Name: agrobacterium-mediated genetic transformation, transgenic production, and its application for the study of male reproductive development in rice
Uploaded: 2020-10-06T14:00:00
Description: Watch this Scientific Journal Video about Agrobacterium-Mediated Genetic Transformation, Transgenic Production, and Its Application for the Study of Male Reproductive Development in Rice at JoVE.com

The authors would like to acknowledge Xiaofei Chen for providing the young rice inflorescences and assistance in making the rice tissue culture medium. This work was supported by the National Natural Science Foundation of China (31900611).

1. sgRNA-CAS9 plant expression vector construction and Agrobacterium-mediated transformation
<ol>
	<li>Target a male sterile gene OsABCG15 in rice according to the published literature28.</li>
	<li>Design sgRNA for the targeted site located between 106&#8211;125 bp in the second exon of OsABCG15 (Figure 1).</li>
	<li>Use T4 polynucleotide kinase to synthesize the sgRNA oligos (sgR-OsABCG15-F: 5&#8217;TGGCAAGCACATCCTCAAGGGGAT3&#8217; and 5&...

<ol>
	<li>Izawa, T., Shimamoto, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Becoming+a+model+plant:+The+importance+of+rice+to+plant+science.">Becoming a model plant: The importance of rice to plant science.</a> Trends in Plant Science. 1 (3), 95-99 (1996).</li><li>Shimamoto, K., Kyozuka, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rice+as+a+model+for+comparative+genomics+of+plants.">Rice as a model for comparative genomics of plants.</a> Annual Review of Plant Biology. 53 (1), 399-419 (2002).</li><li>Selva, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hybrid+breeding+in+wheat:+how+shaping+floral+biology+can+offer+new+perspectives.">Hybrid breeding in wheat: how shaping floral biology can offer new perspectives.</a> Functional Plant Biology. 47 (8), 675-694 (2020).</li><li>Lippman, Z. B., Zamir, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterosis:+revisiting+the+magic.">Heterosis: revisiting the magic.</a> Trends in Genetics. 23 (2), 60-66 (2007).</li><li>Zhang, D., Liang, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+food+security:+using+male+fertility+for+hybrid+seed+breeding.">Improving food security: using male fertility for hybrid seed breeding.</a> Science. , 45-48 (2016).</li><li>Masters, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-Mediated+Immature+Embryo+Transformation+of+Recalcitrant+Maize+Inbred+Lines+Using+Morphogenic+Genes.">Agrobacterium-Mediated Immature Embryo Transformation of Recalcitrant Maize Inbred Lines Using Morphogenic Genes.</a> Journal of Visualized Experiments. (156), e60782 (2020).</li><li>Laurenceau, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+type+IV+pilus+mediates+DNA+binding+during+natural+transformation+in+Streptococcus+pneumoniae.">A type IV pilus mediates DNA binding during natural transformation in Streptococcus pneumoniae.</a> PLoS Pathogens. 9 (6), 1003473 (2013).</li><li>Tzfira, T., Citovsky, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-mediated+genetic+transformation+of+plants:+biology+and+biotechnology.">Agrobacterium-mediated genetic transformation of plants: biology and biotechnology.</a> Current Opinion in Biotechnology. 17 (2), 147-154 (2006).</li><li>Gelvin, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium+in+the+genomics+age.">Agrobacterium in the genomics age.</a> Plant Physiology. 150 (4), 1665-1676 (2009).</li><li>Lacroix, B., Citovsky, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+roles+of+bacterial+and+host+plant+factors+in+Agrobacterium-mediated+genetic+transformation.">The roles of bacterial and host plant factors in Agrobacterium-mediated genetic transformation.</a> International Journal of Developmental Biology. 57, 467-481 (2013).</li><li>Hiei, Y., Komari, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-mediated+transformation+of+rice+using+immature+embryos+or+calli+induced+from+mature+seed.">Agrobacterium-mediated transformation of rice using immature embryos or calli induced from mature seed.</a> Nature Protocols. 3 (5), 824 (2008).</li><li>Hiei, Y., Ohta, S., Komari, T., Kumashiro, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transformation+of+rice+(Oryza+sativa+L.)+mediated+by+Agrobacterium+and+sequence+analysis+of+the+boundaries+of+the+T-DNA.">Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA.</a> The Plant Journal. 6 (2), 271-282 (1994).</li><li>Hiei, Y., Komari, T., Kubo, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+rice+mediated+by+Agrobacterium+tumefaciens.">Transformation of rice mediated by Agrobacterium tumefaciens.</a> Plant Molecular Biology. 35 (1-2), 205-218 (1997).</li><li>Nishimura, A., Aichi, I., Matsuoka, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+protocol+for+Agrobacterium-mediated+transformation+in+rice.">A protocol for Agrobacterium-mediated transformation in rice.</a> Nature Protocols. 1 (6), 2796 (2006).</li><li>Yara, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+transgenic+japonica+rice+(Oryza+sativa)+cultivar,+Taichung+65,+by+the+Agrobacterium-mediated+method.">Production of transgenic japonica rice (Oryza sativa) cultivar, Taichung 65, by the Agrobacterium-mediated method.</a> Plant Biotechnology. 18 (4), 305-310 (2001).</li><li>Cho, S. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transformation+of+Korean+rice+cultivars+(Oryza+sativa+L.)+mediated+by+Agrobacterium+tumefaciens.">Efficient transformation of Korean rice cultivars (Oryza sativa L.) mediated by Agrobacterium tumefaciens.</a> Journal of Plant Biology. 41 (4), 262-268 (1998).</li><li>Toki, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+and+efficient+Agrobacterium-mediated+transformation+in+rice.">Rapid and efficient Agrobacterium-mediated transformation in rice.</a> Plant Molecular Biology Reporter. 15, 16-21 (1997).</li><li>Zhang, J., Xu, R. j., Elliott, M. C., Chen, D. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-mediated+transformation+of+elite+indica+and+japonica+rice+cultivars.">Agrobacterium-mediated transformation of elite indica and japonica rice cultivars.</a> Molecular Biotechnology. 8 (3), 223-231 (1997).</li><li>Aldemita, R. R., Hodges, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium+tumefaciens-mediated+transformation+of+japonica+and+indica+rice+varieties.">Agrobacterium tumefaciens-mediated transformation of japonica and indica rice varieties.</a> Planta. 199 (4), 612-617 (1996).</li><li>Rashid, H., Yokoi, S., Toriyama, K., Hinata, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenic+plant+production+mediated+by+Agrobacterium+in+indica+rice.">Transgenic plant production mediated by Agrobacterium in indica rice.</a> Plant Cell Reports. 15 (10), 727-730 (1996).</li><li>Sahoo, K. K., Tripathi, A. K., Pareek, A., Sopory, S. K., Singla-Pareek, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+protocol+for+efficient+transformation+and+regeneration+of+diverse+indica+rice+cultivars.">An improved protocol for efficient transformation and regeneration of diverse indica rice cultivars.</a> Plant Methods. 7 (1), 49 (2011).</li><li>Rachmawati, D., Hosaka, T., Inoue, E., Anzai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-mediated+transformation+of+Javanica+rice+cv.+Rojolele.">Agrobacterium-mediated transformation of Javanica rice cv. Rojolele.</a> Bioscience, Biotechnology, and Biochemistry. 68 (6), 1193-1200 (2004).</li><li>Dong, J., Teng, W., Buchholz, W. G., Hall, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-mediated+transformation+of+Javanica+rice.">Agrobacterium-mediated transformation of Javanica rice.</a> Molecular Breeding. 2 (3), 267-276 (1996).</li><li>Bortesi, L., Fischer, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CRISPR/Cas9+system+for+plant+genome+editing+and+beyond.">The CRISPR/Cas9 system for plant genome editing and beyond.</a> Biotechnology Advances. 33 (1), 41-52 (2015).</li><li>Li, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+japonica+photo-sensitive+genic+male+sterile+rice+lines+by+editing+carbon+starved+anther+using+CRISPR/Cas9.">Development of japonica photo-sensitive genic male sterile rice lines by editing carbon starved anther using CRISPR/Cas9.</a> Journal of Genetics and Genomics. 43 (6), 415 (2016).</li><li>Qin, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ABCG15+encodes+an+ABC+transporter+protein,+and+is+essential+for+Post-Meiotic+anther+and+pollen+exine+development+in+rice.">ABCG15 encodes an ABC transporter protein, and is essential for Post-Meiotic anther and pollen exine development in rice.</a> Plant and Cell Physiology. 54, (2013).</li><li>Mao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+the+CRISPR-Cas+system+for+efficient+genome+engineering+in+plants.">Application of the CRISPR-Cas system for efficient genome engineering in plants.</a> Molecular Plant. 6 (6), 2008-2011 (2013).</li><li>Itoh, J. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rice+plant+development:+from+zygote+to+spikelet.">Rice plant development: from zygote to spikelet.</a> Plant and Cell Physiology. 46 (1), 23-47 (2005).</li><li>Gawel, N. J., Jarret, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+modified+CTAB+DNA+extraction+procedure+forMusa+andIpomoea.">A modified CTAB DNA extraction procedure forMusa andIpomoea.</a> Plant Molecular Biology Reporter. 9 (3), 262-266 (1991).</li><li>Wei, F. J., Droc, G., Guiderdoni, E., Hsing, Y. i. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=International+Consortium+of+Rice+Mutagenesis:+resources+and+beyond.">International Consortium of Rice Mutagenesis: resources and beyond.</a> Rice. 6 (1), 39 (2013).</li><li>Feng, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+genome+editing+in+plants+using+a+CRISPR/Cas+system.">Efficient genome editing in plants using a CRISPR/Cas system.</a> Cell Research. 23 (10), 1229 (2013).</li></ol>

Artificial genic male sterile mutants are traditionally generated by random physical, chemical, or biological mutagenesis. Although these are powerful techniques, their random nature fails to capitalize on the vast amount of modern genomic knowledge that has the potential to deliver tailored improvements in molecular breeding32. The CRISPR-Cas9 system has been widely used in plants due to its simple and affordable means to manipulate and edit DNA29,<sup class="xr...

Rice is the most important food crop, particularly in developing countries, and represents a staple food for over half of the world&#8217;s population. Overall, the demand for rice grain is growing and is projected to increase 50% by 2030 and 100% by 20501,2. Future improvements in rice yield will need to capitalize on diverse molecular and genetic resources that make rice an excellent model for monocotyledonous plant research. These include an efficient transformation system, advanced molecular map, and publicly accessible database of expressed sequence tags, which have been generated over many years3,4. One strategy to improve crop yield is hybrid seed production5, a central element of which is the ability to manipulate male fertility. Understanding the molecular control of male fertility in cereal crops can help to translate key knowledge into practical techniques to improve hybrid seed production and enhance crop productivity6,7.
Genetic transformation is a key tool for basic research and commercial agriculture since it enables introduction of foreign genes or manipulation of endogenous genes in crop plants, and results in the generation of genetically modified lines. An appropriate transformation protocol can help to accelerate genetic and molecular biology studies for fundamental understanding of gene regulation8. In bacteria, genetic transformation takes place naturally; however, in plants, it is performed artificially using molecular biology techniques9,10. Agrobacterium tumefaciens is a soil-borne, Gram-negative bacterium that causes crown gall disease in plants by transferring T-DNA, a region of its Ti plasmid, into the plant cell via a type IV secretion system11,12. In plants, A. tumefaciens-mediated transformation is considered a widespread method for gene modification because it leads to stable and low copy number integration of T-DNA into the host genome13. Transgenic rice was first generated through Agrobacterium-mediated gene transformation in the mid-1990s in the japonica cultivar14. Using this protocol, several transgenic lines were obtained within a period of 4 months with a transformation efficiency of 10%&#8211;30%. The study indicated that there are two critical steps for the successful transformation: one is the induction of embryogenic callus from mature seeds and another is the addition of acetosyringone, a phenolic compound, to the bacterial culture during co-cultivation, which allows for higher transformation efficiency in plants14,15. This protocol has been extensively used with minor alterations in japonica16,17,18,19 as well as other cultivars such as indica20,21,22,23 and tropical japonica24,25. Indeed, over 80% of the articles describing rice transformation use Agrobacterium-mediated gene transformation as a tool13. To date, several genetic transformation protocols have been developed using rice seed as a starting material for callus induction16,17,18,19. However, very little is known about young inflorescence as explants for callus production. Overall, it is important to establish a rapid, reproducible, and efficient gene transformation and regeneration protocol for functional genomics and studies on crop improvement.
In recent years, the advancement of CRISPR-Cas9 technology has resulted in a precise genome editing mechanism to understand gene function and deliver agronomically important improvements for plant breeding26,27. CRISPR also offers considerable promise for the manipulation of male reproductive development and hybrid production. In this study, we utilized a gene knockout system using CRISPR-Cas9 technology and coupled it to an efficient rice gene transformation protocol using young inflorescences as explants, thereby creating stable male sterile lines for the study of reproductive development.

<table>
	<tbody>
		<tr>
			<td>1-Naphthaleneacetic acid</td>
			<td>Sigma-Aldrich</td>
			<td>N0640</td>
			<td></td>
		</tr>
		<tr>
			<td>2&#65292;4-Dichlorophenoxyacetic Acid</td>
			<td>Sigma-Aldrich</td>
			<td>D7299</td>
			<td></td>
		</tr>
		<tr>
			<td>6-Benzylaminopurine (6-BA)</td>
			<td>Sigma-Aldrich</td>
			<td>B3408</td>
			<td></td>
		</tr>
		<tr>
			<td>Acetosyringone</td>
			<td>Sigma-Aldrich</td>
			<td>D134406</td>
			<td></td>
		</tr>
		<tr>
			<td>Agar</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10000561</td>
			<td></td>
		</tr>
		<tr>
			<td>Ammonium sulfate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10002918</td>
			<td></td>
		</tr>
		<tr>
			<td>Aneurine hydrochloride</td>
			<td>Sigma-Aldrich</td>
			<td>T4625</td>
			<td></td>
		</tr>
		<tr>
			<td>Anhydrous ethanol</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10009218</td>
			<td></td>
		</tr>
		<tr>
			<td>Bacteriological peptone</td>
			<td>Sangon Biotech</td>
			<td>A100636</td>
			<td></td>
		</tr>
		<tr>
			<td>Beef extract</td>
			<td>Sangon Biotech</td>
			<td>A600114</td>
			<td></td>
		</tr>
		<tr>
			<td>Boric acid</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10004808</td>
			<td></td>
		</tr>
		<tr>
			<td>Calcium chloride dihydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>20011160</td>
			<td></td>
		</tr>
		<tr>
			<td>Casein acid hydrolysate</td>
			<td>Beijing XMJ Scientific Co., Ltd</td>
			<td>C184</td>
			<td></td>
		</tr>
		<tr>
			<td>Cobalt(&#8545;) chloride hexahydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10007216</td>
			<td></td>
		</tr>
		<tr>
			<td>Copper(&#8545;) sulfate pentahydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10008218</td>
			<td></td>
		</tr>
		<tr>
			<td>D(+)-Glucose anhydrous</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>63005518</td>
			<td></td>
		</tr>
		<tr>
			<td>D-sorbitol</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>63011037</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA, Disodium Salt, Dihydrate</td>
			<td>Sigma-Aldrich</td>
			<td>E5134</td>
			<td></td>
		</tr>
		<tr>
			<td>EOS Digital SLR and Compact System Cameras</td>
			<td>Canon</td>
			<td>EOS 700D</td>
			<td></td>
		</tr>
		<tr>
			<td>Formaldehyde</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10010018</td>
			<td></td>
		</tr>
		<tr>
			<td>Fully Automated Rotary Microtome</td>
			<td>Leica Biosystems</td>
			<td>Leica RM 2265</td>
			<td></td>
		</tr>
		<tr>
			<td>Glacial acetic acid</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10000208</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycine</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>62011516</td>
			<td></td>
		</tr>
		<tr>
			<td>Hygromycin</td>
			<td>Beijing XMJ Scientific Co., Ltd</td>
			<td>H370</td>
			<td></td>
		</tr>
		<tr>
			<td>Inositol</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>63007738</td>
			<td></td>
		</tr>
		<tr>
			<td>Iodine</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10011517</td>
			<td></td>
		</tr>
		<tr>
			<td>Iron(&#8545;) sulfate heptahydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10012116</td>
			<td></td>
		</tr>
		<tr>
			<td>Kanamycine</td>
			<td>Beijing XMJ Scientific Co., Ltd</td>
			<td>K378</td>
			<td></td>
		</tr>
		<tr>
			<td>Kinetin</td>
			<td>Sigma-Aldrich</td>
			<td>K0753</td>
			<td></td>
		</tr>
		<tr>
			<td>L-Arginine</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>62004034</td>
			<td></td>
		</tr>
		<tr>
			<td>L-Aspartic acid</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>62004736</td>
			<td></td>
		</tr>
		<tr>
			<td>L-Glutamine</td>
			<td>Beijing XMJ Scientific Co., Ltd</td>
			<td>G229</td>
			<td></td>
		</tr>
		<tr>
			<td>L-proline</td>
			<td>Beijing XMJ Scientific Co., Ltd</td>
			<td>P698</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnesium sulfate heptahydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10013018</td>
			<td></td>
		</tr>
		<tr>
			<td>Manganese sulfate monohydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10013418</td>
			<td></td>
		</tr>
		<tr>
			<td>Microscopes</td>
			<td>NIKON</td>
			<td>Eclipse 80i</td>
			<td></td>
		</tr>
		<tr>
			<td>MS</td>
			<td>Phytotech</td>
			<td>M519</td>
			<td></td>
		</tr>
		<tr>
			<td>Nicotinic acid</td>
			<td>Sigma-Aldrich</td>
			<td>N0765</td>
			<td></td>
		</tr>
		<tr>
			<td>Phytagel</td>
			<td>Sigma-Aldrich</td>
			<td>P8169</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium chloride</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10016308</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium dihydrogen phosphate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10017608</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium iodide</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10017160</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium nitrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>1001721933</td>
			<td></td>
		</tr>
		<tr>
			<td>Pyridoxine Hydrochloride (B6)</td>
			<td>Sigma-Aldrich</td>
			<td>47862</td>
			<td></td>
		</tr>
		<tr>
			<td>Rifampicin</td>
			<td>Beijing XMJ Scientific Co., Ltd</td>
			<td>R501</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium hydroxide</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10019718</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium molybdate dihydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10019816</td>
			<td></td>
		</tr>
		<tr>
			<td>Stereo microscopes</td>
			<td>Leica Microsystems</td>
			<td>Leica M205 A</td>
			<td></td>
		</tr>
		<tr>
			<td>Sucrose</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10021418</td>
			<td></td>
		</tr>
		<tr>
			<td>Technovit embedding Kits 7100</td>
			<td>Heraeus Teknovi, Germany</td>
			<td>14653</td>
			<td></td>
		</tr>
		<tr>
			<td>Timentin</td>
			<td>Beijing XMJ Scientific Co., Ltd</td>
			<td>T869</td>
			<td></td>
		</tr>
		<tr>
			<td>Toluidine Blue O</td>
			<td>Sigma-Aldrich</td>
			<td>T3260</td>
			<td></td>
		</tr>
		<tr>
			<td>Water bath for paraffin sections</td>
			<td>Leica Biosystems</td>
			<td>Leica HI1210</td>
			<td></td>
		</tr>
		<tr>
			<td>Yeast extract</td>
			<td>Sangon Biotech</td>
			<td>A515245</td>
			<td></td>
		</tr>
		<tr>
			<td>Zinc sulfate heptahydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10024018</td>
			<td></td>
		</tr>
	</tbody>
</table>

agrobacterium-mediated genetic transformation, transgenic production, and its application for the study of male reproductive development in rice

Male sterility is an important agronomic trait for hybrid seed production that is usually characterized by functional defects in male reproductive organs/gametes. Recent advances in CRISPR-Cas9 genome editing technology allow for high editing efficacy and timesaving knockout mutations of endogenous candidate genes at specific sites. Additionally, Agrobacterium-mediated genetic transformation of rice is also a key method for gene modification, which has been widely adopted by many public and private laboratories. In this study, we applied CRISPR-Cas9 genome editing tools and successfully generated three male sterile mutant lines by targeted genome editing of OsABCG15 in a japonica cultivar. We used a modified Agrobacterium-mediated rice transformation method that could provide excellent means of genetic emasculation for hybrid seed production in rice. Transgenic plants can be obtained within 2&#8211;3 months and homozygous transformants were screened by genotyping using PCR amplification and Sanger sequencing. Basic phenotypic characterization of the male sterile homozygous line was performed by microscopic observation of the rice male reproductive organs, pollen viability analysis by iodine potassium iodide (I2-KI) staining semi-thin cross-sectioning of developing anthers.

Demonstrated here is the use of gene editing technology to create a male sterile line for future research by Agrobacterium-mediated genetic transformation in rice. To create the male sterile line of osabcg15, CRISPR-CAS9-mediated mutagenesis was used for binary vector construction. The sgRNA was driven by the OsU3 promoter, whereas the expression cassette of hSpCas9 was driven by the double 35S promoter, and the middle vector was assembled in a single binary vector pCAMBIA1300 designed for ...

Watch this Scientific Journal Video about Agrobacterium-Mediated Genetic Transformation, Transgenic Production, and Its Application for the Study of Male Reproductive Development in Rice at JoVE.com

Agrobacterium-Mediated Genetic Transformation, Transgenic Production, and Its Application for the Study of Male Reproductive Development in Rice

This work describes the use of CRISPR-Cas9 genome editing technology to knockout endogenous gene OsABCG15 followed by a modified Agrobacterium-mediated transformation protocol to produce a stable male-sterile line in rice.

Agrobacterium-Mediated Genetic Transformation, Transgenic Production, and Its Application for the Study of Male Reproductive Development in Rice

Male sterility is an important agronomic trait for hybrid seed production that is usually characterized by functional defects in male reproductive ...

Research

JoVE Journal

Biology

Testing Visual Sensitivity to the Speed and Direction of Motion in Lizards

Testing visual sensitivity in any species provides basic information regarding behaviour, evolution, and ecology. However, testing specific features of ...

The Ladder Rung Walking Task: A Scoring System and its Practical Application.

Progress in the development of animal models for/stroke, spinal cord injury, and other neurodegenerative disease requires tests of high sensitivity to ...

Lens Transplantation in Zebrafish and its Application in the Analysis of Eye Mutants

The lens plays an important role in the development of the optic cup[1,2]. Using the zebrafish as a model organism, questions regarding lens development ...

Generation of Transgenic C. elegans by Biolistic Transformation

Generation of Transgenic C. elegans by Biolistic Transformation

The number of laboratories using the free living nematode C. elegans is rapidly growing. The popularity of this biological model is attributed to a rapid ...

Agrobacterium-Mediated Virus-Induced Gene Silencing Assay In Cotton

Cotton (Gossypium hirsutum) is one of the most important crops worldwide. Considerable efforts have been made on molecular breeding of new varieties.  The ...

Optimization and Utilization of Agrobacterium-mediated Transient Protein Production in Nicotiana

Optimization and Utilization of Agrobacterium-mediated Transient Protein Production in Nicotiana

Agrobacterium-mediated transient protein production in plants is a promising approach to produce vaccine antigens and therapeutic proteins within a short ...

Transgenic Rodent Assay for Quantifying Male Germ Cell Mutant Frequency

De novo mutations arise mostly in the male germline and may contribute to adverse health outcomes in subsequent generations. Traditional methods for ...

A Multi-hole Cryovial Eliminates Freezing Artifacts when Muscle Tissues are Directly Immersed in Liquid Nitrogen

Studies on skeletal muscle physiology face the technical challenge of appropriately processing the specimens to obtain sections with clearly visible ...

Agrobacterium-Mediated Immature Embryo Transformation of Recalcitrant Maize Inbred Lines Using Morphogenic Genes

Agrobacterium-Mediated Immature Embryo Transformation of Recalcitrant Maize Inbred Lines Using Morphogenic Genes

Demonstrated here is a detailed protocol for Agrobacterium-mediated genetic transformation of maize inbred lines using morphogenic genes Baby boom (Bbm) ...

Real-Time Detection of Reactive Oxygen Species Production in Immune Response in Rice with a Chemiluminescence Assay

Reactive oxygen species (ROS) play vital roles in a variety of biological processes, including the sensing of abiotic and biotic stresses. Upon pathogen ...