Name: circulating microrna quantification using dna-binding dye chemistry and droplet digital pcr
Uploaded: 2016-06-26T14:00:00
Description: Watch this Scientific Journal Video about Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR at JoVE.com

Supported by funding from the Italian Association for Cancer Research (AIRC) to MF (MFAG 11676) and to MN (Special Program Molecular Clinical Oncology - 5 per mille n. 9980, 2010/15) and from the Italian Ministry of Instruction, University and Research FIRB 2011 to MN (Project RBAPIIBYNP).

MicroRNA Isolation from Plasma or Serum
Note: Plasma and serum preparation is a relevant step in circulating miRNA quantification. There is no preferred procedure for plasma and serum preparation. The only important thing to consider is that all the samples from the same experiment must be processed using exactly the same workflow. Start from 200 &#181;l serum or plasma. Total RNA can be isolated from serum or plasma using commercially available kits.
1. Protocol for Total RNA (including mi...

<ol>
	<li>Arroyo, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Argonaute2+complexes+carry+a+population+of+circulating+microRNAs+independent+of+vesicles+in+human+plasma.">Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma.</a> Proc Natl Acad Sci U S A. 108, 5003-5008 (2011).</li><li>Skog, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glioblastoma+microvesicles+transport+RNA+and+proteins+that+promote+tumour+growth+and+provide+diagnostic+biomarkers.">Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers.</a> Nat Cell Biol. 10, 1470-1476 (2008).</li><li>Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D., Remaley, A. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNAs+are+transported+in+plasma+and+delivered+to+recipient+cells+by+high-density+lipoproteins.">MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins.</a> Nat Cell Biol. 13, 423-433 (2011).</li><li>Braicu, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exosomes+as+divine+messengers:+are+they+the+Hermes+of+modern+molecular+oncology.">Exosomes as divine messengers: are they the Hermes of modern molecular oncology.</a> Cell Death Differ. 22, 34-45 (2015).</li><li>Creemers, E. E., Tijsen, A. J., Pinto, Y. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+microRNAs:+novel+biomarkers+and+extracellular+communicators+in+cardiovascular+disease.">Circulating microRNAs: novel biomarkers and extracellular communicators in cardiovascular disease.</a> Circ Res. 110, 483-495 (2012).</li><li>Guay, C., Regazzi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+microRNAs+as+novel+biomarkers+for+diabetes+mellitus.">Circulating microRNAs as novel biomarkers for diabetes mellitus.</a> Nat Rev Endocrinol. 9, 513-521 (2013).</li><li>Schwarzenbach, H., Nishida, N., Calin, G. A., Pantel, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+relevance+of+circulating+cell-free+microRNAs+in+cancer.">Clinical relevance of circulating cell-free microRNAs in cancer.</a> Nat Rev Clin Oncol. 11, 145-156 (2014).</li><li>Moldovan, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methodological+challenges+in+utilizing+miRNAs+as+circulating+biomarkers.">Methodological challenges in utilizing miRNAs as circulating biomarkers.</a> J Cell Mol Med. 18, 371-390 (2014).</li><li>Tiberio, P., Callari, M., Angeloni, V., Daidone, M. G., Appierto, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Challenges+in+Using+Circulating+miRNAs+as+Cancer+Biomarkers.">Challenges in Using Circulating miRNAs as Cancer Biomarkers.</a> Biomed Res Int. 2015, 731479 (2015).</li><li>Jarry, J., Schadendorf, D., Greenwood, C., Spatz, A., van Kempen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+validity+of+circulating+microRNAs+in+oncology:+five+years+of+challenges+and+contradictions.">The validity of circulating microRNAs in oncology: five years of challenges and contradictions.</a> Mol Oncol. 8, 819-829 (2014).</li><li>Witwer, K. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+MicroRNA+Biomarker+Studies:+Pitfalls+and+Potential+Solutions.">Circulating MicroRNA Biomarker Studies: Pitfalls and Potential Solutions.</a> Clin Chem. 61, 56-63 (2015).</li><li>Miotto, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+Circulating+miRNAs+by+Droplet+Digital+PCR:+Comparison+of+EvaGreen-+and+TaqMan-Based+Chemistries.">Quantification of Circulating miRNAs by Droplet Digital PCR: Comparison of EvaGreen- and TaqMan-Based Chemistries.</a> Cancer Epidemiol Biomarkers Prev. 23, 2638-2642 (2014).</li><li>Ferracin, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+of+cell-free+microRNAs+in+cancer+patients.">Absolute quantification of cell-free microRNAs in cancer patients.</a> Oncotarget. , (2015).</li><li>Mangolini, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diagnostic+and+prognostic+microRNAs+in+the+serum+of+breast+cancer+patients+measured+by+droplet+digital+PCR.">Diagnostic and prognostic microRNAs in the serum of breast cancer patients measured by droplet digital PCR.</a> Biomarker Research. , (2015).</li><li>Hindson, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+by+droplet+digital+PCR+versus+analog+real-time+PCR.">Absolute quantification by droplet digital PCR versus analog real-time PCR.</a> Nat Methods. 10, 1003-1005 (2013).</li><li>Mestdagh, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+quantitative+miRNA+expression+platforms+in+the+microRNA+quality+control+(miRQC)+study.">Evaluation of quantitative miRNA expression platforms in the microRNA quality control (miRQC) study.</a> Nat Methods. 11, 809-815 (2014).</li></ol>

Circulating miRNAs are present in blood at extremely low concentrations and the amount of RNA that can be extracted from plasma and serum samples is low. For this reason, they are difficult to quantify with other techniques such as microarray and RNA sequencing. Moreover, there is a generalized lack of agreement on data normalization and the presence of endogenous &#34;reference&#34; miRNAs in the blood. In this context, a sensitive technology like droplet digital PCR, capable of counting the number of miRNA copies per m...

MicroRNAs (miRNAs) are released into blood circulation by potentially all the cells of the organism, as a consequence of active release or necrotic and apoptotic processes. Cell-free miRNAs have been detected in the bloodstream either as free stable molecules or linked to lipoproteins or enveloped inside exosomes and microvesicles 1-3. They are believed to function as cell-to-cell communicators 4, and their amount changes in the presence of cancer, cardiac disorders or autoimmune diseases 5-7. Their accurate and reproducible quantification is the basis for their evaluation as disease biomarkers. However, for several reasons already described elsewhere 8,9, miRNA quantification in serum or plasma, as well as other body fluids, could be very challenging 10,11. We recently developed a method for the absolute quantification of circulating miRNAs, based on miRNA-specific LNA primers and DNA-binding dye droplet digital PCR (ddPCR) technology 12. This methodology has been applied to the validation of miRNA breast cancer biomarkers 13,14. 
After the partitioning of each reverse-transcribed miRNA molecule inside a nanoliter-sized droplet, it is possible to count the copy number of each miRNA in each sample, basically counting the number of green, and therefore positive, fluorescent droplets. As soon as a PCR reaction occurs, a positive count is achieved, without the need to establish a standard curve or taking PCR efficiency into account in target amount calculation, as it happens with quantitative RT-PCR (RT-qPCR). In addition, ddPCR proved to be more sensitive and accurate than RT-qPCR in circulating miRNA quantification 15. In this article we present the detailed protocol of this methodology, discussing the most relevant steps andspecifically considering serum and plasma clinical samples.

<table >
	
		
		
		
		
	
	<tbody>
		<tr >
			<td >miRNeasy Mini Kit</td>
			<td >Qiagen</td>
			<td >217004</td>
			<td >Columns for total RNA, including miRNA, extraction from serum/plasma</td>
		</tr>
		<tr >
			<td >100 nmole RNA oligo Cel-miR-39-3p</td>
			<td >Integrated DNA Technologies</td>
			<td >Custom</td>
			<td >Sequence: UCACCGGGUGUAAAUCAGCUUG</td>
		</tr>
		<tr >
			<td >Universal cDNA synthesis kit II, 8-64 rxns</td>
			<td >Exiqon</td>
			<td >203301</td>
			<td >Kit for microRNA reverse transcription</td>
		</tr>
		<tr >
			<td >MicroRNA LNA PCR primer set&#160;</td>
			<td >Exiqon</td>
			<td >204000-206xxx and 2100000-21xxxxx</td>
			<td >Primers for miRNA amplification inside droplets</td>
		</tr>
		<tr >
			<td >QX200 droplet generator</td>
			<td >BioRad</td>
			<td >186-4002</td>
			<td >Instrument used for droplet reading</td>
		</tr>
		<tr >
			<td >QX200 droplet reader</td>
			<td >BioRad</td>
			<td >186-4003</td>
			<td >Instrument used for droplet generation</td>
		</tr>
		<tr >
			<td >QuantaSoft software</td>
			<td >BioRad</td>
			<td >186-3007</td>
			<td >Software for data collection and analysis</td>
		</tr>
		<tr >
			<td >PX1 PCR plate sealer</td>
			<td >BioRad</td>
			<td >181-4000</td>
			<td >Plate sealer</td>
		</tr>
		<tr >
			<td >DG8 droplet generator cartridges and gaskets</td>
			<td >BioRad</td>
			<td >186-4008</td>
			<td >Cartridges used to mix sample and oil to generate droplets</td>
		</tr>
		<tr >
			<td >QX200 ddPCR EvaGreen supermix</td>
			<td >BioRad</td>
			<td >186-4033/36</td>
			<td >PCR supermix</td>
		</tr>
		<tr >
			<td >QX200 droplet generator oil for EvaGreen dye</td>
			<td >BioRad</td>
			<td >186-4005</td>
			<td >Oil for droplet generation</td>
		</tr>
	</tbody>
</table>

circulating microrna quantification using dna-binding dye chemistry and droplet digital pcr

Circulating (of cell-free) microRNAs (miRNAs) are released from cells into the blood stream. The amount of specific microRNAs in the circulation has been linked to a disease state and has the potential to be used as disease biomarker. A sensitive and accurate method for circulating microRNA quantification using a dye-based chemistry and droplet digital PCR technology has been recently developed. Specifically, using Locked Nucleic Acid (LNA)-based miRNA-specific primers with a green fluorescent DNA-binding dye in a compatible droplet digital PCR system it is possible to obtain the absolute quantification of specific miRNAs. Here, we describe how performing this technique to assess miRNA amount in biological fluids, such as plasma and serum, is both feasible and effective.

The absolute amount of specific miRNAs per ml of plasma or serum can be determined using a green fluorescent DNA-binding dye and droplet digital PCR technology. Figure 1 presents the process of positive-droplets selection, which determines the final miRNA concentration (copies/&#181;l) in the amplification reaction calculated by the analysis software. The amount of each miRNA in the blood is very different, being some miRNA species more abundant than others. Using a 1:50 ...

Watch this Scientific Journal Video about Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR at JoVE.com

Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR

A sensitive and accurate method for cell-free microRNAs quantification using a dye-based chemistry and droplet digital PCR technology is described.

Circulating (of cell-free) microRNAs (miRNAs) are released from cells into the blood stream. The amount of specific microRNAs in the circulation has been ...

Research

JoVE Journal

Bioengineering

High Throughput MicroRNA Profiling: Optimized Multiplex qRT-PCR at Nanoliter Scale on the Fluidigm Dynamic ArrayTM IFCs

The broad involvement of miRNAs in critical processes underlying development, tissue homoeostasis and disease has led to a surging interest among the ...

Fluorescence detection methods for microfluidic droplet platforms

The development of microfluidic platforms for performing chemistry and biology has in large part been driven by a range of potential benefits that ...

Detection and Isolation of Circulating Melanoma Cells using Photoacoustic Flowmetry

Circulating tumor cells (CTCs) are those cells that have separated from a macroscopic tumor and spread through the blood and lymph systems to seed ...

Diagnosis of Neoplasia in Barrett&#8217;s Esophagus using Vital-dye Enhanced Fluorescence Imaging

Diagnosis of Neoplasia in BarrettÃƒÂ¢Ã¢â€šÂ¬Ã¢â€žÂ¢s Esophagus using Vital-dye Enhanced Fluorescence Imaging

The ability to differentiate benign metaplasia in Barrett&#8217;s Esophagus (BE) from neoplasia in vivo remains difficult as both tissue types can be flat ...

Quantification and Size-profiling of Extracellular Vesicles Using Tunable Resistive Pulse Sensing

Extracellular vesicles (EVs), including &#8216;microvesicles&#8217; and &#8216;exosomes&#8217;, are highly abundant in bodily fluids. Recent years have ...

Multicolor Fluorescence Detection for Droplet Microfluidics Using Optical Fibers

Fluorescence assays are the most common readouts used in droplet microfluidics due to their bright signals and fast time response. Applications such as ...

A Method to Estimate Cadaveric Femur Cortical Strains During Fracture Testing Using Digital Image Correlation

This protocol describes the method using digital image correlation to estimate cortical strain from high speed video images of the cadaveric femoral ...

Quantifying Microorganisms at Low Concentrations Using Digital Holographic Microscopy (DHM)

Quantifying Microorganisms at Low Concentrations Using Digital Holographic Microscopy DHM

Accurately detecting and counting sparse bacterial samples has many applications in the food, beverage, and pharmaceutical processing industries, in ...

A Droplet-Based Microfluidic Approach and Microsphere-PCR Amplification for Single-Stranded DNA Amplicons

Droplet-based microfluidics enable the reliable production of homogeneous microspheres in the microfluidic channel, providing controlled size and ...

Bulk Droplet Vitrification for Primary Hepatocyte Preservation

Vitrification is a promising ice-free alternative for classic slow-freezing (at approximately 1 &#176;C/min) cryopreservation of biological samples. ...