Name: dissecting innate immune signaling in viral evasion of cytokine production
Uploaded: 2014-03-02T14:00:00
Description: Watch this Scientific Journal Video about Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production at JoVE.com

Wild-type (Mavs+/+) and knockout (Mavs&#8722;/&#8722;) mice, Wild-type (Mavs+/+) and knockout (Mavs&#8722;/&#8722;) MEFs were kindly provided by Dr. Zhijian J. Chen (University of Texas Southwestern Medical Center)13. This publication is based on work funded by grants from NIH (R01 CA134241 and R01 DE021445) and American Cancer Society (RSG-11-162-01-MPC).

Ethics Statement: All animal work was performed under strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Southern California.
1.&#160;Cytokine Gene Expression by Quantitative Real-time PCR and Secretion by ELISA&#160;in &#947;HV68-infected Mice
<ol>
	<li>Anesthetize gender-matched, 6-8&...

<ol>
	<li>Akira, S., Uematsu, S., Takeuchi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogen+recognition+and+innate+immunity.">Pathogen recognition and innate immunity.</a> Cell. 124, 783-801 (2006).</li><li>Kato, H., Takahasi, K., Fujita, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIG-I-like+receptors:+cytoplasmic+sensors+for+non-self+RNA.">RIG-I-like receptors: cytoplasmic sensors for non-self RNA.</a> Immunol. Rev. 243, 91-98 (2011).</li><li>Kawai, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IPS-1,+an+adaptor+triggering+RIG-I-+and+Mda5-mediated+type+I+interferon+induction.">IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction.</a> Nat. Immunol. 6, 981-988 (2005).</li><li>Seth, R. B., Sun, L., Ea, C. K., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+MAVS,+a+mitochondrial+antiviral+signaling+protein+that+activates+NF-kappaB+and+IRF+3.">Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3.</a> Cell. 122, 669-682 (2005).</li><li>Xu, L. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=VISA+is+an+adapter+protein+required+for+virus-triggered+IFN-beta+signaling.">VISA is an adapter protein required for virus-triggered IFN-beta signaling.</a> Mol. Cell. 19, 727-740 (2005).</li><li>Meylan, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardif+is+an+adaptor+protein+in+the+RIG-I+antiviral+pathway+and+is+targeted+by+hepatitis+C+virus.">Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus.</a> Nature. 437, 1167-1172 (2005).</li><li>Speck, S. H., Virgin, H. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host+and+viral+genetics+of+chronic+infection:+a+mouse+model+of+gamma-herpesvirus+pathogenesis.">Host and viral genetics of chronic infection: a mouse model of gamma-herpesvirus pathogenesis.</a> Curr. Opin. Microbiol. 2, 403-409 (1999).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma-herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+initiate+lytic+replication.">Murine gamma-herpesvirus 68 hijacks MAVS and IKKbeta to initiate lytic replication.</a> PLoS Pathog. , (2010).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma+herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+abrogate+NFkappaB+activation+and+antiviral+cytokine+production.">Murine gamma herpesvirus 68 hijacks MAVS and IKKbeta to abrogate NFkappaB activation and antiviral cytokine production.</a> PLoS Pathog. 7, (2011).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gammaherpesvirus+68+evades+host+cytokine+production+via+replication+transactivator-induced+RelA+degradation.">Murine gammaherpesvirus 68 evades host cytokine production via replication transactivator-induced RelA degradation.</a> J. Virol. 86, 1930-1941 (2012).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissecting+Host-virus+Interaction+in+Lytic+Replication+of+a+Model+Herpesvirus.">Dissecting Host-virus Interaction in Lytic Replication of a Model Herpesvirus.</a> J. Vis. Exp. , (2011).</li><li>He, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Receptor+interacting+protein+kinase-3+determines+cellular+necrotic+response+to+TNF-alpha.">Receptor interacting protein kinase-3 determines cellular necrotic response to TNF-alpha.</a> Cell. 137, 1100-1111 (2009).</li><li>Sun, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+specific+and+essential+role+of+MAVS+in+antiviral+innate+immune+responses.">The specific and essential role of MAVS in antiviral innate immune responses.</a> Immunity. 24, 633-642 (2006).</li></ol>

Viral immune evasion is one of the most dynamic and fascinating interactions interfacing viral offense and host defense9. The host innate immune components are structured such that signal transduction is effectively initiated and faithfully transmitted. Delineating the hierarchy and regulation of signaling cascades is a preeminent topic of innate immunity. Here, we introduce a protocol to identify the regulatory roles of an innate immune component, MAVS, in viral evasion of cytokine production. The protocol co...

Recent studies have outlined the overall signaling cascades in mounting host innate immune responses. Residing within distinct compartments, pattern recognition receptors (PRRs) detect pathogen-associated molecular patterns (PAMPs) of diverse origin to trigger innate immune signaling1.&#160;The retinoic acid-induced gene I (RIG-I) and melanoma differentiation antigen 5 (MDA5) proteins are cytosolic sensors that recognize RNA species with specific structural features2. Upon activation, RIG-I interacts with its downstream MAVS (also known as IPS-1, VISA, and CARDIF) adaptor that, in turn, activates the IKK (IKK&#945;&#946;&#947;) and IKK-related kinase (TBK1 and IKK&#949;, also known as IKKi) complexes3-6. Activated innate immune kinases phosphorylate key regulators of gene expression, including transcription factors and inhibitors thereof, and enable transcriptional activation of host antiviral genes (e.g.&#160;IL6, TNF&#945;, CCL5, and IFN&#946;). These signaling cascades constitute potent intrinsic innate immune responses that establish an anti-microbial state to restrict pathogen propagation during early stages of infection.
Murine &#947;HV68 is closely related to human oncogenic KSHV and EBV. Thus, &#947;HV68 infection of mice provides a tractable small animal model to examine the host immune response to gamma herpes virus infection&#160;in vivo7. Using &#947;HV68, our lab has uncovered an intricate strategy whereby &#947;HV68 hijacks host innate immune signaling to enable viral infection. On one hand, &#947;HV68 activates the MAVS-IKK&#946; pathway to promote viral transcriptional activation via directing activated IKK&#946; to phosphorylate replication transactivator (RTA), the viral transcription factor key for &#947;HV68 replication8. On the other hand, the IKK&#946;-mediated phosphorylation primes RelA for degradation and terminates NF&#922;B activation9. As such, &#947;HV68 infection effectively avoids antiviral cytokine production. Interestingly, a screening utilizing an expression library of &#947;HV68 identified RTA as an E3 ligase to induce RelA degradation and abrogate NF&#922;B activation10. These findings uncover an intricate immune evasion strategy whereby the upstream immune signaling events are harnessed by &#947;HV68 to negate the ultimate antiviral cytokine production.
Here we describe a protocol to measure the antiviral cytokine production in mice infected with &#947;HV68 both in vivo and ex vivo. In the protocol we further explore the &#34;reconstituted&#34; expression of innate immune components in the knockout embryonic fibroblasts by lentiviral transduction, which pinpoints the function of the specific innate immune molecules in regulating the antiviral cytokine production. This protocol can be easily adapted to other viruses and signaling pathways.

<table border="0" cellpadding="0" cellspacing="0" width="684">
	<colgroup>
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">Mouse CCL5 ELISA kit</td>
			<td style="width:211px;">R&#38;D systems</td>
			<td style="width:223px;"><a href="http://www.rndsystems.com/Products/DY478">DY478</a></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">1.0 mm Zirconia/Silica beads</td>
			<td style="width:211px;">BioSpec Products</td>
			<td style="width:223px;">11079110z</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">TRIzol</td>
			<td style="width:211px;">Invitrogen</td>
			<td style="width:223px;"><a href="http://products.invitrogen.com/ivgn/en/US/adirect/invitrogen?cmd=catProductDetail&amp;productID=15596018">15596-018</a></td>
		</tr>
		<tr height="79">
			<td height="98" rowspan="2" style="height:98px;width:251px;">SuperScript II Reverse Transcriptase</td>
			<td rowspan="2" style="width:211px;">Invitrogen</td>
			<td rowspan="2" style="width:223px;">18064-014</td>
		</tr>
		<tr height="19">
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"> </td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">CCL5 quantitative real-time PCR primers</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">CCTGCTGCTTTGCCTACCTCTC</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">ACACACTTGGCGGTTCCTTCGA</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

dissecting innate immune signaling in viral evasion of cytokine production

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. Conversely, viruses have evolved intricate strategies to evade and exploit host immune signaling for survival and propagation. Viral immune evasion, entailing host defense and viral evasion, provides one of the most fascinating and dynamic interfaces to discern the host-virus interaction. These studies advance our understanding in innate immune regulation and pave our way to develop novel antiviral therapies.
Murine &#947;HV68 is a natural pathogen of murine rodents. &#947;HV68 infection of mice provides a tractable small animal model to examine the antiviral response to human KSHV and EBV of which perturbation of in vivo virus-host interactions is not applicable. Here we describe a protocol to determine the antiviral cytokine production. This protocol can be adapted to other viruses and signaling pathways.
Recently, we have discovered that &#947;HV68 hijacks MAVS and IKK&#946;, key innate immune signaling components downstream of the cytosolic RIG-I and MDA5, to abrogate NF&#922;B activation and antiviral cytokine production. Specifically, &#947;HV68 infection activates IKK&#946; and that activated IKK&#946; phosphorylates RelA to accelerate RelA degradation. As such, &#947;HV68 efficiently uncouples NF&#922;B activation from its upstream activated IKK&#946;, negating antiviral cytokine gene expression. This study elucidates an intricate strategy whereby the upstream innate immune activation is intercepted by a viral pathogen to nullify the immediate downstream transcriptional activation and evade antiviral cytokine production.

Three representative figures are shown here, including cytokine production in the lung of &#947;HV68-infected Mavs+/+ and Mavs-/- mouse, cytokine secretion and gene expression level of &#947;HV68-infected Mavs+/+ and Mavs-/- MEFs, and cytokine mRNA levels of &#947;HV68-infected Mavs-/- MEFs &#34;reconstituted&#34; with MAVS. These representative experiments utilize gene knockout mice to investigate antiviral cytokine produ...

Watch this Scientific Journal Video about Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production at JoVE.com

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

We describe a protocol to measure the antiviral cytokine production in mice infected with a model herpesvirus, murine gamma herpesvirus 68 (&#947;HV68) that is closely-related to human Kaposi&#8217;s sarcoma-associated herpesvirus (KSHV) and Epstein-Barr virus (EBV). Utilizing genetically modified mouse strains and mouse embryonic fibroblasts (MEFs), we assessed the antiviral cytokine production both in vivo and ex vivo. &#8220;Reconstituting&#8221; the expression of innate immune components in knockout embryonic fibroblasts by lentiviral transduction, we further pinpoint specific innate immune molecules and dissect the key signaling events that differentially regulate the antiviral cytokine production.

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

Research

JoVE Journal

Immunology and Infection

Production and Titering of Recombinant Adeno-associated Viral Vectors

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently ...

Quantification of the Respiratory Burst Response as an Indicator of Innate Immune Health in Zebrafish

The phagocyte respiratory burst is part of the innate immune response to  pathogen infection and involves the production of reactive oxygen species (ROS). ...

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

Macrophages are key phagocytic innate immune cells.  When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the ...

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

The aquatic pathogen, Streptococcus iniae, is responsible for over 100 million dollars in annual losses for the aquaculture industry and is capable of ...

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic Poly(I:C)

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric ...

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification (BiCAP)

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification BiCAP

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research ...

Single-cell Analysis of Immunophenotype and Cytokine Production in Peripheral Whole Blood via Mass Cytometry

Cytokines play a pivotal role in the pathogenesis of autoimmune diseases. Hence, the measurement of cytokine levels has been the focus of multiple studies ...

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence ...

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

The investigation of the immunogenic potential of commensal bacteria on the host immune system is one essential component when studying intestinal ...

Isolation of Tonsillar Mononuclear Cells to Study Ex Vivo Innate Immune Responses in a Human Mucosal Lymphoid Tissue

Studying isolated cells from mucosa-associated lymphoid tissues (MALT) allows understanding of immune cells response in pathologies involving mucosal ...