We thank Christian Lehner for providing the CENP-C antibody and Eric Joyce for recommendations on FISH. Work in the McKim lab was funded by a grant from NIH (GM101955).

Not: Aksi belirtilmediği sürece, işlemler oda sıcaklığında gerçekleştirilir. Sıcaklık kontrollü inkübatör sinek yetiştirme için sıcaklıkları korumak için kullanılan ve aksi belirtilmediği sürece haçlar vardır. 1. hazırlıklar <ol><li> Sinekler hazırlayın. <ol><li> oosit koleksiyonları prometafaz zenginleştirilmiş. <ol><li> Net yetişkin sağlıklı, genç stok veya çapraz kültürlerinden uçar. 25 ° C&#39;de iki gün için yaş şişe. Not: Genellikle, iki sağlıklı şişe yeterli olacaktır, daha çok bazı çapraz kültürler için gerekli olabilir, ancak. </li><li> İki gün sonra, şişe (bu noktada, 0 ila 2 gün geçmiş) ~ 100 ila 300 kadın toplar. kadın bakire olması gerekmez. Bir şişenin yanına maya hamur dab ekleyin ve 30 kadın ve mayalı şişeleri içine 10 ila 15 erkek her koyun. 25 ° C&#39;de iki gün için yaş şişeler. </li></ol></li><li> Oosit Koleksiyonlar metafaz zenginleştirilmiş. <ol><li> Hisse senedi veya çapraz KÜLTÜR gelen ~ 100 ila 300 kadın toplamakes. Bir şişenin yanına maya hamur dab ekleyin ve 30 kadın yer mayalı şişe içine (ilave hiçbir erkek ile birlikte) her biri. 25 ° C &#39;de üç ila beş gün için yaş şişeler. </li></ol></li></ol></li><li> Çözümler hazırlayın. Not: Aksi belirtilmediği sürece, Solutions, oda sıcaklığında süresiz depolanabilir. <ol><li> Robb tampon Modifiye hazırlama (5x): 500 mM HEPES, 500 mM sukroz, 275 mM sodyum asetat, 200 mM potasyum asetat, 50 mM glukoz, 6 mM magnezyum klorid, 5 mM kalsiyum klorid. 7.4 pH değerini elde etmek için potasyum hidroksit: 8 sodyum hidroksit: 10 K 11 kullanın. filtrasyon ile sterilize; kaynatmayın. -20 ° C&#39;de saklayın. ~ 1x Robb&#39;un oosit başına hazırlık 200 ml hazırlamak için gerekli olarak çözülme. </li><li> Tespit Çözümleri. <ol><li> Seçenek # 1: formaldehit / heptan tespit hazırlayın. Sabitleme tampon hazırlayın: 1x Fosfat tamponlu tuz (PBS) artı 150 mM sukroz. kullanmak için, 687,5 ul Sabitleme Tampon ve 312,5 ul% 16 formaldehit ile taze yapmakoosit hazırlık başına. DİKKAT: Davlumbaz formaldehit çözümlerini kullanırken eldiven giyin. kurumsal kurallarına göre bertaraf edilmelidir. </li><li> Seçenek # 2: formaldehit / kakodilat tespit hazırlayın. Düzeltme Mix hazırlayın: 250 mM sükroz, 100 mM potasyum asetat (pH 7.5), 25 mM sodyum asetat (pH 7.0) ve 25 mM EGTA (pH 8.0). kullanmak için, 400 ul taze karışımı saptamak yapmak 100 ul potasyum kakodilat (1 M, pH 7.2), ve oosit prep 500 ul% 16 formaldehid. DİKKAT: Potasyum kakodilat Arsenik içerir. </li></ol></li><li> 1x PBS artı% 1 veya% 0.05 Triton X-100 PBS / Triton X-100 hazırlayın. 4 ° C&#39;de saklayın. </li><li> 1 x PBS, (ağ / hac)% 0.5 BSA ve% 0.1 Tween-20: PBS-Tween 20 Sığır Serum Albumin (BSA) (PTB) hazırlayın. bir hafta boyunca 4 ° C&#39;de saklanabilir. </li><li> Situ Hibridizasyon (FISH) Çözümleri floresan. <ol><li> Hazırlama 20X Sodyum klorür-sodyum sitrat (SSC): 3 M sodyum klorür ve 0.3 M sodyum sitrat. </li><li> Hazırlama 2x SSC-Tween-20 (SSCT) 2X SSC artı% 0.1 Tween-20. oosit hazırlık başına taze ~ 20 ml olun. </li><li> formamid çözümler hazırlayın: 2 x SSC,% 0.1 Tween-20, ayrıca formamid. 1 ml% 20 formamid, 0.5 mL% 40 formamid, ve oosit hazırlık başına 2 ml% 50 formamid, taze olun. DİKKAT: Davlumbaz formamid çözümlerini kullanırken eldiven giyin. kurumsal kurallarına göre bertaraf edilmelidir. </li><li> (Ağırlık / hacim) 2X SSC,% 50 formamid,% 10 dekstran sülfat: hibridizasyon çözeltisi hazırlayın. 4 ° C&#39;de saklayın. </li></ol></li><li> BALIK Probes. <ol><li> Order HPLC ile arıtma sahip oligonükleotid (dizileri için Tablo 1 &#39;e bakınız) ve 5&#39; flüoresan modifikasyonu (örneğin Cy3 veya Cy5) istenen. 50 ng / | il Tris-EDTA (TE) içinde süspanse edin. NOT: Her zaman ışık maruz oligos koruyun. </li></ol></li></ol></li></ol> Geç evre Drosophila Oosit 2. Koleksiyonu <ol><li> Gibi <em&gt; plastik ve cam sopa intakt membranlı Drosophila oositlerin öncesi kat bir 5 ml tüp ve PTB ile oosit hazırlık başına bir süspanse içinde. </li><li> karbon dioksit ile tüm ~ 100 ila 300 mayalı sinekler uyutmak ve ~ 100 ml 1x Robb&#39;un Tamponu içeren bir blender ekleyin. Darbe üç kez (~ 1 sn her). aktivasyonunu önlemek için &lt;için 20 dakika Robb en içinde oosit tutun. NOT: Alternatif olarak, oosit dişilerden el-disseke edilebilir. Bu yöntemin avantajı, daha az kadın gerektirmesidir. Ancak, bakım hipoksi 7 ile bağlantılı bozulmaları önlemek için sadece birkaç dakikaya kadar karbon dioksite maruz sınırlamak için dikkat edilmelidir. </li><li> Büyük beden parçalarını kaldırmak için 250 ml behere büyük örgü (~ 1.500 mm) süzülür. Birçok bozulmamış karnı yine örgü, yeniden eziyet ek Robb&#39;un Tampon kullanarak malzeme ve filtre üzerinde kalırsa. Daha sonra mümkün olduğunca büyük vücut parçaları gibi birçok kaldırarak, üst tabaka aspire ~ 2 dk dinlendiriniz. </li><li> Fi250 ml&#39;lik bir cam kaba, küçük elek (~ 300 um) vasıtasıyla ltresi. Ek Robb adlı ve kaplamalı Pasteur pipet kullanarak ilk beher dışına kalan oosit durulayın. yerleşmek ~ 3 dk edelim; oosit dışarı razı olacak. Aspire off ama ~ 10 ml. </li><li> kaplanmış 5 ml tüp içine sığacak kadar 10 ml kadar dökün. , Yerleşmek sıvı kaldırmak ve kalanı tekrar edelim. Ek Robb adlı ve kaplamalı Pasteur pipet kullanarak kaptan dışarı kalan oosit durulayın. 3-5 dakika ~ 5 ml tüp dinlendiriniz. </li></ol> 3. İlaç Tedavileri (İsteğe bağlı) <ol><li> Coat her oosit hazırlık için PTB ile ikinci 5 ml tüp. 1 ml Robb birbirlerinin oosit hazırlık için, her (Tablo 2), uygun bir çözücü (kontrol) ya da ilaç ekleyin. </li><li> İkinci kaplanmış 5 ml tüp içine bölünmüş oositler. , Yerleşmek Let sıvı kaldırmak ve bir tüp içine 1 ml Robb en artı çözücü eklemek ve 1 ml Robb en artı ilaç ikinci tüpe. Ilaç tedavisi (Tablo 2) uygun zaman miktarı için Nutate. Let yerleşmek. </li></ol> 4. Sabitleme <ol><li> Aspire tüm sıvı ve hemen 1 ml Fix ekleyin. </li><li> Seçenek # 1: Formaldehit / heptan sabitleme (Fixation Tampon artı% 5 formaldehit). <ol><li> Bir nutator 2.5 dakika için düzelt. 1 mi heptan ve 1 dakika vorteksleyin ekleyin. yerleşmek ~ 1 dk olsun. </li><li> tüm sıvı çıkarın ve sonra PBS 1x 1 ml ekleyin. Vortex 30 sn. yerleşmek ~ 1 dk olsun. </li><li> tüm sıvı çıkarın ve sonra 1x PBS ile tüp doldurun. Not: Oositler hemen kullanılabilir ya da oda sıcaklığında birkaç saat boyunca nutator tutulabilir. </li></ol></li><li> Seçenek # 2: Formaldehit / kakodilat sabitleme (Mix artı% 8 formaldehit ve 100 mM kakodilat Fix). <ol><li> Bir nutator 6 dakika düzelt. 2 dakika dinlendiriniz. sıvı çıkarın ve sonra 1x PBS ile tüp doldurun. Not: Oositler hemen kullanılabilir ya da oda sıcaklığında birkaç saat boyunca nutator tutulabilir. </li></ol></li></ol> 5. Membranlar çıkarma ( &quot;Rolling&quot;) <ol><li> kaplanmış yeniden süspanse kullanarak, bir cam slayt buzlu (kumlanmış) kısmına ~ 500 ila 1000 oosit ekleyin. tüm vücut parçaları ve yabancı madde kullanarak forseps çıkarın. oosit kurumasına izin vermeyin; gerektiğinde 1x PBS ilave edin. </li><li> Periyodik mikroskop altında ilerleyişini kontrol (. En iyi şekilde çalışır oosit genelinde lamel kenarına sürükleyerek) kaldırılır tüm membranların kadar oosit ve yavaşça &quot;roll&quot; oosit üstünde bir lamel yerleştirin gerektiğinde daha 1x PBS ekledi. oosit yok edecek çok fazla basınç olarak özen gösterin. NOT: immünfloresans sadece, (immünofloresan olan veya olmayan) FISH için Adım 6 ile devam için, Adım 7 ile devam edin. </li></ol> Drosophila OOSİT 6. Antikor Boyama <ol><li> Ekstraksiyon ve Engelleme <ol><li> ~ 15 mi, PBS /% 1 Triton X-100 ihtiva eden 15 ml konik bir tüp içine haddelenmiş oosit durulayın. en az 1.5 saat için bu çözüm ve en fazla 2 saat içinde Nutate oositler.Bu adım, antikor nüfuz etmesini sağlar. </li><li> oosit ~ 2 dk dinlendiriniz. Mümkün olduğunca çok sayıda membran ile birlikte sıvı çıkarın, daha sonra PBS ekleme /% 0.05 Triton X-100. NOT: Zarlar haddelenmiş oosit daha yavaş geçer. </li><li> oosit ~ 2 dk yerleşmek izin, sonra tüm ama ~ 1 ml sıvı kaldırmak. Transfer oosit 1.5 ml tüp mezun oldu ve kalan sıvı çıkarın. 1 saat boyunca bloke etmek ve nutate 1 mi ATB ekleyin. </li></ol></li><li> antikor Boyama <ol><li> Embriyoların karşı sekonder antikor Ön emilim. Not: Bu adım, Drosophila proteinleri ile spesifik olmayan antikor reaksiyonları arka plan boyaması ortadan kaldırır. <ol><li> Toplayın ve tipik prosedür 8 uyarınca Drosophila embriyolar (~ 25 ul) düzeltmek. -20 ° C&#39;de metanol içinde depolayın. </li><li> , Embriyolardan, metanolün çıkması, 15 dakika boyunca 800 ul metanol artı PBS 1X 200 ul ve nutate ekleyin. süpernatan 500 ul çıkarın ve PBS 1X 500 ul ile değiştirin. Daha sonra 15 dakika boyunca nutate. (Yıkar ~ 1 saat olmak üzere toplam) iki kez tekrarlayın ve sonra PTB bitirmek. Not: Embriyolar hemen kullanılabilir ya da oda sıcaklığında birkaç saat boyunca nutator tutulabilir. </li><li> , Sıvı çıkarın oosit hazırlık başına 200 ul PTB ile doldurun ve uygun dilüsyonlarda floresan etiketli sekonder antikor ekleyin (son hacim 300 ul olacağını göz önünde bulundurarak;. Adım 7.4) Nutate 4 ° C&#39;de gece boyunca (tercih edilir) ya da 3 ila 4 saat boyunca oda sıcaklığında karıştırılmıştır. Not: önceden absorbe antikorlar Aşama 6.2.4 kullanılacaktır. NOT: mümkün olduğu kadar floresan antikorlar eklenmiştir kez karanlıkta örnekleri tutun. </li></ol></li><li> , Oosit sıvıyı çıkarmak 300 ul PTB ile doldurun ve uygun dilüsyonlarda primer antikorlar ekleyin. 4 ° C&#39;de bir gece boyunca Nutate (tercih edilir) ya da 3 ila 4 saat boyunca oda sıcaklığında karıştırılmıştır. </li><li> Yıkama 1 ml PTB 15 dakika her biri için dört kez oosit. </li><li> Kaldıroosit, sıvı, embriyolar (sekonder antikor önceden absorbe) üstte yüzen madde 200 ul ekle. Ardından 300 ul PTB ile doldurun. 3 ila 4 saat (tercihen) veya gece boyunca 4 ° C&#39;de oda sıcaklığında Nutate. </li><li> 1 mi PTB ile 15 dakika boyunca bir kez oosit yıkayın, sıvıyı ayırın. Daha sonra, 7 dakika boyunca 0.5 ul Hoechst 33342 ve 500 ul PTB ve nutate ekleyin. </li><li> 1 mi PTB ile her biri 15 dakika için iki kere oosit yıkayın. Not: Oositler hemen slayt üzerine monte edilebilir veya görüntüleme için hazır olana kadar 4 ° C&#39;de PTB depolanabilir. </li></ol></li></ol> 7. BALIK (Above Adım 5 Devam) <ol><li> ~ 15 ml 2x SSCT içeren 15 ml konik tüp içine yuvarlandı oosit durulayın. oosit ~ 2 dk dinlendiriniz. 0.5 ml sıvı mümkün olduğu kadar çok membran ile birlikte tüm ama ~ çıkarın. NOT: Zarlar haddelenmiş oosit daha yavaş geçer. </li><li> Transferi 0.5 ml tüp oosit ve kalan sıvıyı çıkarın. Arda eklemek ve 500 ul kaldırmak% 20,% 40,% 50 formamid çözeltiler, her çözelti içinde 10 dakika için nutating. NOT: Oositler formamid yüksek oranları ile yavaş geçer. </li><li> daha sonra 1 5 saat boyunca 37 ° C&#39;de 500 ul% 50 formamid çözeltisi ve nutate ekleyin sıvıyı ayırın. NOT: Daha uzun inkubasyon daha sonda penetrasyon ile sonuçlanır. </li><li> En fazla 100 ° den ul oosit bırakarak sıvı çıkarın ve 36 ul hibridizasyon çözeltisi artı prob 2 ul (50 ng / | il) ve 2 ul su veya 2. prob (Tablo 1) 2 ul ekle. </li><li> gece boyunca 37 ° C&#39;de su banyosunda kuluçkaya bırakılır, ardından 3 dakika boyunca (FISH için) ya da 20 dakika (balık artı immünofloresan), 80 ° C, 91 ° C de inkübe edilir. Not: Bu adımlar, bir PCR gerçekleştirilebilir. </li><li> sıvı çıkarmayın. 1 saat boyunca 37 ° C&#39;de 500 ul% 50 formamid çözeltisi ve nutate ekleyin. </li><li> , Sıvı kaldırmak, yerleşmek Let 500 ul% 50 formamid çözüm ekleyin, bir1 saat süre ile 37 ° C &#39;de D nutate. </li><li> , Sıvının çıkması, yerleşmek izin 10 dakika için oda sıcaklığında 500 ul% 20 formamid çözeltisi ve nutate ekleyin. </li><li> (Tekrarlama birkaç kez ters, sonra sıvı ekleyin kaldır, yerleşmek izin verin.) 500 ul 2x SSCT üç hızlı yıkar gerçekleştirin yerleşmek edelim, sıvı kaldırmak, daha sonra 4 saat boyunca 500 ul ATB ve nutate ekleyin. </li></ol> 8. Antikor Boyama FISH sonra <ol><li> , Oosit sıvıyı çıkarmak 300 ul PTB ile doldurun ve FITC konjuge 10 ul anti-α-tubulin antikor ekleyin. Seçenek olarak ise, diğer antikorlar, yukarıda protokol izlenerek, kullanılabilir. gece boyunca, oda sıcaklığında Nutate. </li><li> daha sonra, 7 dakika boyunca 0.5 ul Hoechst 33342 ve 500 ul PTB ve nutate ekleyin sıvının çıkması, 500 ul PTB ile 15 dakika boyunca bir kez oosit yıkayın. </li><li> 500 ul PTB ile her biri 15 dakika için iki kere oosit yıkayın. Not: Oositler hemen slayt üzerine monte edilebilir ya da hazır olana kadar 4 ° C&#39;de PTB depolanabilirgörüntüleme. mümkün olduğu kadar floresan antikorlar eklenmiştir kez karanlıkta oosit tutun. </li></ol><table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td fo:width="1in"> Tekrarlama Ad </td><td fo:width="1in"> Kromozom </td><td> Oligo Sırası * </td></tr><tr><td> 359 </td><td> X </td><td> GGGATCGTTAGCACTGGTAATTAGCTGC </td></tr><tr><td> AACAC </td><td> 2 </td><td> AACACAACACAACACAACACAACACAACACAACACAACAC </td></tr><tr><td> dodeka </td><td> 3 </td><td> CCCGTACTGGTCCCGTACTCGGTCCCGTACTCGGT </td></tr><tr><td> 1.686 </td><td> 2 + 3 </td><td> AATAACATAGAATAACATAGAATAACATAG </td></tr><tr><td> AATAT </td><td> 4 (+ Y) </td><td> AATATAATATAATATAATATAATATAATAT </td></tr><tr><td colspan="3"> * Eric Joyce, kişisel iletişim, Sullivan ve ark diğer dizilerden 359 dizisi. 8 </td&gt; </tr></tbody></table> Tablo 1: Drosophila sentromerine tekrarlar için FISH probları. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> İlaç </td><td> çözücü </td><td> stok konsantrasyonu </td><td> Nihai konsantrasyon </td><td> Tedavinin zamanı </td><td> Efekt </td></tr><tr><td> kolşisin </td><td> etanol </td><td> 125 mM </td><td> 150 uM </td><td> 10 dakika ya da 30 dakika </td><td> olmayan kinetochore (10 dakika) 9 veya Tüm (30 dakika) mikrotübül destabilize </td></tr><tr><td> paklitaksel </td><td> DMSO </td><td> 10 mM </td><td> 10 uM </td><td> 10 dk </td><td> mikrofona stabilizerotubules </td></tr><tr><td> Binucleine 2 </td><td> DMSO </td><td> 25 mM </td><td> 25 uM </td><td> 20 dakika </td><td> Aurora B kinaz 10 inhibe </td></tr></tbody></table> Tablo 2: İlaç tedavisi.

<ol>
	<li>Bridges, C. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-disjunction+as+proof+of+the+chromosome+theory+of+heredity.">Non-disjunction as proof of the chromosome theory of heredity.</a> Genetics. 1 (1), 1-52 (1916).</li><li>Hassold, T., Hunt, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=To+err+(meiotically)+is+human:+the+genesis+of+human+aneuploidy.">To err (meiotically) is human: the genesis of human aneuploidy.</a> Nat Rev Genet. 2 (4), 280-291 (2001).</li><li>Theurkauf, W. E., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Meiotic+spindle+assembly+in+Drosophila+females:+behavior+of+nonexchange+chromosomes+and+the+effects+of+mutations+in+the+nod+kinesin-like+protein.">Meiotic spindle assembly in Drosophila females: behavior of nonexchange chromosomes and the effects of mutations in the nod kinesin-like protein.</a> J Cell Biol. 116 (5), 1167-1180 (1992).</li><li>Zou, J., Hallen, M. A., Yankel, C. D., Endow, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microtubule-destabilizing+kinesin+motor+regulates+spindle+length+and+anchoring+in+oocytes.">A microtubule-destabilizing kinesin motor regulates spindle length and anchoring in oocytes.</a> J Cell Biol. 180 (3), 459-466 (2008).</li><li>Dernburg, A. F., Sedat, J. W., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+evidence+of+a+role+for+heterochromatin+in+meiotic+chromosome+segregation.">Direct evidence of a role for heterochromatin in meiotic chromosome segregation.</a> Cell. 86 (1), 135-146 (1996).</li><li>Gilliland, W. D., Hughes, S. F., Vietti, D. R., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Congression+of+achiasmate+chromosomes+to+the+metaphase+plate+in+Drosophila+melanogaster+oocytes.">Congression of achiasmate chromosomes to the metaphase plate in Drosophila melanogaster oocytes.</a> Dev Biol. 325 (1), 122-128 (2009).</li><li>Gilliland, W. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hypoxia+transiently+sequesters+mps1+and+polo+to+collagenase-sensitive+filaments+in+Drosophila+prometaphase+oocytes.">Hypoxia transiently sequesters mps1 and polo to collagenase-sensitive filaments in Drosophila prometaphase oocytes.</a> PLoS One. 4 (10), e7544 (2009).</li><li>Sullivan, W., Ashburner, M., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Drosophila Protocols. , (2000).</li><li>Radford, S. J., Hoang, T. L., G&#322;uszek, A. A., Ohkura, H., McKim, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lateral+and+End-On+Kinetochore+Attachments+Are+Coordinated+to+Achieve+Bi-orientation+in+Drosophila+Oocytes.">Lateral and End-On Kinetochore Attachments Are Coordinated to Achieve Bi-orientation in Drosophila Oocytes.</a> PLoS Genet. 11 (10), e1005605 (2015).</li><li>Smurnyy, Y., Toms, A. V., Hickson, G. R., Eck, M. J., Eggert, U. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Binucleine+2,+an+isoform-specific+inhibitor+of+Drosophila+Aurora+B+kinase,+provides+insights+into+the+mechanism+of+cytokinesis.">Binucleine 2, an isoform-specific inhibitor of Drosophila Aurora B kinase, provides insights into the mechanism of cytokinesis.</a> ACS Chem Biol. 5 (11), 1015-1020 (2010).</li><li>Mahowald, A. P., Goralski, T. J., Caulton, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+activation+of+Drosophila+eggs.">In vitro activation of Drosophila eggs.</a> Dev Biol. 98 (2), 437-445 (1983).</li><li>Page, A. W., Orr-Weaver, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+meiotic+divisions+in+Drosophila+oocytes.">Activation of the meiotic divisions in Drosophila oocytes.</a> Dev Biol. 183 (2), 195-207 (1997).</li><li>Tavosanis, G., Llamazares, S., Goulielmos, G., Gonzalez, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Essential+role+for+gamma-tubulin+in+the+acentriolar+female+meiotic+spindle+of+Drosophila.">Essential role for gamma-tubulin in the acentriolar female meiotic spindle of Drosophila.</a> EMBO J. 16 (8), 1809-1819 (1997).</li><li>Endow, S. A., Komma, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spindle+dynamics+during+meiosis+in+Drosophila+oocytes.">Spindle dynamics during meiosis in Drosophila oocytes.</a> J Cell Biol. 137 (6), 1321-1336 (1997).</li><li>Matthies, H. J., Clarkson, M., Saint, R. B., Namba, R., Hawley, R. S., Sullivan, W., Ashburner, M., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Drosophila Protocols. , 67-85 (2000).</li><li>Colombi&#233;, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dual+roles+of+Incenp+crucial+to+the+assembly+of+the+acentrosomal+metaphase+spindle+in+female+meiosis.">Dual roles of Incenp crucial to the assembly of the acentrosomal metaphase spindle in female meiosis.</a> Development. 135 (19), 3239-3246 (2008).</li></ol>

The authors have nothing to disclose.

Drosophila Oositler evreleme bir ince uzun karyosome genellikle metafaz oositlerden prometafaz ayırt karyosome şeklini kullanarak, prometafaz oositlerinde görülmekle birlikte sorunlu olabilir. prometafaz sırasında, karyosome, yuvarlak bir şekil olarak başlar uzar ve daha sonra oosit metafaz tutuklama yaklaştıkça bir yuvarlak şekle geri çekilir. Bu, pek çok prometafaz oositler uzatılmış karyosome yok demektir. mutant ya da ilaçla tedavi oosit incele...

The study of meiosis is sometimes described as the "genetics of genetics". This is because the fundamental properties of chromosome inheritance and independent assortment are carried out through the segregation of chromosomes during gamete production. An important demonstration of the chromosome theory of inheritance came in 1916 from the work of Calvin Bridges in Drosophila melanogaster1. This and other classical genetics studies in Drosophila contributed greatly to our understanding of genetics. Cytological examination of meiotic chromosomes in Drosophila oocytes, however, has been challenging. This is primarily because immunofluorescence of late-stage Drosophila oocytes, when the spindle assembles and chromosomes are oriented for segregation, is hampered by the presence of membranes that render the oocyte impenetrable to antibodies.
Despite this challenge, Drosophila oocytes remain an attractive model for the study of chromosome behavior and spindle assembly. This is because of the powerful genetic tools available in Drosophila, but also because the oocytes arrest at metaphase I, when the chromosomes are oriented and the spindle is fully formed. This facilitates the collection and examination of large numbers of oocytes at this important stage of cell division. In addition, a simple model organism that is amenable to genetic manipulation for the study of oocyte chromosome segregation can provide an important contribution to our understanding of human reproductive health. Errors in chromosome number are the leading genetic cause of miscarriage and birth defects in humans2. A majority of these errors can be traced to the oocyte and are correlated with increasing maternal age. The average age of mothers in the U.S. has been increasing, making this a major public health concern.
We describe here methods for the cytological examination of Drosophila oocytes, including a demonstration of how to remove the oocyte membranes. These methods are modifications of protocols first described by Theurkauf and Hawley3, Zou et al.4, and Dernburg et al.5. We also include methods for the enrichment of different stages of oocytes, based on a protocol first described by Gilliland et al.6. Finally, we add instructions for the drug treatment of Drosophila oocytes. Together, these methods allow the cytological investigation of oocyte chromosome segregation and spindle assembly in Drosophila.

<table><tbody><tr><td>15 ml conical tubes</td><td>Various</td><td></td><td></td></tr><tr><td>16% formaldehyde</td><td>Ted Pella, Inc.</td><td>18505</td><td>HAZARDOUS; once opened, discard after one month</td></tr><tr><td>250 ml beakers</td><td>Various</td><td></td><td></td></tr><tr><td>5 ml tubes</td><td>Various</td><td></td><td></td></tr><tr><td>active dry yeast</td><td>Various</td><td></td><td>mix with water to make a paste the consistency of peanut butter</td></tr><tr><td>anti-&amp;alpha;-tubulin antibody conjugated to FITC</td><td>Sigma</td><td>F2168</td><td>clone DM1A</td></tr><tr><td>Binucleine 2</td><td>Sigma</td><td>B1186</td><td>HAZARDOUS</td></tr><tr><td>blender</td><td>Various</td><td></td><td></td></tr><tr><td>bovine serum albumin</td><td>Sigma</td><td>A4161</td><td></td></tr><tr><td>calcium chloride</td><td>Various</td><td></td><td></td></tr><tr><td>colchicine</td><td>Sigma</td><td>C-9754</td><td>HAZARDOUS</td></tr><tr><td>coverslips</td><td>VWR</td><td>48366-227</td><td>No. 1 1/2</td></tr><tr><td>dextran sulfate</td><td>Various</td><td></td><td></td></tr><tr><td>DMSO</td><td>Various</td><td></td><td></td></tr><tr><td>EGTA</td><td>Various</td><td></td><td></td></tr><tr><td>ethanol</td><td>Various</td><td></td><td></td></tr><tr><td>forceps</td><td>Ted Pella, Inc.</td><td>5622</td><td>Dumont tweezers high precision grade style 5</td></tr><tr><td>formamide</td><td>Sigma</td><td>47670-250ML-F</td><td></td></tr><tr><td>glass slides</td><td>VWR</td><td>48312-003</td><td></td></tr><tr><td>glucose</td><td>Various</td><td></td><td></td></tr><tr><td>graduated 1.5 ml tubes</td><td>Various</td><td></td><td></td></tr><tr><td>HEPES</td><td>VWR</td><td>EM-5330</td><td>available from several venders</td></tr><tr><td>Hoechst 33342</td><td>Various</td><td></td><td></td></tr><tr><td>magnesium chloride</td><td>Various</td><td></td><td></td></tr><tr><td>methanol</td><td>Various</td><td></td><td></td></tr><tr><td>large mesh (~1,500 &amp;micro;m)</td><td>VWR</td><td>AA43657-NK</td><td>variety of formats and other suppliers, 12 or 14 mesh</td></tr><tr><td>small mesh (~300 &amp;micro;m)</td><td>Spectrum labs</td><td>146 424</td><td>variety of formats, &lt;em&gt;e.g.&lt;/em&gt;, 146 422 or 146 486</td></tr><tr><td>nutator</td><td>Various</td><td></td><td></td></tr><tr><td>Pasteur pipets</td><td>Various</td><td></td><td></td></tr><tr><td>potassium acetate</td><td>Various</td><td></td><td></td></tr><tr><td>Cacodylic acid</td><td>Sigma</td><td>C0125</td><td>HAZARDOUS; alternatively, sodium cacodylate may be substituted</td></tr><tr><td>potassium hydroxide</td><td>Various</td><td></td><td></td></tr><tr><td>sodium acetate</td><td>Various</td><td></td><td></td></tr><tr><td>sodium chloride</td><td>Various</td><td></td><td></td></tr><tr><td>sodium citrate</td><td>Various</td><td></td><td></td></tr><tr><td>sodium hydroxide</td><td>Various</td><td></td><td></td></tr><tr><td>sucrose</td><td>Various</td><td></td><td></td></tr><tr><td>taxol (paclitaxel)</td><td>Sigma</td><td>T1912</td><td>HAZARDOUS</td></tr><tr><td>Triton X-100</td><td>Fisher</td><td>PI-28314</td><td></td></tr><tr><td>Tween 20</td><td>Fisher</td><td>PI-28320</td><td></td></tr><tr><td>vortex</td><td>Various</td><td></td><td></td></tr></tbody></table>

techniques for imaging prometaphase and metaphase of meiosis i in fixed drosophila oocytes

Chromosome segregation in human oocytes is error prone, resulting in aneuploidy, which is the leading genetic cause of miscarriage and birth defects. The study of chromosome behavior in oocytes from model organisms holds much promise to uncover the molecular basis of the susceptibility of human oocytes to aneuploidy. Drosophila melanogaster is amenable to genetic manipulation, with over 100 years of research, community, and technique development. Visualizing chromosome behavior and spindle assembly in Drosophila oocytes has particular challenges, however, due primarily to the presence of membranes surrounding the oocyte that are impenetrable to antibodies. We describe here protocols for the collection, preparation, and imaging of meiosis I spindle assembly and chromosome behavior in Drosophila oocytes, which allow the molecular dissection of chromosome segregation in this important model organism.

Burada tarif edilen metodlar mayoz üç aşamadan (Şekil 1) temsil eden geç evre Drosophila oosit toplama neden olur. Profaz Oositler karyosome (Şekil 1A) çevreleyen bölgede tübülin sinyal eksikliği ile görünür çekirdek zarfına varlığı ile ayırt edilir. Prometafaz nükleer zarf arıza sırasında iğ monte ediyor sonra dönemdir. Prometafaz sırasında karyosome, farklı bir şekil alır, ana karyosome kütlesi (Şekil 1...

Watch this Scientific Journal Video about Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes at JoVE.com

Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes

We present protocols for the collection, preparation, and imaging of mature Drosophila oocytes. These methods allow the visualization of chromosome behavior and spindle assembly and function during meiosis.

Sabit Görüntüleme prometafaz ve Metafaz Mayoz ve I Teknikleri<em&gt; Drosophila</em&gt; Oositler

Chromosome segregation in human oocytes is error prone, resulting in aneuploidy, which is the leading genetic cause of miscarriage and birth defects. The ...

techniques-for-imaging-prometaphase-metaphase-meiosis-i-fixed

Research

Education

JoVE Journal

JoVE Core

Molecular Biology

Biology

Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes

Unit 2

Meiosis

SCIENTISTS IN ACTION

9.0K Görüntüleme.  Rutgers University. We present protocols for the collection, preparation, and imaging of mature Drosophila oocytes. These methods allow the visualization of chromosome behavior and spindle assembly and function during meiosis.

Video: Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes

Using Mouse Oocytes to Assess Human Gene Function During Meiosis I

Embryonic aneuploidy is the major genetic cause of infertility in humans. Most of these events originate during female meiosis, and albeit positively correlated with maternal age, age alone is not always predictive of the risk of generating an aneuploid embryo. Therefore, gene variants might account for incorrect chromosome segregation during oogenesis. Given that access to human oocytes is limited for research purposes, a series of assays were developed to study human gene function during meiosis I using mouse oocytes. First, messenger RNA (mRNA) of the gene and gene variant of interest are microinjected into prophase I-arrested mouse oocytes. After allowing time for expression, oocytes are synchronously released into meiotic maturation to complete meiosis I. By tagging the mRNA with a sequence of a fluorescent reporter, such as green fluorescent protein (Gfp), the localization of the human protein can be assessed in addition to the phenotypic alterations. For example, gain or loss of function can be investigated by establishing experimental conditions that challenge the gene product to fix meiotic errors. Although this system is advantageous in investigating human protein function during oogenesis, adequate interpretation of results should be undertaken given that protein expression is not at endogenous levels and, unless controlled for (i.e. knocked out or down), murine homologs are also present in the system.

As the genetic variants associated with human disease begin to become uncovered, it is becoming increasingly important to develop systems with which to rapidly evaluate the biological significance of those identified variants. This protocol describes methods for evaluating human gene function during female meiosis I using mouse oocytes.

Mayoz sırasında insan gen işlevini değerlendirmek için fare yumurta kullanarak ben

Embryonic aneuploidy is the major genetic cause of infertility in humans. Most of these events originate during female meiosis, and albeit positively ...

Genetik

Using Fluorescence In Situ Hybridization (FISH) to Monitor the State of Arm Cohesion in Prometaphase and Metaphase I Drosophila Oocytes

In humans, chromosome segregation errors in oocytes are responsible for the majority of miscarriages and birth defects. Moreover, as women age, their risk of conceiving an aneuploid fetus increases dramatically and this phenomenon is known as the maternal age effect. One requirement for accurate chromosome segregation during the meiotic divisions is maintenance of sister chromatid cohesion during the extended prophase period that oocytes experience. Cytological evidence in both humans and model organisms suggests that meiotic cohesion deteriorates during the aging process. In addition, segregation errors in human oocytes are most prevalent during meiosis I, consistent with premature loss of arm cohesion. The use of model organisms is critical for unraveling the mechanisms that underlie age-dependent loss of cohesion. Drosophila melanogaster offers several advantages for studying the regulation of meiotic cohesion in oocytes. However, until recently, only genetic tests were available to assay for loss of arm cohesion in oocytes of different genotypes or under different experimental conditions. Here, a detailed protocol is provided for using fluorescence in situ hybridization (FISH) to directly visualize defects in arm cohesion in prometaphase I and metaphase I arrested Drosophila oocytes. By generating a FISH probe that hybridizes to the distal arm of the X chromosome and collecting confocal Z stacks, a researcher can visualize the number of individual FISH signals in three dimensions and determine whether sister chromatid arms are separated. The procedure outlined makes it possible to quantify arm cohesion defects in hundreds of Drosophila oocytes. As such, this method provides an important tool for investigating the mechanisms that contribute to cohesion maintenance as well as the factors that lead to its demise during the aging process.

Using Fluorescence In Situ Hybridization FISH to Monitor the State of Arm Cohesion in Prometaphase and Metaphase I Drosophila Oocytes

This manuscript presents a detailed method for generating X-chromosome arm probes and performing fluorescence in situ hybridization (FISH) to examine the state of sister chromatid cohesion in prometaphase and metaphase I arrested Drosophila oocytes. This protocol is suitable for determining whether meiotic arm cohesion is intact or disrupted in different genotypes.

Kol uyum içinde prometafaz ve metafaz durumunu izlemek için Floresans In Situ hibridizasyon (balık) kullanarak ben Drosophila yumurta

In humans, chromosome segregation errors in oocytes are responsible for the majority of miscarriages and birth defects. Moreover, as women age, their risk ...

Gelişim Biyolojisi

Microinjection Techniques for Studying Mitosis in the Drosophila melanogaster Syncytial Embryo

This protocol describes the use of the Drosophila melanogaster syncytial embryo for studying mitosis1. Drosophila has useful genetics with a sequenced genome, and it can be easily maintained and manipulated. Many mitotic mutants exist, and transgenic flies expressing functional fluorescently (e.g. GFP) - tagged mitotic proteins have been and are being generated. Targeted gene expression is possible using the GAL4/UAS system2. 

The Drosophila early embryo carries out multiple mitoses very rapidly (cell cycle duration, &asymp;10 min). It is well suited for imaging mitosis, because during cycles 10-13, nuclei divide rapidly and synchronously without intervening cytokinesis at the surface of the embryo in a single monolayer just underneath the cortex. These rapidly dividing nuclei probably use the same mitotic machinery as other cells, but they are optimized for speed; the checkpoint is generally believed to not be stringent, allowing the study of mitotic proteins whose absence would cause cell cycle arrest in cells with a strong checkpoint. Embryos expressing GFP labeled proteins or microinjected with fluorescently labeled proteins can be easily imaged to follow live dynamics (Fig. 1). In addition, embryos can be microinjected with function-blocking antibodies or inhibitors of specific proteins to study the effect of the loss or perturbation of their function3. These reagents can diffuse throughout the embryo, reaching many spindles to produce a gradient of concentration of inhibitor, which in turn results in a gradient of defects comparable to an allelic series of mutants. Ideally, if the target protein is fluorescently labeled, the gradient of inhibition can be directly visualized4. It is assumed that the strongest phenotype is comparable to the null phenotype, although it is hard to formally exclude the possibility that the antibodies may have dominant effects in rare instances, so rigorous controls and cautious interpretation must be applied. Further away from the injection site, protein function is only partially lost allowing other functions of the target protein to become evident.

Microinjection Techniques for Studying Mitosis in the Drosophila melanogaster Syncytial Embryo

This protocol describes the use of microinjection and high resolution imaging in the Drosophila melanogaster syncytial embryo to study mitosis.

Mitoz incelenmesi için Mikroenjeksiyon Teknikleri Drosophila melanogaster Sinsityal Embriyo

This protocol describes the use of the Drosophila melanogaster syncytial embryo  for studying mitosis1.  Drosophila has useful genetics with a sequenced ...

Biyoloji

Nuclear Migration in the Drosophila Oocyte

Live cell imaging is particularly necessary to understand the cellular and molecular mechanisms that regulate organelle movements, cytoskeleton rearrangements, or polarity patterning within the cells. When studying oocyte nucleus positioning, live-imaging techniques are essential to capture the dynamic events of this process. The Drosophila egg chamber is a multicellular structure and an excellent model system to study this phenomenon because of its large size and availability of numerous genetic tools. During Drosophila mid-oogenesis, the nucleus migrates from a central position within the oocyte to adopt an asymmetric position mediated by microtubule-generated forces. This migration and positioning of the nucleus are necessary to determine the polarity axes of the embryo and the subsequent adult fly. One characteristic of this migration is that it occurs in three dimensions (3D), creating a necessity for live imaging. Thus, to study the mechanisms that regulate nuclear migration, we have developed a protocol to culture the dissected egg chambers and perform live imaging for 12 h by time-lapse acquisitions using spinning-disk confocal microscopy. Overall, our conditions allow us to preserve Drosophila egg chambers alive for a long period of time, thereby enabling the completion of nuclear migration to be visualized in a large number of samples in 3D.

Nuclear Migration in the Drosophila Oocyte

In Drosophila, the oocyte nucleus undergoes microtubule-dependent migration during oogenesis. Here, we describe a protocol that was developed to follow the migration by performing live imaging on egg chambers ex-vivo. Our procedure maintains egg chambers alive for 12 h to acquire multi-position 3D time-lapse movies using spinning-disk confocal microscopy.

Drosophila Oosyte'de Nükleer Göç

Live cell imaging is particularly necessary to understand the cellular and molecular mechanisms that regulate organelle movements, cytoskeleton ...

Confocal and Super-Resolution Imaging of Polarized Intracellular Trafficking and Secretion of Basement Membrane Proteins During Drosophila Oogenesis

The basement membrane (BM) - a specialized sheet of extracellular matrix present at the basal side of epithelial cells - is critical for the establishment and maintenance of epithelial tissue morphology and organ morphogenesis. Moreover, the BM is essential for tissue modeling, serving as a signaling platform, and providing external forces to shape tissues and organs. Despite the many important roles that the BM plays during normal development and pathological conditions, the biological pathways controlling the intracellular trafficking of BM-containing vesicles and how basal secretion leads to the polarized deposition of BM proteins are poorly understood. The follicular epithelium of the Drosophila ovary is an excellent model system to study the basal deposition of BM membrane proteins, as it produces and secretes all major components of the BM. Confocal and super-resolution imaging combined with image processing in fixed tissues allows for the identification and characterization of cellular factors specifically involved in the intracellular trafficking and deposition of BM proteins. This article presents a detailed protocol for staining and imaging BM-containing vesicles and deposited BM using endogenously tagged proteins in the follicular epithelium of the Drosophila ovary. This protocol can be applied to address both qualitative and quantitative questions and it was developed to accommodate high-throughput screening, allowing for the rapid and efficient identification of factors involved in the polarized intracellular trafficking and secretion of vesicles during epithelial tissue development.

Confocal and Super-Resolution Imaging of Polarized Intracellular Trafficking and Secretion of Basement Membrane Proteins During Drosophila Oogenesis

The basement membrane is essential for tissue and organ morphogenesis during development. To better understand the mechanisms leading to proper placement of this structure, the protocol presented describes methods to visualize and characterize the intracellular trafficking and secretion of basement membrane proteins in epithelial cells using confocal and super-resolution microscopy.

Drosophila Oogenezi Sırasında Polarize Hücre İçi Kaçakçılığın ve Bazalton Membran Proteinlerinin Sekresyonunun Konfokal ve Süper Rezolüsyonlu Görüntülenmesi

The basement membrane (BM) - a specialized sheet of extracellular matrix present at the basal side of epithelial cells - is critical for the establishment ...

Mouse Oocyte Microinjection, Maturation and Ploidy Assessment

Mistakes in chromosome segregation lead to aneuploid cells. In somatic cells, aneuploidy is associated with cancer but in gametes, aneuploidy leads to infertility, miscarriages or developmental disorders like Down syndrome. Haploid gametes form through species-specific developmental programs that are coupled to meiosis. The first meiotic division (MI) is unique to meiosis because sister chromatids remain attached while homologous chromosomes are segregated. For reasons not fully understood, this reductional division is prone to errors and is more commonly the source of aneuploidy than errors in meiosis II (MII) or than errors in male meiosis 1,2. 
In mammals, oocytes arrest at prophase of MI with a large, intact germinal vesicle (GV; nucleus) and only resume meiosis when they receive ovulatory cues. Once meiosis resumes, oocytes complete MI and undergo an asymmetric cell division, arresting again at metaphase of MII. Eggs will not complete MII until they are fertilized by sperm. Oocytes also can undergo meiotic maturation using established in vitro culture conditions 3. Because generation of transgenic and gene-targeted mouse mutants is costly and can take long periods of time, manipulation of female gametes in vitro is a more economical and time-saving strategy. 
Here, we describe methods to isolate prophase-arrested oocytes from mice and for microinjection. Any material of choice may be introduced into the oocyte, but because meiotically-competent oocytes are transcriptionally silent 4,5 cRNA, and not DNA, must be injected for ectopic expression studies. To assess ploidy, we describe our conditions for in vitro maturation of oocytes to MII eggs. Historically, chromosome-spreading techniques are used for counting chromosome number 6. This method is technically challenging and is limited to only identifying hyperploidies. Here, we describe a method to determine hypo-and hyperploidies using intact eggs 7-8. This method uses monastrol, a kinesin-5 inhibitor, that collapses the bipolar spindle into a monopolar spindle 9 thus separating chromosomes such that individual kinetochores can readily be detected and counted by using an anti-CREST autoimmune serum. Because this method is performed in intact eggs, chromosomes are not lost due to operator error.

Oocytes are prone to aneuploidy due to errors in chromosome segregation during meiotic maturation. Aneuploid eggs can cause infertility, miscarriages or developmental disorders like Down syndrome. Here, we describe methods to introduce materials of choice into oocytes and methods to study meiotic maturation and assess ploidy.

Fare Oosit Mikroenjeksiyon, olgunlaşması ve ploidi Değerlendirmesi

Mistakes in chromosome segregation lead to aneuploid cells.  In somatic cells, aneuploidy is associated with cancer but in gametes, aneuploidy leads to ...

Studying Mitotic Checkpoint by Illustrating Dynamic Kinetochore Protein Behavior and Chromosome Motion in Living Drosophila Syncytial Embryos

The spindle assembly checkpoint (SAC) mechanism is an active signal, which monitors the interaction between chromosome kinetochores and spindle microtubules to prevent anaphase onset until the chromosomes are properly connected. Cells use this mechanism to prevent aneuploidy or genomic instability, and hence cancers and other human diseases like birth defects and Alzheimer's1. A number of the SAC components such as Mad1, Mad2, Bub1, BubR1, Bub3, Mps1, Zw10, Rod and Aurora B kinase have been identified and they are all kinetochore dynamic proteins2. Evidence suggests that the kinetochore is where the SAC signal is initiated. The SAC prime regulatory target is Cdc20. Cdc20 is one of the essential APC/C (Anaphase Promoting Complex or Cyclosome) activators3 and is also a kinetochore dynamic protein4-6. When activated, the SAC inhibits the activity of the APC/C to prevent the destruction of two key substrates, cyclin B and securin, thereby preventing the metaphase to anaphase transition7,8. Exactly how the SAC signal is initiated and assembled on the kinetochores and relayed onto the APC/C to inhibit its function still remains elusive.
Drosophila is an extremely tractable experimental system; a much simpler and better-understood organism compared to the human but one that shares fundamental processes in common. It is, perhaps, one of the best organisms to use for bio-imaging studies in living cells, especially for visualization of the mitotic events in space and time, as the early embryo goes through 13 rapid nuclear division cycles synchronously (8-10 minutes for each cycle at 25 &deg;C) and gradually organizes the nuclei in a single monolayer just underneath the cortex9.
Here, I present a bio-imaging method using transgenic Drosophila expressing GFP (Green Fluorescent Protein) or its variant-targeted proteins of interest and a Leica TCS SP2 confocal laser scanning microscope system to study the SAC function in flies, by showing images of GFP fusion proteins of some of the SAC components, Cdc20 and Mad2, as the example.

Studying Mitotic Checkpoint by Illustrating Dynamic Kinetochore Protein Behavior and Chromosome Motion in Living Drosophila Syncytial Embryos

The kinetochore is where the SAC initiates its signal monitoring the mitotic segregation of the sister chromatids. A method is described to visualize the recruitment and turnover of one of the kinetochore proteins and its coordination with the chromosome motion in Drosophila embryos using a Leica laser scanning confocal system.

Living Görselleştirilmesi Dinamik Kinetochore Protein Davranış ve Kromozom Hareket tarafından Mitotik Checkpoint incelenmesi<em&gt; Drosophila</em&gt; Sinsityal Embriyolar

The spindle assembly checkpoint (SAC) mechanism is an active signal, which monitors the interaction between chromosome kinetochores and spindle ...

Live Imaging of GFP-labeled Proteins in Drosophila Oocytes

The Drosophila oocyte has been established as a versatile system for investigating fundamental questions such as cytoskeletal function, cell organization, and organelle structure and function. The availability of various GFP-tagged proteins means that many cellular processes can be monitored in living cells over the course of minutes or hours, and using this technique, processes such as RNP transport, epithelial morphogenesis, and tissue remodeling have been described in great detail in Drosophila oocytes1,2.
The ability to perform video imaging combined with a rich repertoire of mutants allows an enormous variety of genes and processes to be examined in incredible detail. One such example is the process of ooplasmic streaming, which initiates at mid-oogenesis3,4. This vigorous movement of cytoplasmic vesicles is microtubule and kinesin-dependent5 and provides a useful system for investigating cytoskeleton function at these stages.
Here I present a protocol for time lapse imaging of living oocytes using virtually any confocal microscopy setup.

Live Imaging of GFP-labeled Proteins in Drosophila Oocytes

A protocol for live imaging of GFP-tagged proteins or autofluorescent structures in individual Drosophila oocytes is described.

GFP etiketli Proteinlerin Görüntüleme Canlı<em&gt; Drosophila</em&gt; Oosit

The  Drosophila oocyte has been established as a versatile system for investigating  fundamental questions such as cytoskeletal function, cell ...

Cytological Analysis of Spermatogenesis: Live and Fixed Preparations of Drosophila Testes

Drosophila melanogaster is a powerful model system that has been widely used to elucidate a variety of biological processes. For example, studies of both the female and male germ lines of Drosophila have contributed greatly to the current understanding of meiosis as well as stem cell biology. Excellent protocols are available in the literature for the isolation and imaging of Drosophila ovaries&#160;and testes3-12. Herein, methods for the dissection and preparation of Drosophila testes for microscopic analysis are described with an accompanying video demonstration. A protocol for isolating testes from the abdomen of adult males and preparing slides of live tissue for analysis by phase-contrast microscopy as well as a protocol for fixing and immunostaining testes for analysis by fluorescence microscopy are presented. These techniques can be applied in the characterization of Drosophila mutants that exhibit defects in spermatogenesis as well as in the visualization of subcellular localizations of proteins.

Cytological Analysis of Spermatogenesis: Live and Fixed Preparations of Drosophila Testes

Methods for isolating and preparing Drosophila testes samples (live and fixed) for imaging by phase-contrast and fluorescence microscopy are described herein.&#160;

Spermatogenez sitolojik analizi: Canlı ve Sabit Hazırlıklar<em&gt; Drosophila</em&gt; Testisler

Drosophila melanogaster is a powerful model system that has been widely used to elucidate a variety of biological processes. For example, studies of both ...

Preparation of Fixed Drosophila Oocytes for Immunostaining: A High-Throughput Method to Fix and Remove the Outer Membrane

Source: Radford, S. J., McKim, K. S. <a href="https://www.jove.com/video/54666/" target="_blank">Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes</a>. J. Vis. Exp. (2016).
Immunostaining of Drosophila late-stage oocytes can prove challenging due to the oocytes&#39; surrounding membranes. This video describes a high-throughput method for obtaining oocytes, their fixation, and membranes&#39; removal for immunostaining. The featured protocol demonstrates these techniques with late-stage oocytes used to visualize different stages of meiosis.

İmmün boyama için sabit Drosophila oositlerinin hazırlanması: dış zarı sabitlemek ve çıkarmak için yüksek verimli bir yöntem

Source: Radford, S. J., McKim, K. S. Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes. J. Vis. Exp. (2016).
...

Sabit Görüntüleme prometafaz ve Metafaz Mayoz ve I Teknikleri

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler