Thanks to Michaela Hall, Larissa Bispo and Gustavo Tavares for Technical Assistance.

Foodstuffs that are eaten raw or lightly cooked are of most concern for human health. Examples include salad vegetables, fruit, shellfish and crustaceans.
1. Sample Collection
<ol>
	<li>Collect samples under conditions that minimize contamination, and stored in separate, clean bags during transport. Once collected, samples should be stored at 4 &#176;C and processed within 24 hr.</li>
</ol>
2. Enriched Culture Preparation
<ol>
	<li>Fruits and vegetables:
	<ol>
		<li>Place approximately 10 g of material in a durable plastic bag. If processing larger material, concentrate on the skin of the fruit or vegetable. Add 90 ml 0.1 M sodium phosphate buffer, pH 7.0 and process in a paddle blender for 30 sec. Alternatively, the material can be manually agitated if a paddle blender is not available.</li>
		<li>Collect the liquid into two 50 ml Falcon tubes. Centrifuge tubes at 4,000 x g for 7 min to pellet bacteria.</li>
		<li>Carefully remove the supernatant and suspend the pelleted bacteria in 30 ml of sterile Luria Bertani (LB) broth.</li>
		<li>Incubate on a shaker O/N, holding one tube at 25 &#176;C and the other at 37 &#176;C. Cultures should be shaken at 200 oscillations per minute (opm). Store cultures at 4 &#176;C until required.</li>
	</ol>
	</li>
	<li>Seafood:
	<ol>
		<li>Dissect out the stomach (oysters) or digestive tract (prawns) using sterile forceps and tweezers and place into a sterile 1.5 ml tube containing 200 &#181;l of 0.1 M sodium phosphate buffer, pH 7.0. Macerate the sample to create a homogenate.</li>
		<li>Dispense 5 ml of LB broth into two sterile 5 ml tubes, and inoculate each with the seafood homogenate.</li>
		<li>Incubate on a shaker O/N, holding one tube at 25 &#176;C and the other 37 &#176;C. Cultures should be shaken at 200 opm. Store cultures at 4 &#176;C until required.</li>
	</ol>
	</li>
</ol>
3. Screening Cultures for Integrons
NOTE: Standard PCR protocols are used throughout this methodology, using buffers supplied with the enzyme, and a final MgCl2 concentration of 2.5 mM. If required, Lorenz (2011)24 has outlined PCR optimization and troubleshooting methods in an earlier issue of this journal.
<ol>
	<li>Boiled DNA preparation:
	<ol>
		<li>Dispense 100 &#181;l of enriched culture into a sterile 0.5 ml PCR tube. Heat the sample to 99 &#176;C for 10 min, using a water bath or heat block. Snap chill on ice for 2 min.</li>
		<li>Microcentrifuge at 14,000 x g for 5 min to pellet cell debris. Return to ice. DNA samples can be frozen at -20 &#176;C until required, but must be thawed on ice.</li>
	</ol>
	</li>
	<li>Screening for class 1 integrons using PCR: 
	NOTE: Mixed cultures from the O/N incubation are screened for class 1 integrons using the HS463a/HS464 PCR protocol (Table 1).
	<ol>
		<li>Thaw all PCR reagents on ice, away from any potential sources of contaminating DNA. Make up 48 &#181;l PCR mastermix per sample, including negative controls (Table 2). Dispense 48 &#181;l of PCR master mix to each tube, using barrier tips.</li>
		<li>Add 2 &#181;l of thawed DNA to individual PCR tubes using barrier tips. Run appropriate program in the PCR thermocycler.</li>
		<li>To assess the results of the amplification, electrophorese 7 &#181;l of PCR product on a 2% agarose gel poured and run in TBE buffer (90 mM TRIS-borate, 2 mM EDTA). Include a molecular weight marker, such as a 100 bp ladder.</li>
		<li>Post stain the gel with a DNA stain, and visualize using a UV transilluminator. Check that there has been no amplification in the negative control. A strong band at around 470 bp for any particular sample indicates that the mixed culture contains bacteria that carry a class 1 integron. Pure colonies will now be isolated from any mixed culture that returned a positive PCR.</li>
	</ol>
	</li>
</ol>
4. Screening of Single Colonies for Class 1 Integrons
<ol>
	<li>Serial dilutions and spread plates: 
	NOTE: To isolate single colonies from the PCR-positive mixed cultures, the mixed culture is serially diluted 10-fold in sodium phosphate buffer, and then plated to recover single colonies.
	<ol>
		<li>Add 1 ml of mixed culture to 9 ml of 0.1 M sodium phosphate buffer, pH 7.0 and mix by inversion. Add 1 ml of the dilution to a further 9 ml of phosphate buffer, and repeat until a serial dilution of 10-8 is reached.</li>
		<li>Spread 100 &#181;l of the 10-4 to 10-8 dilutions onto LB agar, in duplicate. Incubate the plates O/N at the same temperature used for the initial mixed culture. Plates can then be stored at 4 &#176;C until required, however it is best to process the single colonies fairly promptly.</li>
	</ol>
	</li>
	<li>Single colony selection and boiled DNA preparation:
	<ol>
		<li>Pick single colonies from the serial dilution plates, selecting as many different colony types as possible, using criteria such as colony size, shape and color. Use sterile toothpicks to select single colonies from the spread plate.</li>
		<li>Touch the toothpick to the colony, and then transfer into a PCR tube containing 100 &#181;l of sterile water. If large numbers of colonies are to be screened, then colonies can be prepared in a microtiter tray. Spin the toothpick between the fingers to dislodge some of the cells into the water.</li>
		<li>Using the same toothpick, inoculate an LB plate with a streak of the colony. Large numbers of colonies can be stored on labelled plates if each streak is about 1 cm long.&#160;Repeat steps 1 to 3 until you have selected an appropriate number of isolates.</li>
		<li>Incubate the LB plates O/N, at the same temperature as that used for the initial enriched culture. Cultures can then be stored at 4 &#176;C until required.</li>
		<li>For preparing DNA from the bacterial suspensions, follow the steps as outlined in section 3.1. For screening of pure culture lysates, perform the HS463a/HS464 PCR as outlined in section 3.2. Isolates that return a positive PCR will be used for preparation of genomic DNA (section 5), and for further analyses.</li>
	</ol>
	</li>
</ol>
5. Genomic DNA Extraction of Integron-positive Single Colonies Using Bead Beating25
<ol>
	<li>Inoculate 5 ml of LB broth with a sample of the pure culture isolated in section 4.2. Incubate O/N, shaking at the same temperature that was used for the initial enriched culture.</li>
	<li>Pellet cells at 4,000 x g for 7 min, then remove the supernatant. Resuspend the pelleted cells in 1 ml CLS-TC solution in a Lysing Matrix E fast prep tube. Using a bead beating machine, process the sample at 5.5 m/sec for 30 sec.</li>
	<li>Centrifuge tube at 14,000 x g for 5 min and recover 700 &#181;l of supernatant into a sterile 1.5 ml tube.</li>
	<li>Add 700 &#181;l of binding matrix diluted 1:5 with 6 M guanidinium thiocyanate and mix at RT for 5 min. Centrifuge at 14,000 x g for 1 min, discard supernatant.</li>
	<li>Add 800 &#181;l salt ethanol wash (70% ethanol, 0.1 M sodium acetate) and vortex until the pellet is fully resuspended. Wash for 5 min at RT, centrifuge at 14,000 x g for 1 min and discard supernatant. Ensure all supernatant has been removed, using a micropipette if necessary, then allow to air dry for 5 min.</li>
	<li>Resuspend the pellet matrix in 200 &#181;l TE (10 mM Tris-HCl, 1mM EDTA, pH 7.6) by pipetting up and down. Incubate at RT for 3 min. Centrifuge at 14,000 x g for 3 min and transfer 160 &#181;l of the eluted DNA into a sterile tube. Run an aliquot of the genomic DNA extraction on a 2% w/v agarose gel to check the yield and integrity of the DNA extraction. The purified genomic DNA is stored at -20 &#176;C and defrosted on ice when required for PCR testing.</li>
</ol>
6. Diagnostic PCRs and DNA Sequencing
NOTE: The genomic DNA prepared in section 5 will be used for all diagnostic PCRs, and to confirm the positive test for class 1 integrons.
<ol>
	<li>Thaw genomic DNA on ice, briefly vortex the DNA sample and pulse spin at 14,000 x g for 20 sec. Repeat the PCR for the class 1 integron-integrase gene using HS463a/HS464 (Table 1), confirming that the isolate is positive for the 471 bp amplicon (Section 3.2).</li>
	<li>Identification of positive cultures to species level is achieved by analysis of the small subunit rRNA gene (16S rDNA). Amplify the 16S gene using primers f27/r1492 (Table 1). Check the PCR products using electrophoresis. All bacterial targets should generate a 16S amplicon of about 1450 bp.</li>
	<li>Sequence the 16S rRNA gene amplicon to determine species identity, but since there are likely to be multiple positive PCRs from step 6.2, and many of these positives will be the same bacterial species, we will first distinguish different species using restriction digestion of the 16S PCR product.
	<ol>
		<li>Digest an aliquot of the 16S PCR with the restriction enzyme Hinf1. Any enzyme that recognizes 4 bp cleavage sites will do, but Hinf1 generates good diversity from 16S targets, and is a reliable, inexpensive enzyme.</li>
	</ol>
	</li>
	<li>Set up a 30 &#181;l restriction digest mastermix (Table 2) in a sterile tube and add 20 &#181;l of un-purfied 16S PCR product. Incubate in a 37 &#176;C water bath O/N. Check the digest on a 2% agarose gel.</li>
	<li>Score the digestion patterns produced by Hinf1. Isolates with the same 16S restriction profile are likely to be the same species. Rather than sequencing every 16S PCR product, sequence at most three representatives of each Hinf1 restriction pattern.</li>
	<li>Purify the 16S PCR products using a commercial kit. A single stranded exonuclease kit can be used, but column based or precipitation methods also work well to remove unincorporated primers and single stranded DNAs. Sequence the 16S amplicons using primer r910 (Table 1), setting up the reactions as specified by the sequencing facility.</li>
	<li>Use the resulting DNA sequence to interrogate the NCBI DNA database with the blastn function (<a href="http://blast.ncbi.nlm.nih.gov/Blast.cgi" target="_blank">http://blast.ncbi.nlm.nih.gov/Blast.cgi</a>). Greater than 97% nucleotide identity is usually taken as species identity.</li>
</ol>
7. Mapping and Characterization of Integrons and Cassette Arrays
NOTE: Class 1 integrons emanating from human-dominated ecosystems are likely to be the most common integrons in all your samples. These integrons all have a recent single origin, and therefore have a highly conserved DNA sequence5.
<ol>
	<li>Differentiate between a class 1 integrons emanating from human sources and those that occur naturally in environmental samples by performing a PCR with primer set intI1F165/intI1R47610 (Table 1). 
	NOTE: Class 1 integrons from clinical or commensal bacteria will generate a ~300 bp product, while environmental class 1 integrons will not generate any product.</li>
	<li>Characterize the clinical integrons by amplifying the cassette array with primer set HS458/HS459. This PCR will amplify the region between intI1 and the 3&#8217; conserved segment at the terminus of most cassette arrays. Because the number and identity of cassettes is variable, the size of the PCR product will also vary.</li>
	<li>Purify amplicons and sequence the DNA using each of the amplification primers. Use sequences to interrogate DNA databases using the blastn function (<a href="http://blast.ncbi.nlm.nih.gov/Blast.cgi" target="_blank">http://blast.ncbi.nlm.nih.gov/Blast.cgi</a>).</li>
	<li>Ensure naming of cassettes follow standardized nomenclature9, since many data depositions for integron gene cassettes use inconsistent or ambiguous names. Give particular attention to novel gene cassettes, since these may encode new phenotypes, including genes that confer increased transmissibility, pathogenicity or virulence8,21. 
	NOTE: Preclinical forms of the class 1 integron still circulate in natural environments. In particular, those that are linked to active Tn402 transposons are of most interest26. The cassette arrays of these integrons will not amplify with primer set HS458/HS459, but can be amplified with the MRG284/MRG285 primer set (Table 1), generating amplicons of variable size dependent on cassette content. PCR products should be purified and DNA sequenced as outlined in 7.2.</li>
</ol>

<ol>
	<li>Bush, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tackling+antibiotic+resistance.">Tackling antibiotic resistance.</a> Nature Rev. Microbiol. 9, 894-896 (2011).</li><li>Davies, J., Davies, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Origins+and+evolution+of+antibiotic+resistance.">Origins and evolution of antibiotic resistance.</a> Microbiol. Mol. Biol. Rev. 74 (3), 417-433 (2010).</li><li>Costa, V. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibiotic+resistance+is+ancient.">Antibiotic resistance is ancient.</a> Nature. 477 (7365), 457-461 (2011).</li><li>Gillings, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+consequences+of+antibiotic+use+for+the+resistome,+mobilome+and+microbial+pangenome.">Evolutionary consequences of antibiotic use for the resistome, mobilome and microbial pangenome.</a> Front. Microbiol. 4, 4 (2013).</li><li>Gillings, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+evolution+of+class+1+integrons+and+the+rise+of+antibiotic+resistance.">The evolution of class 1 integrons and the rise of antibiotic resistance.</a> J. Bacteriol. 190 (14), 5095-5100 (2008).</li><li>Brassard, S., Lapointe, J., Roy, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diversity+and+relative+strength+of+tandem+promoters+for+the+antibiotic-resistance+genes+of+several+integrons.">Diversity and relative strength of tandem promoters for the antibiotic-resistance genes of several integrons.</a> Gene. 142 (1), 49-54 (1994).</li><li>Partridge, S. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Definition+of+the+attI1+site+of+class+1+integrons.">Definition of the attI1 site of class 1 integrons.</a> Microbiol. 146 (11), 2855-2864 (2000).</li><li>Gillings, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrons:+Past,+Present,+and+Future.">Integrons: Past, Present, and Future.</a> Microbiol. Mol. Biol. Rev. 78 (2), 257-277 (2014).</li><li>Partridge, S. R., Tsafnat, G., Coiera, E., Iredell, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+cassettes+and+cassette+arrays+in+mobile+resistance+integrons.">Gene cassettes and cassette arrays in mobile resistance integrons.</a> FEMS Microbiol. Rev. 33 (4), 757-784 (2009).</li><li>Gillings, M. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+the+class+1+integron-integrase+gene+as+a+proxy+for+anthropogenic+pollution.">Using the class 1 integron-integrase gene as a proxy for anthropogenic pollution.</a> ISME J. In press, (2014).</li><li>Gaze, W. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impacts+of+anthropogenic+activity+on+the+ecology+of+class+1+integrons+and+integron-associated+genes+in+the+environment.">Impacts of anthropogenic activity on the ecology of class 1 integrons and integron-associated genes in the environment.</a> ISME J. 5, 1253-1261 (2011).</li><li>Gerzova, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+microbiota+composition+and+presence+of+selected+antibiotic+resistance+genes+in+carriage+water+of+ornamental+fish.">Characterization of microbiota composition and presence of selected antibiotic resistance genes in carriage water of ornamental fish.</a> PLoS ONE. 9, e103865 (2014).</li><li>Power, M., Emery, S., Gillings, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Into+the+wild:+dissemination+of+antibiotic+resistance+determinants+via+a+species+recovery+program.">Into the wild: dissemination of antibiotic resistance determinants via a species recovery program.</a> PLoS ONE. 8, e63017 (2013).</li><li>Stokes, H. W., Gillings, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+flow,+mobile+genetic+elements+and+the+recruitment+of+antibiotic+resistance+genes+into+Gram-negative+pathogens.">Gene flow, mobile genetic elements and the recruitment of antibiotic resistance genes into Gram-negative pathogens.</a> FEMS Microbiol. Rev. 35 (5), 790-819 (2011).</li><li>Moura, A., Oliveira, C., Henriques, I., Smalla, K., Correia, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Broad+diversity+of+conjugative+plasmids+in+integron-carrying+bacteria+from+wastewater+environments.">Broad diversity of conjugative plasmids in integron-carrying bacteria from wastewater environments.</a> FEMS Microbiol. Lett. 330 (2), 157-164 (2012).</li><li>Schl&#252;ter, A., Krause, L., Szczepanowski, R., Goesmann, A., P&#252;hler, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+diversity+and+composition+of+a+plasmid+metagenome+from+a+wastewater+treatment+plant.">Genetic diversity and composition of a plasmid metagenome from a wastewater treatment plant.</a> J. Biotech. 136 (1-2), 65-76 (2008).</li><li>Taylor, N. G. H., Verner-Jeffreys, D. W., Baker-Austin, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aquatic+systems:+maintaining,+mixing+and+mobilising+antimicrobial+resistance.">Aquatic systems: maintaining, mixing and mobilising antimicrobial resistance.</a> TREE. 26 (6), 278-284 (2011).</li><li>Stalder, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+and+qualitative+impact+of+hospital+effluent+on+dissemination+of+the+integron+pool.">Quantitative and qualitative impact of hospital effluent on dissemination of the integron pool.</a> ISME J. 8, 768-777 (2014).</li><li>Allen, H. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Call+of+the+wild:+antibiotic+resistance+genes+in+natural+environments.">Call of the wild: antibiotic resistance genes in natural environments.</a> Nature Rev. Microbiol. 8, 251-259 (2010).</li><li>Wellington, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+the+natural+environment+in+the+emergence+of+antibiotic+resistance+in+Gram-negative+bacteria.">The role of the natural environment in the emergence of antibiotic resistance in Gram-negative bacteria.</a> Lancet Infect. Dis. 13 (2), 155-165 (2013).</li><li>Gillings, M. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mobilization+of+a+Tn402-like+class+1+integron+with+a+novel+cassette+array+via+flanking+miniature+inverted-repeat+transposable+element-like+structures.">Mobilization of a Tn402-like class 1 integron with a novel cassette array via flanking miniature inverted-repeat transposable element-like structures.</a> Appl. Env. Microbiol. 75 (18), 6002-6004 (2009).</li><li>Graham, D. W., Collignon, P., Davies, J., Larsson, D. J., Snape, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Underappreciated+role+of+regionally+poor+water+quality+on+globally+increasing+antibiotic+resistance.">Underappreciated role of regionally poor water quality on globally increasing antibiotic resistance.</a> Env. Sci. Technol. 48 (20), 11746-11747 (2014).</li><li>Perry, J. A., Westman, E. L., Wright, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+antibiotic+resistome:+what's+new.">The antibiotic resistome: what's new.</a> Curr. Opinion Microbiol. 21, 45-50 (2014).</li><li>Lorenz, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymerase+chain+reaction:+basic+protocol+plus+troubleshooting+and+optimization+strategies.">Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.</a> J. Vis. Exp. 63, e3998-e3998 (2011).</li><li>Gillings, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+Extraction+of+PCR-Competent+DNA+from+Recalcitrant+Environmental+Samples.">Rapid Extraction of PCR-Competent DNA from Recalcitrant Environmental Samples.</a> Env. Microbiol. 1096, 17-23 (2014).</li><li>Sajjad, A., Holley, M. P., Labbate, M., Stokes, H., Gillings, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preclinical+class+1+integron+with+a+complete+Tn402-like+transposition+module.">Preclinical class 1 integron with a complete Tn402-like transposition module.</a> Appl. Env. Microbiol. 77 (1), 335-337 (2011).</li><li>Wright, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibiotic+resistance+in+the+environment:+A+link+to+the+clinic.">Antibiotic resistance in the environment: A link to the clinic.</a> Curr. Opinion Microbiol. 13 (5), 589-594 (2010).</li><li>Stokes, H., Nesbo, C., Holley, M., Bahl, M., Gillings, M., Boucher, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Class+1+integrons+predating+the+association+with+Tn402.-like+transposition+genes+are+present+in+a+sediment+microbial+community.">Class 1 integrons predating the association with Tn402.-like transposition genes are present in a sediment microbial community.</a> Journal of Bacteriology. 188, 5722-5730 (2006).</li><li>Lane, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Nucleic Acid Techniques in Bacterial Systematics. , 115-175 (1991).</li><li>Holmes, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombination+activity+of+a+distinctive+integron-gene+cassette+system+associated+with+stutzeri.+populations+in+soil.">Recombination activity of a distinctive integron-gene cassette system associated with stutzeri. populations in soil.</a> Journal of Bacteriology. 185, 918-928 (2003).</li></ol>

The authors have nothing relevant to disclose.

The identification of integrons and their associated gene cassettes is potentially a key step in predicting the emergence of new opportunistic pathogens, tracking pathways for pathogens into the human food chain, and identifying new resistance and virulence determinants8,21,26. The aim of this paper was to describe a streamlined approach for screening samples for class 1 integrons, characterizing their cassette arrays and identifying the bacterial species in which they reside. Critical steps in the protocol involve good microbiological practice, and preventing PCR contamination that would generate false positives.
The protocol described here can be easily modified to detect other clinically relevant integrons, including the class 2 and class 3 integrons that are also found in human pathogens. It can also be modified to detect integrons in microbial communities from water, biofilms, soil or sediment. There are some limitations to this technique, which arise from a reliance on culturing of bacterial cells. Many environmental bacteria are not easily culturable, and the protocol described here would not detect these species. The range of species that are recovered could be expanded by using different bacterial media formulations and longer incubation times. Nevertheless, the majority of species of interest for human health are likely to grow under the conditions described here.
This protocol has some advantages over techniques that use plating on selective media. No assumptions need be made about the identity of resistance determinants carried by individual isolates, and new resistance genes can be recovered and characterized. In more general terms, the workflow can also be adapted to detect any element of the resistome27 or mobilome that might be of interest4. Such assays are important for understanding the dynamics of the various DNA elements involved in antibiotic resistance, and critical for conserving the dwindling armory of antimicrobial compounds.

The discovery of antibiotics was one of the greatest scientific achievements of the 20th century. However, the use and abuse of antibiotics has led to the rapid evolution of antibiotic resistant bacteria, and these now pose a serious threat to public health in the 21st century. The rise of bacterial strains resistant to most treatment options raises the possibility we are entering an era where antimicrobial drugs are no longer effective1,2.
The genetic machinery that confers antibiotic resistance is an ancient system, predating humans and antibiotic selection pressures by millions of years3. Mobile genetic elements, such as plasmids, transposons, genomic islands, integrative conjugative elements and integrons can disseminate antibiotic resistance genes (ARG) both within and between bacterial species4. Of these, integrons have played a central role in the spread of ARG, despite the fact that they rely upon plasmids and transposons for mobilization and insertion into bacterial genomes5. Integrons capture gene cassettes using an integron-integrase, and then express cassettes using an integron encoded promoter6,7 (Figure 1). Integron gene cassettes are small mobile elements consisting of single open reading frames (ORF) whose products can confer resistance to antibiotics or disinfectants8. Class 1 integrons are the integrons most commonly recovered from clinical isolates5, where they have collectively acquired over 130 different antibiotic resistance gene cassettes9.
The spread of class 1 integrons into human-associated commensal and pathogenic bacteria generates human waste streams that contain large numbers of these genetic elements10. An estimated 1019 bacteria that contain class 1 integrons are released via sewage sludge each year in the United Kingdom11. It is therefore not surprising that class 1 integrons conferring antibiotic resistances are now being detected in microbiota of wild birds, fish, and other native wildlife12-14. Releasing integrons back into the environment poses a significant public health threat, since acquisition of new gene cassettes and complex rearrangements with other mobile elements continues to occur, particularly in sewage treatment plants and other water bodies15-18. The natural environment then becomes a fertile recruiting ground for new resistance determinants and opportunistic pathogens19,20. Novel integron-containing bacteria and new ARGs can circle back into the human community through contaminated water and food21,22. Surveillance of environmental ARGs is a key strategy for understanding and managing antibiotic resistance in the future23. In particular, attention should be paid to foodstuffs that are eaten raw or lightly cooked, since these present the greatest threat for transmission of new mobile elements and pathogens.
In this protocol, a streamlined approach for detecting, identifying and characterizing class 1 integrons and their associated gene cassettes in foodstuffs are outlined (Figure 2). Using a combination of culturing and polymerase chain reaction (PCR), integrons can be rapidly detected in complex bacterial communities and individual isolates. Methods for identifying the species of bacteria and the conformation and identity of the integron-associated gene cassettes are given. The method is suitable for a broad range of plant and animal foods, and examples of typical workflows are given for each of these food types.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>GoTaq Colourless Mastermix</td>
			<td>Promega</td>
			<td>M7132</td>
			<td>Used in all PCRs</td>
		</tr>
		<tr>
			<td>RNAse (Ribonuclease A from bovine pancreas)</td>
			<td>Sigma</td>
			<td>R6513-10MG</td>
			<td>Used in all PCRs</td>
		</tr>
		<tr>
			<td>HinFI restriction enzyme</td>
			<td>Promega</td>
			<td>R6201</td>
			<td>Used to digest 16S rDNA PCR poducts. Enzyme comes with optimal buffer and BSA</td>
		</tr>
		<tr>
			<td>100 bp ladder</td>
			<td>GE Healthcare</td>
			<td>27400701</td>
			<td>Used as a size standard on all agarose gels</td>
		</tr>
		<tr>
			<td>GelRed DNA stain</td>
			<td>Biotium</td>
			<td>41003</td>
			<td>CAUTION: Personal protection must be worn when handling this material</td>
		</tr>
		<tr>
			<td>Guanidinium Thiocyanate</td>
			<td>Life Technologies</td>
			<td>AM9422</td>
			<td>CAUTION: Personal protection must be worn when handling this material</td>
		</tr>
		<tr>
			<td>CLS-TC Solution</td>
			<td>MP Biomedicals</td>
			<td>6540409</td>
			<td>Resuspension solution used at the begining of the genomic DNA extraction</td>
		</tr>
		<tr>
			<td>Lysing Matrix E FastPrep tubes</td>
			<td>MP Biomedicals</td>
			<td>116914500</td>
			<td>Tube required for mechanical disruption of bacterial cell walls. This code is used for packs of 500 tubes, smaller quantities are available.</td>
		</tr>
		<tr>
			<td>binding matrix</td>
			<td>MP Biomedicals</td>
			<td>116540408</td>
			<td>Diluted 1:5 with 6M guanidinium thiocyanate and used in the genomic DNA extraction method.</td>
		</tr>
		<tr>
			<td>Fast Prep machine</td>
			<td>MP Biomedicals</td>
			<td>Number of options available</td>
			<td>MP Biomedicals has a number of FastPrep machines available to purchase. Visit http://www.mpbio.com for more information</td>
		</tr>
	</tbody>
</table>

screening foodstuffs for class 1 integrons and gene cassettes

Antibiotic resistance is one of the greatest threats to health in the 21st century. Acquisition of resistance genes via lateral gene transfer is a major factor in the spread of diverse resistance mechanisms. Amongst the DNA elements facilitating lateral transfer, the class 1 integrons have largely been responsible for spreading antibiotic resistance determinants amongst Gram negative pathogens. In total, these integrons have acquired and disseminated over 130 different antibiotic resistance genes. With continued antibiotic use, class 1 integrons have become ubiquitous in commensals and pathogens of humans and their domesticated animals. As a consequence, they can now be found in all human waste streams, where they continue to acquire new genes, and have the potential to cycle back into humans via the food chain. This protocol details a streamlined approach for detecting class 1 integrons and their associated resistance gene cassettes in foodstuffs, using culturing and PCR. Using this protocol, researchers should be able to: collect and prepare samples to make enriched cultures and screen for class 1 integrons; isolate single bacterial colonies to identify integron-positive isolates; identify bacterial species that contain class 1 integrons; and characterize these integrons and their associated gene cassettes.

Screening of mixed cultures and bacterial isolates for intI1
Primer set HS463a/HS464 PCR can be used to detect the presence of the class 1 integron-integrase gene, intI1 (Figure 1). This primer set works well for detecting intI1 in mixed cultures, and is also used to screen bacterial colonies harvested from spread plates (Figure 2). Positive isolates should generate a single strong band at 471 bp using this primer set (Figure 3A). The majority of positive isolates will carry intI1 that has originated from humans or their agricultural and domestic animals. These isolates will also be positive in a PCR using primers F165/R476, which should generate a 311 bp amplicon (Figure 1). Environmental sources of intI1 will generally not be positive in this second assay.
Characterization of integron cassette arrays
Genomic DNA from pure isolates is used for characterization of integron cassette arrays. The cassette arrays of Tn402-associated class 1 integrons can be amplified using primers HS458/HS459. These primers respectively target the integron recombination site, and the 3&#8217; end of the cassette array, which normally terminates in the qacE&#916; sul1 gene fusion (Figure 1). The size of PCR products generated in this assay varies according to the number and identity of cassettes in the array (Figure 3B). Environmental class 1 integrons are often embedded in bacterial chromosomes, and their cassette arrays can be amplified by primers that target the proximal and most distal recombination sites (Figure 1). Primers MRG284/285 are designed to amplify this region, and again, because the cassette content varies, the size of the amplicons also varies (Figure 3C). Sequencing of HS458/459 PCR products will normally recover known antibiotic resistance determinants, while sequencing MRG284/285 PCR products will generally recover gene cassettes that encode polypeptides of unknown function.
Identifying Bacterial species
Bacteria are identified using 16S rDNA sequencing and database comparisons. Genomic DNA is used as a template for amplification of the 16S small subunit rRNA gene. Using the primers suggested, this should generate an amplicon of about 1450 bp. Because large numbers of colonies might be screened at any one time, a hierarchical screening method is employed. Amplified 16S PCR products are digested with the restriction enzyme Hinf1, and these digests are separated on agarose gels. Individual species will generate distinctive patterns after digest, such that isolates of the same species can be easily identified (Figure 3D). Sequencing the 16S rRNA gene PCR products from a maximum of three isolates representing any one restriction pattern allows efficient identification of all the likely species in a collection of integron positive isolates.
<img alt="Figure 1" src="/files/ftp_upload/52889/52889fig1highres.jpg" width="700" /> 
Figure 1. Structure of class 1 integrons. Schematic diagrams of clinical and environmental class 1 integrons, showing PCR primer binding sites referred to in the manuscript. Class 1 integrons consist of an integron-integrase gene (intI1) that catalyzes the capture and expression of gene cassettes to form a cassette array. Before the advent of antibiotic use, the majority of class 1 integrons were chromosomal, and carried gene cassettes whose functions are yet to be determined. Strong selection via antibiotic use has vastly increased the abundance of one sequence variant of class 1 integron associated with the Tn402 transposon. These &#8216;clinical&#8217; integrons have acquired arrays of cassettes that encode antibiotic resistance. It is these integrons that are currently polluting natural environments and the food production chain. <a href="https://www.jove.com/files/ftp_upload/52889/52889fig1highres.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/52889/52889fig2highres.jpg" width="700" /> 
Figure 2. Schematic flowchart for detecting class 1 integrons in foodstuffs. Samples of foodstuffs are used to inoculate media and generate a mixed bacterial culture. These mixed cultures are screened for the presence of class 1 integrons, and positive cultures used to prepare spread plates. Individual colonies from the spread plates are rescreened for integrons. Positive cultures are purified, DNA extracted and characterized for cassette content by DNA sequencing. Sequencing of the 16S rRNA gene is used for species identification. <a href="https://www.jove.com/files/ftp_upload/52889/52889fig2highres.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/52889/52889fig3highres.jpg" width="700" /> 
Figure 3. Representative electrophoretic analyses from the screening process. (A) Screening single colonies using intI1 primers HS463a/464. Positive colonies generate a strong single band at 471 bp. (B) Amplification of cassette arrays from Tn402 integrons using primers HS458/459. This PCR generates variable product sizes dependent on the identity and size of the component cassettes in the array. Identification of these cassettes requires DNA sequencing. (C) Amplification of cassette arrays from environmental class 1 integrons using primers MRG284/285. This PCR also generates variable product sizes dependent on the identity and size of the component cassettes in the array, however cassettes in environmental arrays are unlikely to encode antibiotic resistance. (D) Screening of 16S PCR products by digestion with Hinf1. Isolates with identical restriction patterns are likely to be the same species. If large numbers of a single restriction type are recovered, only a few of these need be sequenced. <a href="https://www.jove.com/files/ftp_upload/52889/52889fig3highres.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="0" cellpadding="0" cellspacing="0" fo:keep-together.within-page="always">
	<tbody>
		<tr>
			<td>PCR</td>
			<td>Gene target</td>
			<td fo:width="0.6in">Primer name</td>
			<td fo:width="0.5in">Direction</td>
			<td fo:width="2in">Sequence 5&#8217; &#8211; 3&#8217;</td>
			<td>Cycling conditions</td>
			<td>Reference</td>
		</tr>
		<tr>
			<td rowspan="2">HS463a/HS464</td>
			<td rowspan="2">Class 1 Integron</td>
			<td>HS464</td>
			<td>Forward</td>
			<td>ACATGCGTGTAAATCATCGTCG</td>
			<td rowspan="2">94 &#176;C 3 min; 35 cycles 94 &#176;C 30 sec, 60 &#176;C 30 sec, 72 &#176;C 1 min 30 sec; 72 &#176;C 5 min</td>
			<td rowspan="2">Stokes et al., 200628</td>
		</tr>
		<tr>
			<td>HS463a</td>
			<td>Reverse</td>
			<td>CTGGATTTCGATCACGGCACG</td>
		</tr>
		<tr>
			<td rowspan="2">f27/r1492</td>
			<td rowspan="2">16S rRNA</td>
			<td>f27</td>
			<td>Forward</td>
			<td>AGAGTTTGATCMTGGCTCAG</td>
			<td rowspan="2">94 &#176;C 3 min; 35 cycles 94 &#176;C 30 sec, 60 &#176;C 30 sec, 72 &#176;C 1 min 30 sec; 72 &#176;C 5 min</td>
			<td rowspan="2">Lane, 199129</td>
		</tr>
		<tr>
			<td>r1492</td>
			<td>Reverse</td>
			<td>TACGGYTACCTTGTTACGACTT</td>
		</tr>
		<tr>
			<td rowspan="2">intI1F165/IntI1R476</td>
			<td rowspan="2">Clinical class 1 integron</td>
			<td>intI1F165</td>
			<td>Forward</td>
			<td>CGAACGAGTGGCGGAGGGTG</td>
			<td rowspan="2">94 &#176;C 3 min; 35 cycles 94 &#176;C 30 sec, 55 &#176;C 30 sec, 72 &#176;C 1 min 30 sec; 72 &#176;C 5 min</td>
			<td rowspan="2">Gillings, 201410</td>
		</tr>
		<tr>
			<td>intI1R476</td>
			<td>Reverse</td>
			<td>TACCCGAGAGCTTGGCACCCA</td>
		</tr>
		<tr>
			<td rowspan="2">HS549/HS550</td>
			<td rowspan="2">3&#8217;CS Clinical Integron</td>
			<td>HS549</td>
			<td>Forward</td>
			<td>ACTAAGCTTGCCCCTTCCGC</td>
			<td rowspan="2">94 &#176;C 3 min; 35 cycles 94 &#176;C 30 sec, 65 &#176;C 30 sec, 72 &#176;C 1 min 30 sec; 72 &#176;C 5 min</td>
			<td rowspan="2">Stokes et al., 200628</td>
		</tr>
		<tr>
			<td>HS550</td>
			<td>Reverse</td>
			<td>CTAGGCATGATCTAACCCTCGG</td>
		</tr>
		<tr>
			<td rowspan="2">HS458/HS459</td>
			<td rowspan="2">Clinical cassette array</td>
			<td>HS458</td>
			<td>Forward</td>
			<td>GCAAAAAGGCAGCAATTATGAGCC</td>
			<td rowspan="2">94 &#176;C 3 min; 35 cycles 94 &#176;C 30 sec, 55 &#176;C 30 sec, 72 &#176;C 1 min 30 sec; 72 &#176;C 5 min</td>
			<td rowspan="2">Holmes et al., 200330</td>
		</tr>
		<tr>
			<td>HS459</td>
			<td>Reverse</td>
			<td>GTTTGATGTTATGGAGCAGCAACG</td>
		</tr>
		<tr>
			<td rowspan="2">MRG284/MRG285</td>
			<td rowspan="2">Environmental cassette</td>
			<td>MRG284</td>
			<td>Forward</td>
			<td>GTTACGCCGTGGGTCGATG</td>
			<td rowspan="2">94 &#176;C 3 min; 35 cycles 94 &#176;C 30 sec, 55 &#176;C 30 sec, 72 &#176;C 1 min 30 sec; 72 &#176;C 5 min</td>
			<td rowspan="2">Gillings et al., 200921</td>
		</tr>
		<tr>
			<td>MRG285</td>
			<td>Reverse</td>
			<td>CCAGAGCAGCCGTAGAGC</td>
		</tr>
	</tbody>
</table>
Table 1. Primer sequences and PCR conditions used for identifying Class 1 integrons and their associated gene cassettes.
<table border="0" cellpadding="0" cellspacing="0">
	<colgroup>
		<col span="4" />
	</colgroup>
	<tbody>
		<tr>
			<td>PCR reagents</td>
			<td>Volume (&#181;l)</td>
			<td>Restriction digest reagents</td>
			<td>Volume (&#181;l)</td>
		</tr>
		<tr>
			<td>Sterile water</td>
			<td>21.5</td>
			<td>Sterile water</td>
			<td>23</td>
		</tr>
		<tr>
			<td>10x GoTaq White</td>
			<td>25</td>
			<td>Buffer B</td>
			<td>5</td>
		</tr>
		<tr>
			<td>RNAseA [1 mg/ml]</td>
			<td>0.5</td>
			<td>Bovine Serum Albumin [1 mg/ml]</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Forward Primer [50 &#181;M]</td>
			<td>0.5</td>
			<td>HinfI [10 units/&#181;l]</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Reverse Primer [50 &#181;M]</td>
			<td>0.5</td>
			<td colspan="2"></td>
		</tr>
		<tr>
			<td>Mastermix volume</td>
			<td>48</td>
			<td>Mastermix volume</td>
			<td>30</td>
		</tr>
		<tr>
			<td>DNA template</td>
			<td>2</td>
			<td>PCR Template</td>
			<td>20</td>
		</tr>
		<tr>
			<td>Final PCR volume</td>
			<td>50</td>
			<td>Final restriction digest volume</td>
			<td>50</td>
		</tr>
	</tbody>
</table>
Table 2. PCR and restriction digest mastermix constituents.

Watch this Scientific Journal Video about Screening Foodstuffs for Class 1 Integrons and Gene Cassettes at JoVE.com

Screening Foodstuffs for Class 1 Integrons and Gene Cassettes

This protocol describes the detection of class 1 integrons and their associated gene cassettes in foodstuffs.

Antibiotic resistance is one of the greatest threats to health in the 21st century. Acquisition of resistance genes via lateral gene transfer is a major ...

screening-foodstuffs-for-class-1-integrons-and-gene-cassettes

Nanyang Technological University

Research

JoVE Journal

Environment

9.0K Views.  Macquarie University. This protocol describes the detection of class 1 integrons and their associated gene cassettes in foodstuffs. 

Video: Screening Foodstuffs for Class 1 Integrons and Gene Cassettes

Transient Gene Expression in Tobacco using Gibson Assembly and the Gene Gun

In order to target a single protein to multiple subcellular organelles, plants typically duplicate the relevant genes, and express each gene separately using complex regulatory strategies including differential promoters and/or signal sequences. Metabolic engineers and synthetic biologists interested in targeting enzymes to a particular organelle are faced with a challenge: For a protein that is to be localized to more than one organelle, the engineer must clone the same gene multiple times. This work presents a solution to this strategy: harnessing alternative splicing of mRNA. This technology takes advantage of established chloroplast and peroxisome targeting sequences and combines them into a single mRNA that is alternatively spliced. Some splice variants are sent to the chloroplast, some to the peroxisome, and some to the cytosol. Here the system is designed for multiple-organelle targeting with alternative splicing. In this work, GFP was expected to be expressed in the chloroplast, cytosol, and peroxisome by a series of rationally designed 5&#8217; mRNA tags. These tags have the potential to reduce the amount of cloning required when heterologous genes need to be expressed in multiple subcellular organelles. The constructs were designed in previous work11, and were cloned using Gibson assembly, a ligation independent cloning method that does not require restriction enzymes. The resultant plasmids were introduced into Nicotiana benthamiana epidermal leaf cells with a modified Gene Gun protocol. Finally, transformed leaves were observed with confocal microscopy.

This work describes a novel method for selectively targeting subcellular organelles in plants, assayed using the BioRad Gene Gun.

In order to target a single protein to multiple subcellular organelles, plants typically duplicate the relevant genes, and express each gene separately ...

Semi-High Throughput Screening for Potential Drought-tolerance in Lettuce (Lactuca sativa) Germplasm Collections

This protocol describes a method by which a large collection of the leafy green vegetable lettuce (Lactuca sativa L.) germplasm was screened for likely drought-tolerance traits. Fresh water availability for agricultural use is a growing concern across the United States as well as many regions of the world. Short-term drought events along with regulatory intervention in the regulation of water availability coupled with the looming threat of long-term climate shifts that may lead to reduced precipitation in many important agricultural regions has increased the need to hasten the development of crops adapted for improved water use efficiency in order to maintain or expand production in the coming years. This protocol is not meant as a step-by-step guide to identifying at either the physiological or molecular level drought-tolerance traits in lettuce, but rather is a method developed and refined through the screening of thousands of different lettuce varieties. The nature of this screen is based in part on the streamlined measurements focusing on only three water-stress indicators: leaf relative water content, wilt, and differential plant growth following drought-stress. The purpose of rapidly screening a large germplasm collection is to narrow the candidate pool to a point in which more intensive physiological, molecular, and genetic methods can be applied to identify specific drought-tolerant traits in either the lab or field. Candidates can also be directly incorporated into breeding programs as a source of drought-tolerance traits.

Semi-High Throughput Screening for Potential Drought-tolerance in Lettuce Lactuca sativa Germplasm Collections

This protocol was developed to screen a large germplasm collection of the leafy vegetable lettuce (Lactuca sativa L.) for drought-tolerance, in order to identify a small candidate pool of lettuce for use in physiological, molecular, and genetic studies to identify underlying drought-tolerance traits along with breeding programs.

This protocol describes a method by which a large collection of the leafy green vegetable lettuce (Lactuca sativa L.) germplasm was screened for likely ...

High-throughput Screening of Recalcitrance Variations in Lignocellulosic Biomass: Total Lignin, Lignin Monomers, and Enzymatic Sugar Release

The conversion of lignocellulosic biomass to fuels, chemicals, and other commodities has been explored as one possible pathway toward reductions in the use of non-renewable energy sources. In order to identify which plants, out of a diverse pool, have the desired chemical traits for downstream applications, attributes, such as cellulose and lignin content, or monomeric sugar release following an enzymatic saccharification, must be compared. The experimental and data analysis protocols of the standard methods of analysis can be time-consuming, thereby limiting the number of samples that can be measured. High-throughput (HTP) methods alleviate the shortcomings of the standard methods, and permit the rapid screening of available samples to isolate those possessing the desired traits. This study illustrates the HTP sugar release and pyrolysis-molecular beam mass spectrometry pipelines employed at the National Renewable Energy Lab. These pipelines have enabled the efficient assessment of thousands of plants while decreasing experimental time and costs through reductions in labor and consumables.

Plant cell wall structure and chemistry traits are evaluated to identify ideal feedstocks for biofuels and bio-materials. Standard methods have limitations when applied to large data sets. These high-throughput pretreatment, enzyme saccharification, and pyrolysis-molecular beam mass spectrometry methods compare large numbers of biomass samples with decreased experimental time and cost.

The conversion of lignocellulosic biomass to fuels, chemicals, and other commodities has been explored as one possible pathway toward reductions in the ...

Assaying Predatory Feeding Behaviors in Pristionchus and Other Nematodes

This protocol provides multiple methods for the analysis and quantification of predatory feeding behaviors in nematodes. Many nematode species including Pristionchus pacificus display complex behaviors, the most striking of which is the predation of other nematode larvae. However, as these behaviors are absent in the model organism Caenorhabditis elegans, they have thus far only recently been described in detail along with the development of reliable behavioral assays 1. These predatory behaviors are dependent upon phenotypically plastic but fixed mouth morphs making the correct identification and categorization of these animals essential. In P. pacificus there are two mouth types, the stenostomatous and eurystomatous morphs 2, with only the wide mouthed eurystomatous containing an extra tooth and being capable of killing other nematode larvae. Through the isolation of an abundance of size matched prey larvae and subsequent exposure to predatory nematodes, assays including both "corpse assays" and "bite assays" on correctly identified mouth morph nematodes are possible. These assays provide a means to rapidly quantify predation success rates and provide a detailed behavioral analysis of individual nematodes engaged in predatory feeding activities. In addition, with the use of a high-speed camera, visualization of changes in pharyngeal activity including tooth and pumping dynamics are also possible.

Assaying Predatory Feeding Behaviors in Pristionchus and Other Nematodes

Behavioral assays provide powerful tools for understanding neuronal function. Here we present several protocols for quantifying predatory feeding behavior found in the model nematode Pristionchus pacificus and its relatives. Additionally, we provide methods for analyzing predatory feeding adaptations including mouth structures and teeth.

This protocol provides multiple methods for the analysis and quantification of predatory feeding behaviors in nematodes. Many nematode species including ...

Screening for Endocrine Activity in Water Using Commercially-available In Vitro Transactivation Bioassays

In vitro transactivation bioassays have shown promise as water quality monitoring tools, however their adoption and widespread application has been hindered partly due to a lack of standardized methods and availability of robust, user-friendly technology. In this study, commercially available, division-arrested cell lines were employed to quantitatively screen for endocrine activity of chemicals present in water samples of interest to environmental quality professionals. A single, standardized protocol that included comprehensive quality assurance/quality control (QA/QC) checks was developed for Estrogen and Glucocorticoid Receptor activity (ER and GR, respectively) using a cell-based Fluorescence Resonance Energy Transfer (FRET) assay. Samples of treated municipal wastewater effluent and surface water from freshwater systems in California (USA), were extracted using solid phase extraction and analyzed for endocrine activity using the standardized protocol. Background and dose-response for endpoint-specific reference chemicals met QA/QC guidelines deemed necessary for reliable measurement. The bioassay screening response for surface water samples was largely not detectable. In contrast, effluent samples from secondary treatment plants had the highest measurable activity, with estimated bioassay equivalent concentrations (BEQs) up to 392 ng dexamethasone/L for GR and 17 ng 17&#946;-estradiol/L for ER. The bioassay response for a tertiary effluent sample was lower than that measured for secondary effluents, indicating a lower residual of endocrine active chemicals after advanced treatment. This protocol showed that in vitro transactivation bioassays that utilize commercially available, division-arrested cell &#34;kits&#34;, can be adapted to screen for endocrine activity in water.

Screening for Endocrine Activity in Water Using Commercially-available In Vitro Transactivation Bioassays

A protocol to screen for endocrine activity in organic extracts of water samples, including treated wastewater effluent and surface (receiving) water, was adapted using commercially available division-arrested ("freeze and thaw") in vitro transactivation bioassays.

In vitro transactivation bioassays have shown promise as water quality monitoring tools, however their adoption and widespread application has been ...

Protocol for Microplastics Sampling on the Sea Surface and Sample Analysis

Microplastic pollution in the marine environment is a scientific topic that has received increasing attention over the last decade. The majority of scientific publications address microplastic pollution of the sea surface. The protocol below describes the methodology for sampling, sample preparation, separation and chemical identification of microplastic particles. A manta net fixed on an &#187;A frame&#171; attached to the side of the vessel was used for sampling. Microplastic particles caught in the cod end of the net were separated from samples by visual identification and use of stereomicroscopes. Particles were analyzed for their size using an image analysis program and for their chemical structure using ATR-FTIR and micro FTIR spectroscopy. The described protocol is in line with recommendations for microplastics monitoring published by the Marine Strategy Framework Directive (MSFD) Technical Subgroup on Marine Litter. This written protocol with video guide will support the work of researchers that deal with microplastics monitoring all over the world.

The protocol below describes the methodology for: microplastics sampling on the sea surface, separation of microplastic and chemical identification of particles. This protocol is in line with the recommendations for microplastics monitoring published by the MSFD Technical Subgroup on Marine Litter.

Microplastic pollution in the marine environment is a scientific topic that has received increasing attention over the last decade. The majority of ...

Extraction of Organochlorine Pesticides from Plastic Pellets and Plastic Type Analysis

Plastic resin pellets, categorized as microplastics (&#8804;5 mm in diameter), are small granules that can be unintentionally released to the environment during manufacturing and transport. Because of their environmental persistence, they are widely distributed in the oceans and on beaches all over the world. They can act as a vector of potentially toxic organic compounds (e.g., polychlorinated biphenyls) and might consequently negatively affect marine organisms. Their possible impacts along the food chain are not yet well understood. In order to assess the hazards associated with the occurrence of plastic pellets in the marine environment, it is necessary to develop methodologies that allow for rapid determination of associated organic contaminant levels. The present protocol describes the different steps required for sampling resin pellets, analyzing adsorbed organochlorine pesticides (OCPs) and identifying the plastic type. The focus is on the extraction of OCPs from plastic pellets by means of a pressurized fluid extractor (PFE) and on the polymer chemical analysis applying Fourier Transform-InfraRed (FT-IR) spectroscopy. The developed methodology focuses on 11 OCPs and related compounds, including dichlorodiphenyltrichloroethane (DDT) and its two main metabolites, lindane and two production isomers, as well as the two biologically active isomers of technical endosulfan. This protocol constitutes a simple and rapid alternative to existing methodology for evaluating the concentration of organic contaminants adsorbed on plastic pieces.

Microplastics act as vector of potentially toxic organic contaminants with unpredictable effects. This protocol describes an alternative methodology for assessing the levels of organochlorine pesticides adsorbed on plastic pellets and identifying the polymer chemical structure. The focus is on pressurized fluid extraction and attenuated total reflectance Fourier transform infrared spectroscopy.

Plastic resin pellets, categorized as microplastics (&#8804;5 mm in diameter), are small granules that can be unintentionally released to the environment ...

Extraction and Characterization of Surfactants from Atmospheric Aerosols

Surface-active compounds, or surfactants, present in atmospheric aerosols are expected to play important roles in the formation of liquid water clouds in the Earth&#39;s atmosphere, a central process in meteorology, hydrology, and for the climate system. But because specific extraction and characterization of these compounds have been lacking for decades, very little is known on their identity, properties, mode of action and origins, thus preventing the full understanding of cloud formation and its potential links with the Earth&#39;s ecosystems.
In this paper we present recently developed methods for 1) the targeted extraction of all the surfactants from atmospheric aerosol samples and for the determination of 2) their absolute concentrations in the aerosol phase and 3) their static surface tension curves in water, including their Critical Micelle Concentration (CMC). These methods have been validated with 9 references surfactants, including anionic, cationic and non-ionic ones. Examples of results are presented for surfactants found in fine aerosol particles (diameter &#60;1 &#956;m) collected at a coastal site in Croatia and suggestions for future improvements and other characterizations than those presented are discussed.

Methods are presented for the targeted extraction of surfactants present in atmospheric aerosols and the determination of their absolute concentrations and surface tension curves in water, including their Critical Micelle Concentration (CMC).

Surface-active compounds, or surfactants, present in atmospheric aerosols are expected to play important roles in the formation of liquid water clouds in ...

The Barnacle Balanus improvisus as a Marine Model - Culturing and Gene Expression

Barnacles are marine crustaceans with a sessile adult and free-swimming, planktonic larvae. The barnacle Balanus (Amphibalanus) improvisus is particularly relevant as a model for the studies of osmoregulatory mechanisms because of its extreme tolerance to low salinity. It is also widely used as a model of settling biology, in particular in relation to antifouling research. However, natural seasonal spawning yields an unpredictable supply of cyprid larvae for studies. A protocol for the all-year-round culturing of B. improvisus has been developed and a detailed description of all steps in the production line is outlined (i.e., the establishment of adult cultures on panels, the collection and rearing of barnacle larvae, and the administration of feed for adults and larvae). The description also provides guidance on troubleshooting and discusses critical parameters (e.g., the removal of contamination, the production of high-quality feed, the manpower needed, and the importance of high-quality seawater). Each batch from the culturing system maximally yields roughly 12,000 nauplii and can deliver four batches in a week, so up to almost 50,000 larvae per week can be produced. The method used to culture B. improvisus is, probably, to a large extent also applicable to other marine invertebrates with free-swimminglarvae. Protocols are presented for the dissection of various tissues from adults as well as the production of high-quality RNA for studies on gene expression. It is also described how cultured adults and reared cyprids can be utilized in a wide array of experimental designs for examining gene expression in relation to external factors. The use of cultured barnacles in gene expression is illustrated with studies of possible osmoregulatory roles of Na+/K+ ATPase and aquaporins.

The Barnacle Balanus improvisus as a Marine Model - Culturing and Gene Expression

The barnacle Balanus (Amphibalanus) improvisus is a model for studying osmoregulation and antifouling. However, natural seasonal spawning yields an unpredictable supply of cyprid larvae. Here, a protocol for the all-year-round culturing of B. improvisus is described, including the production of larvae. The use of cultured barnacles in gene expression studies is illustrated.

Barnacles are marine crustaceans with a sessile adult and free-swimming, planktonic larvae. The barnacle Balanus (Amphibalanus) improvisus is particularly ...

Agrobacterium tumefaciens and Agrobacterium rhizogenes-Mediated Transformation of Potato and the Promoter Activity of a Suberin Gene by GUS Staining

Agrobacterium sp. is one of the most widely used methods to obtain transgenic plants as it has the ability to transfer and integrate its own T-DNA into the plant&#39;s genome. Here, we present two transformation systems to genetically modify potato (Solanum tuberosum) plants. In A. tumefaciens transformation, leaves are infected, the transformed cells are selected and a new complete transformed plant is regenerated using phytohormones in 18 weeks. In A. rhizogenes transformation, stems are infected by injecting the bacteria with a needle, the new emerged transformed hairy roots are detected using a red fluorescent marker and the non-transformed roots are removed. In 5-6 weeks, the resulting plant is a composite of a wild type shoot with fully developed transformed hairy roots. To increase the biomass, the transformed hairy roots can be excised and self-propagated. We applied both Agrobacterium-mediated transformation methods to obtain roots expressing the GUS reporter gene driven by a suberin biosynthetic gene promoter. The GUS staining procedure is provided and allows the cell localization of the promoter induction. In both methods, the transformed potato roots showed GUS staining in the suberized endodermis and exodermis, and additionally, in A. rhizogenes transformed roots the GUS activity was also detected in the emergence of lateral roots. These results suggest that A. rhizogenes can be a fast alternative tool to study the genes that are expressed&#160;in roots.

Agrobacterium tumefaciens and Agrobacterium rhizogenes-Mediated Transformation of Potato and the Promoter Activity of a Suberin Gene by GUS Staining

Here, we present two protocols to transform potato plants. The Agrobacterium tumefaciens transformation leads to a complete transgenic plant while the Agrobacterium rhizogenes produces transgenic hairy roots in a wild type shoot that can be self-propagated. We then detect promoter activity by GUS staining in the transformed roots.

Agrobacterium sp. is one of the most widely used methods to obtain transgenic plants as it has the ability to transfer and integrate its own T-DNA into ...