

A technique to identify translational pause sites on mRNA is described. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA, followed by the size analysis of the nascent chains using a denaturing gel electrophoresis.

Ribozom Bağlı Doğan Polipeptitler İzolasyonu<em&gt; In vitro</em&gt; MRNA boyunca Translasyonel Duraklat Siteleri Belirleme

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

Using SecM Arrest Sequence as a Tool to Isolate Ribosome Bound Polypeptides

Extensive research has provided ample evidences suggesting that protein folding in the cell is a co-translational process1-5. However, the exact pathway that polypeptide chain follows during co-translational folding to achieve its functional form is still an enigma. In order to understand this process and to determine the exact conformation of the co-translational folding intermediates, it is essential to develop techniques that allow the isolation of RNCs carrying nascent chains of predetermined sizes to allow their further structural analysis.
SecM (secretion monitor) is a 170 amino acid E. coli protein that regulates expression of the downstream SecA (secretion driving) ATPase in the secM-secA operon6. Nakatogawa and Ito originally found that a 17 amino acid long sequence (150-FSTPVWISQAQGIRAGP-166) in the C-terminal region of the SecM protein is sufficient and necessary to cause stalling of SecM elongation at Gly165, thereby producing peptidyl-glycyl-tRNA stably bound to the ribosomal P-site7-9. More importantly, it was found that this 17 amino acid long sequence can be fused to the C-terminus of virtually any full-length and/or truncated protein thus allowing the production of RNCs carrying nascent chains of predetermined sizes7. Thus, when fused or inserted into the target protein, SecM stalling sequence produces arrest of the polypeptide chain elongation and generates stable RNCs both in vivo in E. coli cells and in vitro in a cell-free system. Sucrose gradient centrifugation is further utilized to isolate RNCs.
The isolated RNCs can be used to analyze structural and functional features of the co-translational folding intermediates. Recently, this technique has been successfully used to gain insights into the structure of several ribosome bound nascent chains10,11. Here we describe the isolation of bovine Gamma-B Crystallin RNCs fused to SecM and generated in an in vitro translation system.

We describe here a technique that is now routinely used to isolate stably bound ribosome nascent chain complexes (RNCs). This technique takes advantage of the discovery that a 17 amino acid long SecM "arrest sequence" can halt translation elongation in a prokaryotic (E. coli) system, when inserted into (or fused to the C-terminus) of virtually any protein.

Ribozom Ciltli Polipeptitler izole bir aracı olarak SECM Tutuklanma sırası kullanılarak

Extensive research has provided ample evidences suggesting that protein folding in the cell is a co-translational process1-5. However, the exact pathway ...

Rapid Genetic Analysis of Epithelial-Mesenchymal Signaling During Hair Regeneration

Hair follicle morphogenesis, a complex process requiring interaction between epithelia-derived keratinocytes and the underlying mesenchyme, is an attractive model system to study organ development and tissue-specific signaling. Although hair follicle development is genetically tractable, fast and reproducible analysis of factors essential for this process remains a challenge. Here we describe a procedure to generate targeted overexpression or shRNA-mediated knockdown of factors using lentivirus in a tissue-specific manner. Using a modified version of a hair regeneration model 5, 6, 11, we can achieve robust gain- or loss-of-function analysis in primary mouse keratinocytes or dermal cells to facilitate study of epithelial-mesenchymal signaling pathways that lead to hair follicle morphogenesis. We describe how to isolate fresh primary mouse keratinocytes and dermal cells, which contain dermal papilla cells and their precursors, deliver lentivirus containing either shRNA or cDNA to one of the cell populations, and combine the cells to generate fully formed hair follicles on the backs of nude mice. This approach allows analysis of tissue-specific factors required to generate hair follicles within three weeks and provides a fast and convenient companion to existing genetic models.

Tissue-specific analysis of a hair follicle regeneration model using lentivirus to mediate gain- or loss-of-function.

Saç Rejenerasyon sırasında epitelyal-mezenkimal Sinyal Rapid Genetik Analizi

Hair follicle morphogenesis, a complex process requiring interaction between epithelia-derived keratinocytes and the underlying mesenchyme, is an ...

Intravenous Injections in Neonatal Mice

Intravenous injection is a clinically applicable manner to deliver therapeutics. For adult rodents and larger animals, intravenous injections are technically feasible and routine. However, some mouse models can have early onset of disease with a rapid progression that makes administration of potential therapies difficult. The temporal (or facial) vein is just anterior to the ear bud in mice and is clearly visible for the first two days after birth on either side of the head using a dissecting microscope. During this window, the temporal vein can be injected with volumes up to 50 &#956;l. The injection is safe and well tolerated by both the pups and the dams. A typical injection procedure is completed within 1-2 min, after which the pup is returned to the home cage. By the third postnatal day the vein is difficult to visualize and the injection procedure becomes technically unreliable. This technique has been used for delivery of adeno-associated virus (AAV) vectors, which in turn can provide almost body-wide, stable transgene expression for the life of the animal depending on the viral serotype chosen.

Animal models of pediatric disease can experience early onset and aggressive disease progression. Clinically relevant therapy delivery to young mouse models can be technically difficult. This protocol describes a non-invasive intravenous injection method for newborn mice within the first two postnatal days of life.

Yenidoğan Farelerde intravenöz enjeksiyonlar

Intravenous injection is a clinically applicable manner to deliver therapeutics. For adult rodents and larger animals, intravenous injections are ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 &#181;l whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

We describe here a simple and rapid paper-based DNA extraction method of HIV proviral DNA from whole blood detected by quantitative PCR. This protocol can be extended for use in detecting other genetic markers or using alternative amplification methods.

Nükleik Asitlerin süzülmesi İzolasyonu: basit ve hızlı DNA izolasyonu,

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Cystometric and External Urethral Sphincter Measurements in Awake Rats with Implanted Catheter and Electrodes Allowing for Repeated Measurements

Lower urinary tract function is mainly assessed by means of cystometric bladder function analysis in rodents. Conventional cystometries are usually performed as terminal analysis under urethane anesthesia. It is well known that anesthetic drugs can influence bladder function. Hence, the aim of this technique is to perform cystometric measurements of the urinary bladder and external urethral sphincter in lightly restrained awake rats. For this purpose, a bladder catheter is implanted into the bladder dome. Subsequently, two electrodes are implanted bilateral to the external urethral sphincter and a ground electrode is sutured to a non-responsive skeletal muscle. The bladder catheter and the three electrodes are finally tunneled subcutaneously to the neck region and affixed to a harness. With this technique, the lower urinary tract can be measured at multiple time points in the same animal to assess lower urinary tract function. The main application of this technique is the follow-up of simultaneous urinary bladder and external urethral sphincter function in awake healthy rats and after induction of a disease or injury. Moreover, subsequent lower urinary tract monitoring can be performed during evaluation of the disease/injury and to monitor treatment efficacy.

This protocol first describes the surgical procedure of the permanent implantation of a urinary bladder catheter combined with external urethral sphincter electrodes, and second, the measurement of the function of the urinary bladder and external urethral sphincter in implanted awake animals.

Cystometric ve dış üretral sfinkter ölçümleri implant kateter ve tekrarlanan ölçülerini izin elektrotları ile uyanık Sıçanlarda

Lower urinary tract function is mainly assessed by means of cystometric bladder function analysis in rodents. Conventional cystometries are usually ...