The authors would like to thank the National Key Research and Development Program of China (Grant No. 2021YFD2200502), the National Natural Science Foundation of China (Grant No. 31971736) for the financial support.

1. Preparation of bamboo seedlings
<ol>
	<li>Prepare moso bamboo (Phyllostachys edulis) seedlings using seeds harvested in Guilin, Guangxi, China. Begin by soaking the seeds in water for 2-3 days, making sure to change the water daily. Next, create a substrate by mixing soil and vermiculite in a ratio of 3:1.</li>
	<li>Sow the soaked seeds into the substrate for germination. Maintain the seedlings under laboratory conditions, keeping the temperature between 18-25 &#176;C. Ensure a 16 h light/8 h dark photoperiod with a light intensity of 250-350 &#181;mol/m2/s during the light phase.</li>
	<li>Maintain a relative humidity of approximately 60%. For Agrobacterium-infection, use seedlings that are 15 days old and have a height of 2-10 cm, which is the best stage for transformation. 
	NOTE: Because bamboo flowering is unpredictable, seeds are not available every year. The seeds are usually stored for 2-3 years at 4 &#176;C in a dry environment and can still maintain a viability of over 20%.</li>
</ol>
2. Preparation of plasmids and&#160;&#160;Agrobacterium
<ol>
	<li>Plasmids: To validate the transient expression effect, employ the pHDE-35S::RUBY construct containing a visible reporter gene driven by the CaMV 35S promoter10. For gene editing, use the pCambia1300-Ubi::Cas9 construct, which carries the Cas9 gene driven by the maize Ubi promoter11. Insert the sgRNA guiding sequences of PeVDE and other target genes between the two AarI sites in the pCambia1300-Ubi::Cas9 construct9.</li>
	<li>Insert the CRISPR/Cas9 guide RNA sequences between the two AarI restriction endonuclease sites of the pCambia1300-Ubi::Cas9 construct, including PeVDE and PeCCR5 target genes.</li>
	<li>Add GGCA to the 5&#39; end of the 20-nucleotide sequence and synthesize a single-stranded DNA sequence. Reverse complement the 20-nucleotide sequence and add AAAC to the 5&#39; end, then synthesize another single-stranded DNA sequence.</li>
	<li>Dilute both single-stranded DNA sequences to a concentration of 10 nM/L in diluted water, mix thoroughly, and heat at 95 &#176;C for 5 min. Allow the mixture to cool to room temperature, resulting in the formation of double-stranded adapters.</li>
	<li>Connect the adapters with the linear pCambia1300-Ubi::Cas9 fragment digested by AarI endonuclease using T4 DNA ligase and sequence the constructed CRISPR/Cas9 vector to obtain the desired gene-targeting construct.</li>
	<li>To transform plasmids into Agrobacterium, use the freeze-thaw method as follows: Mix 1 &#181;L of the plasmids (concentration: 10 - 1,000 ng/&#181;L) with 100 &#181;L of Agrobacterium-competent cells (translation efficiency: &#62; 1 x 104 colony-forming-units/&#181;g) and gently mix them. Place the mixture on ice for 5 min. Transfer the mixture to liquid nitrogen for 5 min.</li>
	<li>Thaw the mixture in a 37 &#176;C water bath for 5 min. Add 500 &#181;L of Luria-Bertani (LB) medium to the mixture and incubate it on a shaking incubator at 28 &#176;C at 200 rpm for 2-3 h. For the pHDE-35S::RUBY plasmids, introduce them individually into the AGL1, GV3101, LBA4044, and EHA105 strains of Agrobacterium tumefaciens (A. tumefaciens)12. For the CRISPR/Cas9 plasmids, introduce them into the GV3101 strain of A. tumefaciens.</li>
	<li>Grow Agrobacterium in yeast extract peptone (YEP) medium (10 g beef extract, 10 g yeast extract, and 5 g NaCl per L) with the corresponding antibiotics (spectinomycin for 35S::RUBY and kanamycin for CRISPR/Cas9) at 28 &#176;C. The single colonies were observed 36-48 h after cultivation.</li>
	<li>Pick and transfer the colonies into liquid YEP medium (with corresponding antibiotics) for further growth. After 24-36 h, use the primers of RUBY-F and RUBY-R (Table 1) to perform PCR to confirm the successful transfer of plasmids into Agrobacterium.</li>
	<li>Transfer 1 mL of the successfully transformed Agrobacterium into 100 mL of fresh liquid YEP medium (with corresponding antibiotics) and then grow overnight at 28 &#176;C to an OD600 of 0.8.</li>
	<li>Centrifuge the bacterial suspension at 4,000 x g for 5 min at 4 &#176;C, wash the bacterial pellet once with suspensions infiltration medium (10 mM MgCl2 and 10 mM MES-KOH [pH 5.6]), and then centrifuge again. Resuspend the bacterial pellet in a suspension infiltration medium to an OD600 of 0.6 for bamboo transformation.</li>
</ol>
3. Agrobacterium -mediated in planta transformation system
<ol>
	<li>Prepare for transformation; carefully remove the seedlings with soil-attached roots from the substrate, ensuring the roots remain intact. Wrap the seedlings with tin foil to maintain moisture and prevent soil detachment (Figure 1A).</li>
	<li>Transfer the wrapped seedlings to an environment with higher humidity (relative air humidity &#62;90%) and lower illumination (intensity less than 50 &#181;mol/m2/s) for a duration of 2 h.</li>
	<li>Using a sharp needle from a syringe, wound the upper part of curled immature leaves (approximately 1-2 cm from the top) of the bamboo seedlings once or twice (as indicated by the red triangles in Figure 1A).</li>
	<li>Afterward, dip the wounded upper part of the seedlings into suspensions of Agrobacterium. Perform the entire process, from wounding to dipping into Agrobacterium rapidly, as the fresh wound will increase inoculation efficiency.</li>
	<li>Immediately transfer the seedlings to a vacuum chamber with a pressure of 25-27 mmHg for 2 min (Figure 1B).</li>
	<li>After vacuuming, carefully unwrap the seedlings and replant them into the substrate. Place the seedlings in dim light or darkness (&#60;50 &#181;mol/m2/s) with high humidity (RH&#62;90%) at room temperature (18-25 &#176;C) for 2 days. Subsequently, culture the seedlings under normal growth conditions, watering them every 5-7 days. Observe their phenotypes to provide materials for subsequent experiments.</li>
</ol>
4. Designing single guide RNAs (sgRNAs) for gene editing
<ol>
	<li>Identify a protospacer adjacent motif (PAM) site located near a specific and conserved domain of the target gene sequence. Ensure that the specific PAM sequence is NGG in this CRISPR/Cas9 system. Verify the on-target specificity of the selected sequence by performing a BlastN search against the bamboo genome database. Ensure that the sgRNA is unique, especially in the upstream region and close to the PAM9,11. 
	NOTE: This comparison will effectively reduce potential off-target sites in the genome affected by the gene-editing process.</li>
	<li>Design two sgRNAs (sgRNA-1 and sgRNA-2) on the first exon of the PeVDE gene13. Include AgeI restriction sites upstream of the PAM in sgRNA-1 and XbaI restriction sites upstream of the PAM in sgRNA-2. Design one sgRNA on the fourth exon of the PeCCR5 gene, which encodes the conserved motif of KNWYCYGK. This motif is critical for the catalysis of CCRs14.</li>
	<li>Design a 20 nucleotide spacer sequence adjacent to the PAM site. This spacer sequence will guide the Cas9 enzyme to the target site for DNA cleavage and subsequent gene editing. 
	&#8203;NOTE: It is advisable to choose a target region upstream of the endonuclease enzyme cleavage site within the PAM site. This will facilitate the validation of gene editing efficiency.</li>
</ol>
5. Primer design and PCR
<ol>
	<li>Manually design specific primers for amplification of the PeVDE and PeCCR5 fragments. Design the upstream and downstream primers to be located at least 100 bp outside the target site, with a length difference of over 100 bp to allow for distinct band separation during electrophoresis. Design primers for amplification of RUBY within the first 500 bp of the gene. A list of all primers used is provided in Table 1.</li>
	<li>Use a high-fidelity DNA polymerase for PCR. In this case, utilize DNA polymerase with high fidelity and efficient amplification in gene cloning.</li>
	<li>Prepare the PCR reaction mixture as follows: 5x buffer (Mg2+ Plus): 4 &#181;L; dNTP mixture (2.5 mM each): 1.6 &#181;L; Forward and reverse primers (10 pmol each): 1 &#181;L each; bamboo genome DNA (approximately 50 ng); DNA Polymerase (2.5 U/&#181;L): 0.2 &#181;L; Dilute water to a total volume of 20 &#181;L.</li>
	<li>Follow the PCR running conditions: Initial denaturation at 98 &#176;C for 5 min; Denaturation at 98 &#176;C for 10 s; Annealing at 56 &#176;C for 5 s; Extension at 72 &#176;C for 30 s; Repeat denaturation to extension for 32 cycles; Final extension at 72 &#176;C for 5 min; Hold at 4 &#176;C indefinitely. 
	&#8203;NOTE: PCR conditions are provided as an example and may need to be optimized for specific applications or targets.</li>
</ol>
6. DNA extraction, endonuclease enzyme digestion, and sequencing
<ol>
	<li>Separate the region with lower NPQ values from fresh bamboo leaf blades using scissors, as identified by the imaging-PAM fluorometer (refer to step 7.4). Freeze the leaf samples with liquid nitrogen and transfer the frozen leaf samples into a mortar. Grind the samples into a fine powder using a pestle, adding enough liquid nitrogen during the grinding process. This step helps in releasing the cellular content, including DNA.</li>
	<li>Extract genomic DNA from the powdered leaf using the Cetyltrimethylammonium Ammonium Bromide (CTAB) method. Add 50 mg of leaf powder samples to 800 &#181;L of a 2% CTAB solution. Mix the sample thoroughly and incubate at 65 &#176;C for 30 min, with gentle shaking every 5 min.</li>
	<li>Add an equal volume of chloroform/isoamyl alcohol (24:1, v/v) and vigorously shake the mixture. After centrifugation at 8,000 g for 8 min, transfer the supernatant to a new tube.</li>
	<li>Add an equal volume of chloroform/isoamyl alcohol and repeat step 6.3. Add an equal volume of ice-cold isopropanol, and invert the tube several times before being placed at -20 &#176;C for 30 min. After centrifugation at 8,000 x g for 5 min, discard the supernatant.</li>
	<li>Wash the DNA pellet 2x with 75% ethanol at 4 &#176;C, then dissolve in 50 &#181;L of water.</li>
	<li>Amplify the genomic DNA containing the target site of the target genes from both wild-type and Agrobacterium-infected bamboo leaves with the protocol in step 5.4.</li>
	<li>Perform endonuclease enzyme digestion of the PCR products. Select a specific enzyme that recognizes the desired restriction sites within the amplified DNA fragments. Use AgeI and XbaI endonucleases for digestion.</li>
	<li>Prepare a reaction mixture consisting of AgeI or XbaI (20 units/&#181;L)- 1 &#181;L, 1 &#181;g PCR products, 10x buffer- 5 &#181;L, and add water to a total volume of 50 &#181;L. Incubate at 37 &#176;C for 1 h.</li>
	<li>Analyze the proportion of digested DNA fragments using gel electrophoresis. Compare the digested fragments from the wild-type and Agrobacterium-infected samples to assess gene editing efficiency.</li>
	<li>Tag the transposase adapter TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG and GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG sequences to the 5&#39; end of the forward and reverse primers, respectively, for the amplification of PeVDE and PeCCR5 fragments9,15. Use the protocol described in step 5.4 for amplification. Prepare the PCR products (before digestion) for deep sequencing.</li>
</ol>
7. Measurement of chlorophyll fluorescence of NPQ values in leaves
<ol>
	<li>Prior to the measurements, expose the bamboo seedlings to high light intensity conditions of 1200 &#181;mol/m2/s for 2 h. This exposure increases the amount of absorbed light quantum and activates the photoprotection system in the leaves.</li>
	<li>Use an imaging-PAM fluorometer to measure the in vivo PS II chlorophyll fluorescence of bamboo leaves. Set the actinic light intensity to 800 &#181;mol/m2/s for 6 min fluorescence measurements. During this period, apply a saturating pulse every 30 s to obtain chlorophyll fluorescence curves. The stable values of the curves will be used for calculations13.</li>
	<li>Calculate the non-photochemical quenching (NPQ) using the formula: 
	NPQ = (Fm - Fm&#39;) / Fm&#39; 
	where Fm represents the maximum fluorescence in the dark-adapted state, and Fm&#39; represents the maximum fluorescence in any light-adapted state.</li>
	<li>Monitor the NPQ values from the visual interface of the imaging software. The software allows real-time analysis and display of the fluorescence data, including the NPQ values.</li>
</ol>

Developing Gene Transformation and Editing Methods in Bamboo

<ol>
	<li>Jiang, Z. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> World Bamboo and Rattan (in Chinese). , (2002).</li><li>Ye, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+plant+regeneration+and+transformation+system+of+ma+bamboo+(Dendrocalamus+latiflorus+Munro)+started+from+young+shoot+as+explant.">An efficient plant regeneration and transformation system of ma bamboo (Dendrocalamus latiflorus Munro) started from young shoot as explant.</a> Frontiers in Plant Science. 8, 1298 (2017).</li><li>Ye, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Robust+CRISPR/Cas9+mediated+genome+editing+and+its+application+in+manipulating+plant+height+in+the+first+generation+of+hexaploid+Ma+bamboo+(Dendrocalamus+latiflorus+Munro).">Robust CRISPR/Cas9 mediated genome editing and its application in manipulating plant height in the first generation of hexaploid Ma bamboo (Dendrocalamus latiflorus Munro).</a> Plant Biotechnology Journal. 18 (7), 1501-1503 (2020).</li><li>Xiang, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+purple+Ma+bamboo+(Dendrocalamus+latiflorus+Munro)+with+enhanced+drought+and+cold+stress+tolerance+by+engineering+anthocyanin+biosynthesis.">Production of purple Ma bamboo (Dendrocalamus latiflorus Munro) with enhanced drought and cold stress tolerance by engineering anthocyanin biosynthesis.</a> Planta. 254 (3), 50 (2021).</li><li>Huang, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+genetic+transformation+and+CRISPR/Cas9-based+genome+editing+system+for+moso+bamboo+(Phyllostachys+edulis).">An efficient genetic transformation and CRISPR/Cas9-based genome editing system for moso bamboo (Phyllostachys edulis).</a> Frontiers in Plant Science. 13, 822022 (2022).</li><li>Lee, M. W., Yang, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+expression+assay+by+agroinfiltration+of+leaves.">Transient expression assay by agroinfiltration of leaves.</a> Methods in Molecular Biology. 323, 225-229 (2006).</li><li>Canto, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+expression+systems+in+plants:+potentialities+and+constraints.">Transient expression systems in plants: potentialities and constraints.</a> Advances in Experimental Medicine and Biology. 896, 287-301 (2016).</li><li>Chen, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+the+production+and+expedient+screening+of+CRISPR/Cas9-mediated+non-transgenic+mutant+plants.">A method for the production and expedient screening of CRISPR/Cas9-mediated non-transgenic mutant plants.</a> Horticulture Research. 5, 13 (2018).</li><li>Sun, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+biotechnology+for+in-planta+gene+editing+and+its+application+in+promoting+flavonoid+biosynthesis+in+bamboo+leaves.">A new biotechnology for in-planta gene editing and its application in promoting flavonoid biosynthesis in bamboo leaves.</a> Plant Methods. 19 (1), 20 (2023).</li><li>He, Y., Zhang, T., Sun, H., Zhan, H., Zhao, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reporter+for+noninvasively+monitoring+gene+expression+and+plant+transformation.">A reporter for noninvasively monitoring gene expression and plant transformation.</a> Horticulture Research. 7 (1), 152 (2020).</li><li>Wang, C., Shen, L., Fu, Y., Yan, C., Wang, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple+CRISPR/Cas9+system+for+multiplex+genome+editing+in+rice.">A simple CRISPR/Cas9 system for multiplex genome editing in rice.</a> Journal of Genetics and Genomics. 42 (12), 703-706 (2015).</li><li>McCormick, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Leaf+disc+transformation+of+cultivated+tomato+(L.+esculentum)+using+Agrobacterium+tumefaciens.">Leaf disc transformation of cultivated tomato (L. esculentum) using Agrobacterium tumefaciens.</a> Plant Cell Reports. 5 (2), 81-84 (1986).</li><li>Lou, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=a+violaxanthin+de-epoxidase+gene+from+moso+bamboo,+confers+photoprotection+ability+in+transgenic+Arabidopsis+under+high+light.">a violaxanthin de-epoxidase gene from moso bamboo, confers photoprotection ability in transgenic Arabidopsis under high light.</a> Frontiers in Plant Science. 13, 927949 (2022).</li><li>Zhou, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+cinnamoyl+CoA+reductases+involved+in+parallel+routes+to+lignin+in+Medicago+truncatula.">Distinct cinnamoyl CoA reductases involved in parallel routes to lignin in Medicago truncatula.</a> Proceedings of the National Academy of Sciences of the United States of America. 107 (41), 17803-17808 (2010).</li><li>De Roeck, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deleterious+ABCA7+mutations+and+transcript+rescue+mechanisms+in+early+onset+Alzheimer's+disease.">Deleterious ABCA7 mutations and transcript rescue mechanisms in early onset Alzheimer's disease.</a> Acta Neuropathologica. 134 (3), 475-487 (2017).</li></ol>

The authors declare that they have no competing interests.

This method significantly reduces the time required compared to traditional genetic transformation methods, which typically take 1-2 years, and achieves transient expression of exogenous genes and gene editing of endogenous genes within 5 days. However, this method has limitations as it can only transform a small proportion of cells, and the gene-edited leaves are chimeric and lack the ability to regenerate into complete plants. Nevertheless, this in planta gene expression and gene editing technology provides a ...

The investigation of gene function in bamboo holds great promise for the advanced understanding of bamboo and unlocking its potential for genetic modification. An effective way of this can be achieved through the process of Agrobacterium-mediated infection in bamboo leaves, whereby the T-DNA fragment containing exogenous genes is introduced into the cells, subsequently leading to the expression of the genes within the leaf cells.
Bamboo is a valuable and renewable resource with a wide range of applications in manufacturing, art, and research. Bamboo possesses excellent wood properties such as high mechanical strength, toughness, moderate stiffness, and flexibility1, which is now widely used in a variety of household and industrial supplies, including toothbrushes, straws, buttons, disposable tableware, underground pipelines, and cooling tower fillers for thermal power generation. Therefore, bamboo breeding plays a crucial role in obtaining bamboo varieties with excellent wood properties for replacing plastics and reducing plastic usage, protecting the environment, and tackling climate change, as well as generating significant economic value.
However, traditional bamboo breeding faces challenges due to the lengthy vegetative growth stage and uncertain flowering period. Although molecular breeding techniques have been developed and applied to bamboo breeding, the process of bamboo gene transformation is time-consuming, labor-intensive, and complicated due to the callus induction and regeneration processes2,3,4,5. Stable genetic transformation often requires Agrobacterium-mediated methods, which involve tissue culture processes such as callus induction and regeneration. However, bamboo has a low ability for callus regeneration, greatly limiting the application of stable genetic transformation in bamboo. After Agrobacterium infects plant cells, the T-DNA fragment enters the plant cells, with the majority of T-DNA fragments remaining non-integrated in the cells, resulting in transient expression. Only a small portion of T-DNA fragments randomly integrate into its chromosome, leading to stable expression. The transient expression levels show an accumulation curve that can vary for each gene expressed from an Agrobacterium-delivered T-DNA. In most cases, the highest expression levels occur 3-4 days after infiltration and quickly decrease after 5-6 days6,7. Previous studies have shown that more than 1/3rd of mutations in gene-edited plants obtained without selection pressure for resistance come from the transient expression of CRISPR/Cas9, while the remaining less than 2/3rd come from stable expression after DNA integration into the genome8. This indicates that T-DNA integration into the plant genome is not necessary for gene editing. Moreover, selection pressure for resistance significantly inhibits the growth of non-transgenic cells, directly affecting the regeneration process of infected explants. Therefore, by using transient expression without selection pressure for resistance in bamboo, it is possible to achieve non-integrated expression of exogenous genes and study gene function directly in plant organs. Hence, an easy and time-saving method can be developed for exogenous gene expression and editing in bamboo9.
The developed exogenous gene expression and gene editing method is characterized by its simplicity, cost-effectiveness, and the absence of expensive equipment or complex procedures9. In this method, the bamboo endogenous violaxanthin de-epoxidase gene (PeVDE) was used as the reporter for exogenous gene expression without selection pressure. This is because the edited PeVDE in bamboo leaves reduces the photoprotection ability under high light and demonstrates a decrease in the non-photochemical quenching (NPQ) value, which can be detected through chlorophyll fluorescence imaging. To demonstrate the effectiveness of this method, another bamboo endogenous gene, the cinnamoyl-CoA reductase gene (PeCCR5)9, was knocked out using this system and successfully generated mutants of this gene. This technique can be used for the functional characterization of genes that have functions in bamboo leaves. By overexpressing these genes transiently in bamboo leaves, their expression levels can be enhanced, or by gene editing, their expression can be knocked down, allowing for the study of downstream gene expression levels, leaf phenotypes, and product contents. This provides a more efficient and feasible approach for gene function research in bamboo. This technique can be applied to the functional characterization of genes that function in bamboo leaves. By overexpressing these genes transiently in bamboo leaves, their expression levels can be enhanced, or by gene editing, their expression can be knocked down, allowing for the study of downstream gene expression levels, leaf phenotypes, and product contents. Additionally, it is important to note that, due to extensive polyploidization, the majority of commercially important genes in bamboo genomes are present in multiple copies, resulting in genetic redundancy. This poses a challenge for performing multiplex genome editing in bamboo. Prior to the application of stable genetic transformation or gene editing techniques, it is crucial to quickly validate gene functions. In addressing the issue of multiple gene copies, one approach is to analyze transcriptome expression profiles to identify genes that are actively expressed during specific stages. Furthermore, targeting the conserved functional domains of these gene copies allows for the design of common target sequences or the incorporation of multiple target sites into the same CRISPR/Cas9 vector, enabling the simultaneous knockout of these genes. This provides a more efficient and feasible approach for gene function research in bamboo.

<table><tbody><tr><td>&lt;em&gt;35S::RUBY&lt;/em&gt;</td><td>Addgene, United States</td><td>160908</td><td>Plamid construct</td></tr><tr><td>&lt;em&gt;Agrobacterium &lt;/em&gt;competent cells of GV3101, EHA105,LBA4404, and AGL1</td><td>Biomed, China</td><td>BC304-01, BC303-01, BC301-01, and BC302-01</td><td>For Agrobacterium infection</td></tr><tr><td>CTAB</td><td>Sigma-Aldrich, United States</td><td>57-09-0</td><td>DNA extraction</td></tr><tr><td>Imaging-PAM fluorometer</td><td>Walz, Effeltrich, Germany</td><td></td><td>Detect chlorophyll fluorescence of bamboo leaves</td></tr><tr><td>ImagingWin</td><td>Walz, Effeltrich, Germany</td><td></td><td>Software for Imaging-PAM fluorometer</td></tr><tr><td>&lt;em&gt;Paq &lt;/em&gt;CI or &lt;em&gt;Aar &lt;/em&gt;I</td><td>NEB, United States</td><td>R0745S</td><td>Incorporate the target sequence onto the CRISPR/Cas9 vector.</td></tr><tr><td>PrimeSTAR Max DNA polymerase</td><td>Takara, Japan</td><td>R045Q</td><td>For gene cloning</td></tr><tr><td>T4 DNA ligase</td><td>NEB, United States</td><td>M0202V</td><td>Incorporate the target sequence onto the CRISPR/Cas9 vector.</td></tr></tbody></table>

in planta gene expression and gene editing in moso bamboo leaves

A novel in planta gene transformation method was developed for bamboo, which avoids the need for time-consuming and labor-intensive callus induction and regeneration processes. This method involves Agrobacterium-mediated gene expression via wounding and vacuum for bamboo seedlings. It successfully demonstrated the expression of exogenous genes, such as the RUBY reporter and Cas9 gene, in bamboo leaves. The highest transformation efficiency for the accumulation of betalain in RUBY seedlings was achieved using the GV3101 strain, with a percentage of 85.2% after infection. Although the foreign DNA did not integrate into the bamboo genome, the method was efficient in expressing the exogenous genes. Furthermore, a gene editing system has also been developed with a native reporter using this method, from which an in situ mutant generated by the edited bamboo violaxanthin de-epoxidase gene (PeVDE) in bamboo leaves, with a mutation rate of 17.33%. The mutation of PeVDE resulted in decreased non-photochemical quenching (NPQ) values under high light, which can be accurately detected by a fluorometer. This makes the edited PeVDE a potential native reporter for both exogenous and endogenous genes in bamboo. With the reporter of PeVDE, a cinnamoyl-CoA reductase gene was successfully edited with a mutation rate of 8.3%. This operation avoids the process of tissue culture or callus induction, which is quick and efficient for expressing exogenous genes and endogenous gene editing in bamboo. This method can improve the efficiency of gene function verification and will help reveal the molecular mechanisms of key metabolic pathways in bamboo.

Agrobacterium-mediated in planta gene expression in bamboo leaves 
The RUBY reporter gene has been demonstrated to be effective in visualizing transient gene expression due to its ability to produce vivid red betalain from tyrosine10. In this study, Agrobacterium-mediated transformation was utilized to transiently express the exogenous RUBY gene in bamboo leaves (Figure 1). At&#160; the 3rd ...

Watch this Scientific Journal Video about Advancing Gene Editing in Bamboo Leaves for Sustainable Plastic Alternatives at JoVE.com

Author Spotlight: Advancing Gene Editing in Bamboo Leaves for Sustainable Plastic Alternatives 

In this study, a novel in planta gene expression and gene editing method mediated by Agrobacterium was developed in bamboo. This method greatly improved the efficiency of gene function validation in bamboo, which has significant implications for accelerating the process of bamboo breeding.

In Planta Gene Expression and Gene Editing in Moso Bamboo Leaves

A novel in planta gene transformation method was developed for bamboo, which avoids the need for time-consuming and labor-intensive callus induction and ...

in-planta-gene-expression-and-gene-editing-in-moso-bamboo-leaves

Research

JoVE Journal

Biology

1.5K Views.  Key Laboratory of State Forestry and Grassland Administration/Beijing on Bamboo & Rattan Science and Technology. In this study, a novel in planta gene expression and gene editing method mediated by Agrobacterium was developed in bamboo. This method greatly improved the efficiency of gene function validation in bamboo, which has significant implications for accelerating the process of bamboo breeding.

Video: Author Spotlight: Advancing Gene Editing in Bamboo Leaves for Sustainable Plastic Alternatives 

A Robotic Platform for High-throughput Protoplast Isolation and Transformation

Over the last decade there has been a resurgence in the use of plant protoplasts that range from model species to crop species, for analysis of signal transduction pathways, transcriptional regulatory networks, gene expression, genome-editing, and gene-silencing. Furthermore, significant progress has been made in the regeneration of plants from protoplasts, which has generated even more interest in the use of these systems for plant genomics. In this work, a protocol has been developed for automation of protoplast isolation and transformation from a &#39;Bright Yellow&#39; 2 (BY-2) tobacco suspension culture using a robotic platform. The transformation procedures were validated using an orange fluorescent protein (OFP) reporter gene (pporRFP) under the control of the Cauliflower mosaic virus 35S promoter (35S). OFP expression in protoplasts was confirmed by epifluorescence microscopy. Analyses also included protoplast production efficiency methods using propidium iodide. Finally, low-cost food-grade enzymes were used for the protoplast isolation procedure, circumventing the need for lab-grade enzymes that are cost-prohibitive in high-throughput automated protoplast isolation and analysis. Based on the protocol developed in this work, the complete procedure from protoplast isolation to transformation can be conducted in under 4 hr, without any input from the operator. While the protocol developed in this work was validated with the BY-2 cell culture, the procedures and methods should be translatable to any plant suspension culture/protoplast system, which should enable acceleration of crop genomics research.

A high-throughput, automated, tobacco protoplast production and transformation methodology is described. The robotic system enables massively parallel gene expression and discovery in the model BY-2 system that should be translatable to non-model crops.

Over the last decade there has been a resurgence in the use of plant protoplasts that range from model species to crop species, for analysis of signal ...

Genetics

Transient Gene Expression in Tobacco using Gibson Assembly and the Gene Gun

In order to target a single protein to multiple subcellular organelles, plants typically duplicate the relevant genes, and express each gene separately using complex regulatory strategies including differential promoters and/or signal sequences. Metabolic engineers and synthetic biologists interested in targeting enzymes to a particular organelle are faced with a challenge: For a protein that is to be localized to more than one organelle, the engineer must clone the same gene multiple times. This work presents a solution to this strategy: harnessing alternative splicing of mRNA. This technology takes advantage of established chloroplast and peroxisome targeting sequences and combines them into a single mRNA that is alternatively spliced. Some splice variants are sent to the chloroplast, some to the peroxisome, and some to the cytosol. Here the system is designed for multiple-organelle targeting with alternative splicing. In this work, GFP was expected to be expressed in the chloroplast, cytosol, and peroxisome by a series of rationally designed 5&#8217; mRNA tags. These tags have the potential to reduce the amount of cloning required when heterologous genes need to be expressed in multiple subcellular organelles. The constructs were designed in previous work11, and were cloned using Gibson assembly, a ligation independent cloning method that does not require restriction enzymes. The resultant plasmids were introduced into Nicotiana benthamiana epidermal leaf cells with a modified Gene Gun protocol. Finally, transformed leaves were observed with confocal microscopy.

This work describes a novel method for selectively targeting subcellular organelles in plants, assayed using the BioRad Gene Gun.

In order to target a single protein to multiple subcellular organelles, plants typically duplicate the relevant genes, and express each gene separately ...

Environment

Lignin Down-regulation of Zea mays via dsRNAi and Klason Lignin Analysis

To facilitate the use of lignocellulosic biomass as an alternative bioenergy resource, during biological conversion processes, a pretreatment step is needed to open up the structure of the plant cell wall, increasing the accessibility of the cell wall carbohydrates. Lignin, a polyphenolic material present in many cell wall types, is known to be a significant hindrance to enzyme access. Reduction in lignin content to a level that does not interfere with the structural integrity and defense system of the plant might be a valuable step to reduce the costs of bioethanol production. In this study, we have genetically down-regulated one of the lignin biosynthesis-related genes, cinnamoyl-CoA reductase (ZmCCR1) via a double stranded RNA interference technique. The ZmCCR1_RNAi construct was integrated into the maize genome using the particle bombardment method. Transgenic maize plants grew normally as compared to the wild-type control plants without interfering with biomass growth or defense mechanisms, with the exception of displaying of brown-coloration in transgenic plants leaf mid-ribs, husks, and stems. The microscopic analyses, in conjunction with the histological assay, revealed that the leaf sclerenchyma fibers were thinned but the structure and size of other major vascular system components was not altered. The lignin content in the transgenic maize was reduced by 7-8.7%, the crystalline cellulose content was increased in response to lignin reduction, and hemicelluloses remained unchanged. The analyses may indicate that carbon flow might have been shifted from lignin biosynthesis to cellulose biosynthesis. This article delineates the procedures used to down-regulate the lignin content in maize via RNAi technology, and the cell wall compositional analyses used to verify the effect of the modifications on the cell wall structure.

Lignin Down-regulation of Zea mays via dsRNAi and Klason Lignin Analysis

A double stranded RNA interference (dsRNAi) technique is employed to down-regulate the maize cinnamoyl coenzyme A reductase (ZmCCR1) gene to lower plant lignin content. Lignin down-regulation from the cell wall is visualized by microscopic analyses and quantified by the Klason method. Compositional changes in hemicellulose and crystalline cellulose are analyzed.

To facilitate the use of lignocellulosic biomass as an alternative bioenergy resource, during biological conversion processes, a pretreatment step is ...

Bioengineering

Co-expression of Multiple Chimeric Fluorescent Fusion Proteins in an Efficient Way in Plants

Information about the spatiotemporal subcellular localization(s) of a protein is critical to understand its physiological functions in cells. Fluorescent proteins and generation of fluorescent fusion proteins have been wildly used as an effective tool to directly visualize the protein localization and dynamics in cells. It is especially useful to compare them with well-known organelle markers after co-expression with the protein of interest. Nevertheless, classical approaches for protein co-expression in plants usually involve multiple independent expression plasmids, and therefore have drawbacks that include low co-expression efficiency, expression-level variation, and high time expenditure in genetic crossing and screening. In this study, we describe a robust and novel method for co-expression of multiple chimeric fluorescent proteins in plants. It overcomes the limitations of the conventional methods by using a single expression vector that is composed of multiple semi-independent expressing cassettes. Each protein expression cassette contains its own functional protein expression elements, and therefore it can be flexibly adjusted to meet diverse expression demand. Also, it is easy and convenient to perform the assembly and manipulation of DNA fragments in the expression plasmid by using an optimized one-step reaction without additional digestion and ligation steps. Furthermore, it is fully compatible with current fluorescent protein derived bio-imaging technologies and applications, such as FRET and BiFC. As a validation of the method, we employed this new system to co-express fluorescently fused vacuolar sorting receptor and secretory carrier membrane proteins. The results show that their perspective subcellular localizations are the same as in previous studies by both transient expression and genetic transformation in plants.

We have developed a novel method for co-expressing multiple chimeric fluorescent fusion proteins in plants to overcome the difficulties of conventional methods. It takes advantage of using a single expression plasmid that contains multiple functionally independent protein expressing cassettes to achieve protein co-expression.

Information about the spatiotemporal subcellular localization(s) of a protein is critical to understand its physiological functions in cells. Fluorescent ...

Chemistry

In Situ Hybridization for the Precise Localization of Transcripts in Plants

With the advances in genomics research of the past decade, plant biology has seen numerous studies presenting large-scale quantitative analyses of gene expression. Microarray and next generation sequencing approaches are being used to investigate developmental, physiological and stress response processes, dissect epigenetic and small RNA pathways, and build large gene regulatory networks1-3. While these techniques facilitate the simultaneous analysis of large gene sets, they typically provide a very limited spatiotemporal resolution of gene expression changes. This limitation can be partially overcome by using either profiling method in conjunction with lasermicrodissection or fluorescence-activated cell sorting4-7. However, to fully understand the biological role of a gene, knowledge of its spatiotemporal pattern of expression at a cellular resolution is essential. Particularly, when studying development or the effects of environmental stimuli and mutants can the detailed analysis of a gene's expression pattern become essential. For instance, subtle quantitative differences in the expression levels of key regulatory genes can lead to dramatic phenotypes when associated with the loss or gain of expression in specific cell types. 
Several methods are routinely used for the detailed examination of gene expression patterns. One is through analysis of transgenic reporter lines. Such analysis can, however, become time-consuming when analyzing multiple genes or working in plants recalcitrant to transformation. Moreover, an independent validation to ensure that the transgene expression pattern mimics that of the endogenous gene is typically required. Immunohistochemical protein localization or mRNA in situ hybridization present relatively fast alternatives for the direct visualization of gene expression within cells and tissues. The latter has the distinct advantage that it can be readily used on any gene of interest. In situ hybridization allows detection of target mRNAs in cells by hybridization with a labeled anti-sense RNA probe obtained by in vitro transcription of the gene of interest. 
Here we outline a protocol for the in situ localization of gene expression in plants that is highly sensitivity and specific. It is optimized for use with paraformaldehyde fixed, paraffin-embedded sections, which give excellent preservation of histology, and DIG-labeled probes that are visualized by immuno-detection and alkaline-phosphatase colorimetric reaction. This protocol has been successfully applied to a number of tissues from a wide range of plant species, and can be used to analyze expression of mRNAs as well as small RNAs8-14.

In Situ Hybridization for the Precise Localization of Transcripts in Plants

The in situ hybridization protocol described here allows a direct localization of mRNA and small RNA expression at the cellular level with high sensitivity and specificity. The procedure is optimized for paraffin-embedded plant tissue sections, is applicable to a wide range of plants and tissues, and can be completed within ten days.

With the advances in genomics research of the past decade, plant biology has seen numerous studies presenting large-scale quantitative analyses of gene ...

CRISPR-Based Efficient Genome Editing for Resistant Starch in Rice Breeding

Breeding by Design for Functional Rice with Genome Editing Technologies

The conventional approaches to crop breeding, which rely predominantly on time-consuming and labor-intensive methods such as traditional hybridization and mutation breeding, face challenges in efficiently introducing targeted traits and generating diverse plant populations. Conversely, the emergence of genome editing technologies has ushered in a paradigm shift, enabling the precise and expedited manipulation of plant genomes to intentionally introduce desired characteristics. One of the most widespread editing tools is the CRISPR/Cas system, which has been used by researchers to study important biology-related problems. However, the precise and effective workflow of genome editing has not been well-defined in crop breeding. In this study, we demonstrated the entire process of breeding rice varieties enriched with high levels of resistant starch (RS), a functional trait that plays a crucial role in preventing diseases such as diabetes and obesity. The workflow encompassed several key steps, such as the selection of functional SBEIIb gene, designing the single-guide RNA (sgRNA), selecting an appropriate genome editing vector, determining the vector delivery method, conducting plant tissue culture, genotyping mutation and phenotypic analysis. Additionally, the time frame necessary for each stage of the process has been clearly demonstrated. This protocol not only streamlines the breeding process but also enhances the accuracy and efficiency of trait introduction, thereby accelerating the development of functional rice varieties.

Author Spotlight: Streamlining Rice Breeding with CRISPR/Cas for Obtaining Optimal Phenotypic and Agronomic Traits 

The protocol describes breeding resistant starch rice varieties by design using genome editing technologies in a precise, efficient, and technically simple way.

The conventional approaches to crop breeding, which rely predominantly on time-consuming and labor-intensive methods such as traditional hybridization and ...

A Comparative Analysis of Recombinant Protein Expression in Different Biofactories: Bacteria, Insect Cells and Plant Systems

Plant-based systems are considered a valuable platform for the production of recombinant proteins as a result of their well-documented potential for the flexible, low-cost production of high-quality, bioactive products.
In this study, we compared the expression of a target human recombinant protein in traditional fermenter-based cell cultures (bacterial and insect) with plant-based expression systems, both transient and stable.
For each platform, we described the set-up, optimization and length of the production process, the final product quality and the yields and we evaluated provisional production costs, specific for the selected target recombinant protein.
Overall, our results indicate that bacteria are unsuitable for the production of the target protein due to its accumulation within insoluble inclusion bodies. On the other hand, plant-based systems are versatile platforms that allow the production of the selected protein at lower-costs than Baculovirus/insect cell system. In particular, stable transgenic lines displayed the highest-yield of the final product and transient expressing plants the fastest process development. However, not all recombinant proteins may benefit from plant-based systems but the best production platform should be determined empirically with a case-by-case approach, as described here.

In this study the expression of a target human recombinant protein in different production platforms was compared. We focused on traditional fermenter-based cultures and on plants, describing the set-up of each system and highlighting, on the basis of the reported results, the inherent limits and advantages for each platform.

Plant-based systems are considered a valuable platform for the production of recombinant proteins as a result of their well-documented potential for the ...

Laser-Capture Microdissection RNA-Sequencing for Spatial and Temporal Tissue-Specific Gene Expression Analysis in Plants

The development of a complex multicellular organism is governed by distinct cell types that have different transcriptional profiles. To identify transcriptional regulatory networks that govern developmental processes it is necessary to measure the spatial and temporal gene expression profiles of these individual cell types. Therefore, insight into the spatio-temporal control of gene expression is essential to gain understanding of how biological and developmental processes are regulated. Here, we describe a laser-capture microdissection (LCM) method to isolate small number of cells from three barley embryo organs over a time-course during germination followed by transcript profiling. The method consists of tissue fixation, tissue processing, paraffin embedding, sectioning, LCM and RNA extraction followed by real-time PCR or RNA-seq. This method has enabled us to obtain spatial and temporal profiles of seed organ transcriptomes from varying numbers of cells (tens to hundreds), providing much greater tissue-specificity than typical bulk-tissue analyses. From these data we were able to define and compare transcriptional regulatory networks as well as predict candidate regulatory transcription factors for individual tissues. The method should be applicable to other plant tissues with minimal optimization.

Presented here is a protocol for laser-capture microdissection (LCM) of plant tissues. LCM is a microscopic technique for isolating areas of tissue in a contamination-free manner. The procedure includes tissue fixation, paraffin embedding, sectioning, LCM and RNA extraction. RNA is used in the downstream tissue-specific, temporally resolved analysis of transcriptomes.

The development of a complex multicellular organism is governed by distinct cell types that have different transcriptional profiles. To identify ...

Agrobacterium-Mediated Genetic Transformation, Transgenic Production, and Its Application for the Study of Male Reproductive Development in Rice

Male sterility is an important agronomic trait for hybrid seed production that is usually characterized by functional defects in male reproductive organs/gametes. Recent advances in CRISPR-Cas9 genome editing technology allow for high editing efficacy and timesaving knockout mutations of endogenous candidate genes at specific sites. Additionally, Agrobacterium-mediated genetic transformation of rice is also a key method for gene modification, which has been widely adopted by many public and private laboratories. In this study, we applied CRISPR-Cas9 genome editing tools and successfully generated three male sterile mutant lines by targeted genome editing of OsABCG15 in a japonica cultivar. We used a modified Agrobacterium-mediated rice transformation method that could provide excellent means of genetic emasculation for hybrid seed production in rice. Transgenic plants can be obtained within 2&#8211;3 months and homozygous transformants were screened by genotyping using PCR amplification and Sanger sequencing. Basic phenotypic characterization of the male sterile homozygous line was performed by microscopic observation of the rice male reproductive organs, pollen viability analysis by iodine potassium iodide (I2-KI) staining semi-thin cross-sectioning of developing anthers.

Agrobacterium-Mediated Genetic Transformation, Transgenic Production, and Its Application for the Study of Male Reproductive Development in Rice

This work describes the use of CRISPR-Cas9 genome editing technology to knockout endogenous gene OsABCG15 followed by a modified Agrobacterium-mediated transformation protocol to produce a stable male-sterile line in rice.

Male sterility is an important agronomic trait for hybrid seed production that is usually characterized by functional defects in male reproductive ...

Direct Agroinoculation of Maize Seedlings by Injection with Recombinant Foxtail Mosaic Virus and Sugarcane Mosaic Virus Infectious Clones

Agrobacterium-based inoculation approaches are widely used for introducing viral vectors into plant tissues. This study details a protocol for the injection of maize seedlings near meristematic tissue with Agrobacterium carrying a viral vector. Recombinant foxtail mosaic virus (FoMV) clones engineered for gene silencing and gene expression were used to optimize this method, and its use was expanded to include a recombinant sugarcane mosaic virus (SCMV) engineered for gene expression. Gene fragments or coding sequences of interest are inserted into a modified, infectious viral genome that has been cloned into the binary T-DNA plasmid vector pCAMBIA1380. The resulting plasmid constructs are transformed into Agrobacterium tumefaciens strain GV3101. Maize seedlings as young as 4 days old can be injected near the coleoptilar node with bacteria resuspended in MgSO4 solution. During infection with Agrobacterium, the T-DNA carrying the viral genome is transferred to maize cells, allowing for the transcription of the viral RNA genome. As the recombinant virus replicates and systemically spreads throughout the plant, viral symptoms and phenotypic changes resulting from the silencing of the target genes lesion mimic 22 (les22)&#160;or&#160;phytoene desaturase (pds) can be observed on the leaves, or expression of green fluorescent protein (GFP) can be detected upon illumination with UV light or fluorescence microscopy. To detect the virus and assess the integrity of the insert simultaneously, RNA is extracted from the leaves of the injected plant and RT-PCR is conducted using primers flanking the multiple cloning site (MCS) carrying the inserted sequence. This protocol has been used effectively in several maize genotypes and can readily be expanded to other viral vectors, thereby offering an accessible tool for viral vector introduction in maize.

An Agrobacterium-based injection (agroinjection) protocol is presented for the inoculation of foxtail mosaic virus&#160;and sugarcane mosaic virusclones into maize seedlings. Inoculation in this manner leads to viral infection, virus-induced gene silencing of marker genes, and viral overexpression of GFP.

In Planta Gene Expression and Gene Editing in Moso Bamboo Leaves

Summary

Explore More Videos

Chapters in this video

A Robotic Platform for High-throughput Protoplast Isolation and Transformation

Transient Gene Expression in Tobacco using Gibson Assembly and the Gene Gun

Lignin Down-regulation of Zea mays via dsRNAi and Klason Lignin Analysis

Co-expression of Multiple Chimeric Fluorescent Fusion Proteins in an Efficient Way in Plants

In Situ Hybridization for the Precise Localization of Transcripts in Plants

Breeding by Design for Functional Rice with Genome Editing Technologies

A Comparative Analysis of Recombinant Protein Expression in Different Biofactories: Bacteria, Insect Cells and Plant Systems

Laser-Capture Microdissection RNA-Sequencing for Spatial and Temporal Tissue-Specific Gene Expression Analysis in Plants

Agrobacterium-Mediated Genetic Transformation, Transgenic Production, and Its Application for the Study of Male Reproductive Development in Rice

Direct Agroinoculation of Maize Seedlings by Injection with Recombinant Foxtail Mosaic Virus and Sugarcane Mosaic Virus Infectious Clones