This work was supported by the Swiss National Science Foundation Sinergia grant CRSII3 147697, the Stiftung f&#252;r Angewandte Krebsforschung and Z&#252;rich Krebsliga.

1. Preparation of Cytosolic and Nuclear Protein Fraction
<ol>
	<li>Plate 4 x 106 ACC-MESO-4 cells in a T150 cell culture flask grown in RPMI - 1640 medium supplemented with 10% FBS, 1x penicillin/streptomycin (100x), and 2 mM L-Glutamine (200 mM). When cells reach a confluence of 80-90% (~5-5.5 x 106 cells), proceed with protein extraction of nuclear and cytosolic fraction. 
	NOTE: ACC-MESO-4 cell line was obtained from the RIKEN BioResource Centre11.</li>
	<li>Aspirate medium, wash the cells by adding 15 mL of 1x PBS, tilt the plate gently a few times and aspirate the 1x PBS. Add 3 mL of 0.25% Trypsin-EDTA and incubate the culture flask at 37 &#176;C for 3 min. 
	NOTE: Look at the cells under the microscope for detachment; if still attached tap the flask against the palm of a hand 3 times.</li>
	<li>Add 7 mL of RPMI-1640 medium supplemented with 10% FBS, 1x penicillin/streptomycin (100x), and 2 mM L-Glutamine (200 mM), collect the cells in a 15 mL tube, and spin down at 200 x g for 5 min.</li>
	<li>Aspirate medium and resuspend cell pellet with 1.5 mL of 1x PBS, then transfer the cells into a 1.5 mL microcentrifuge tube. Spin down at 500 x g and 4 &#176;C for 5 min. Discard the supernatant. 
	NOTE: From this step onwards, perform all centrifugation steps at 4 &#176;C and keep all reagents on ice.</li>
	<li>Resuspend the cell pellet with ice-cold 1.5 mL of 1x PBS and spin down the cells at 500 x g and 4 &#176;C for 3 min. Discard the supernatant. 
	NOTE: The required amounts of CER I, CER II, and NER reagents are 10, 0.55, and 5 volumes of estimated cell pellet packed volume, respectively; the following protocol assumes a volume of 20 &#181;L. We recommend preparing only the required amount of reagent CER I.</li>
	<li>Add 200 &#181;L of ice-cold cytoplasmic extraction reagent (CER I) supplemented with 2 &#181;L of 1x proteinase inhibitor, e.g., dilute 1 tablet of Protease Inhibitor (EDTA-free) in 500 &#181;L of water to obtain 100x stock. This amount of reagent CER I is enough to lyse 20 &#181;L of a cell pellet packed volume.
	<ol>
		<li>To estimate the cell pellet packed volume, compare the tube containing the cell pellet with a 1.5 mL tube filled with 10, 20, 50 or 100 &#181;L of 1x PBS.</li>
	</ol>
	</li>
	<li>Resuspend the cell pellet by vigorously vortexing the tube for 15 s and incubate the tube on ice for 10 min. Add 11 &#181;L of ice-cold cytoplasmic extraction reagent II (CER II) to the tube, vigorously vortex for 5 s, and incubate 1 min on ice.</li>
	<li>Vortex vigorously for 5 s and centrifuge the tube at 16,000 x g and 4 &#176;C for 5 min. Transfer the supernatant to the clean pre-chilled tube on ice. The supernatant is the cytoplasmic fraction that is further used in the RNA-pulldown experiment.</li>
	<li>Resuspend the remaining pellet in 100 &#181;L of ice-cold nuclear extraction reagent (NER) supplemented with 1&#160;&#181;L of proteinase inhibitor (100x) and vigorously vortex for 15 s. We recommend preparing only the required amount of NER reagent supplemented with protease inhibitors.</li>
	<li>Incubate the sample on ice for 40 min with occasional vortexing for 15 s (every 10 min).</li>
	<li>Centrifuge the tube at 16,000 x g for 10 min. Transfer the supernatant (this is the nuclear protein fraction) to a clean pre-chilled tube.</li>
	<li>Immediately proceed by measuring protein concentration using the bicinchoninic (BCA) method (see Table of Materials).To control for protein purity of each fraction, perform immunoblotting (Figure 1) against &#945;-tubulin (positive detection only in the cytosolic fraction) and Poly ADP-ribose polymerase - PARP (positive detection only in the nuclear fraction). For protein visualization, refer to section 4.</li>
	<li>In order to keep protein activity and their native state, prepare 25 &#181;L of aliquots of cytosolic and nuclear extracts. Snap-freeze these aliquots by placing them in liquid nitrogen for 5 s and store directly at -80 &#176;C.</li>
</ol>
2. Labeling of RNA with Desthiobiotin
<ol>
	<li>Have RNA probes commercially synthesized and HPLC purified. Resuspend with nuclease-free water at 10 &#181;M. 
	NOTE: Probe sequences are listed in Table 1.</li>
	<li>Use 50 pmol of RNA per RNA-pulldown reaction. Thaw and keep all reagents on ice except for PEG 30%, used to label 3&#39; terminus of RNA oligo.</li>
	<li>Transfer 5 &#181;L of 10 &#181;M RNA probes, labeled as CALB2 3&#39; UTR (ARE), CALB2 3&#39; UTR (mtARE), and Unrelated-RNA (IRE), into 0.5 mL thin-wall microcentrifuge tubes and incubate in a PCR machine at 85 &#176;C for 5 min. Place the tubes immediately on ice. 
	NOTE: This step is important, as it promotes the relaxation and accessibility of the RNA probe for labeling.</li>
	<li>For a single 30 &#181;L reaction, add to the RNA-containing tube the following 10 &#181;L mix: 3 &#181;L of nuclease free water, 3 &#181;L of 10x RNA Ligase Reaction Buffer, 1 &#181;L of RNase Inhibitor (40 U/&#181;L), 1 &#181;L of Desthiobiotinylated Cytidine Bisphosphate (1 mM), and 2 &#181;L of T4 RNA ligase (20 U/&#181;L). 
	NOTE: To prepare master mix A for 3 samples in excess (3.2), mix 9.6 &#181;L of nuclease free water, 9.6 &#181;L of 10x RNA Ligase Reaction Buffer, 3.2 &#181;L of RNase Inhibitor (40 U/&#181;L), 3.2 &#181;L of Desthiobiotinylated Cytidine Bisphosphate (1 mM), and 6.4 &#181;L of T4 RNA ligase (20 U/&#181;L).</li>
	<li>Add carefully 15 &#181;L of PEG 30% to the reaction. Use another tip to mix the reaction. Incubate the reaction overnight at 16 &#176;C.</li>
	<li>The next day, prepare the following: 5 M NaCl (fresh/nuclease-free), chloroform: isoamyl alcohol in 24:1 ratio (e.g., per reaction - 96 &#181;L chloroform and 4 &#181;L of isoamyl alcohol), ice-cold 100% ethanol, and ice-cold 70% ethanol.</li>
	<li>Add 70 &#181;L of nuclease-free water to the RNA-labeling reaction tubes. Add 100 &#181;L of chloroform: isoamyl alcohol and vortex briefly. Spin-down at 13,000 x g for 3 min. Carefully remove ONLY the upper phase and transfer to a new nuclease-free 1.5 mL tube; avoid touching the lower phase.</li>
	<li>Add 10 &#181;L of 5 M NaCl, 1 &#181;L of glycogen and 300 &#181;L of ice-cold 100% ethanol. Place the tube at -20 &#176;C for 2 h. 
	NOTE: At this step, the experiment can be continued on the following day.</li>
	<li>Centrifuge at 13,000 x g and 4 &#176;C for 15 min. Carefully discard the supernatant without disturbing the pellet. Add 300 &#181;L of ice-cold 70% ethanol and centrifuge again at 13,000 x g and 4 &#176;C for 5 min.</li>
	<li>Discard the supernatant completely and air-dry the pellet (15 min). Resuspend the pellet in 20 &#181;L of nuclease-free water. 
	NOTE: Proceed with RNA-pulldown on the same day.</li>
	<li>Incubate the RNA at 90 &#176;C for 2 min and place on ice. Place the labelled-RNA on ice during the following step of pre-washing of the streptavidin magnetic beads. 
	NOTE: A longer incubation time may damage the RNA probe.</li>
</ol>
3. RNA-Protein Pulldown
<ol>
	<li>Pre-washing streptavidin-magnetic beads and incubation with desthiobiotin-RNA
	<ol>
		<li>Use 50 &#181;L of streptavidin magnetic beads per 50 pmol RNA. However, this should be optimized depending on the experiment.</li>
		<li>Vortex the tube with streptavidin-magnetic beads for 15 s, and quickly remove 200 &#181;L (master mix; enough for 3+1 reactions) into a clean 1.5 mL safe-lock tube using cut pipette tips. Place the tube on a magnetic stand so that the beads collect at the side of the tube and wait 1 min. Remove the resuspension liquid.</li>
		<li>To wash the beads, remove the tube from the magnetic stand, add 400 &#181;L of 0.1 M NaOH, 0.05 M NaCl solution, and gently pipet up and down several times. Place the tube back on the magnetic stand. Wait 1 min and collect the supernatant. Repeat this step again.</li>
		<li>Wash the beads with 200 &#181;L of 100 mM NaCl. Remove the supernatant.</li>
		<li>Add 200 &#181;L of 20 mM Tris (pH 7.5), resuspend beads by pipetting, place the tube on the magnetic stand, wait for 1 min and remove the supernatant. Repeat the step.</li>
		<li>Remove the tube from the magnetic stand, add 200 &#181;L of 1x RNA Capture buffer, and resuspend streptavidin magnetic beads by briefly vortexing. Remove 50 &#181;L of streptavidin magnetic beads and add to each labeled-RNA tube using a cut pipette tip. Incubate the tubes for 30 min at room temperature on a roller.</li>
	</ol>
	</li>
	<li>Binding of protein to RNA
	<ol>
		<li>Place the tubes into a magnetic stand, wait 1 min, and remove the supernatant.</li>
		<li>Add 50 &#181;L of 20 mM Tris (pH 7.5) to the beads and resuspend by pipetting. Place the tubes into a magnetic stand, wait 1 min, and remove supernatant. Repeat this step.</li>
		<li>Add 100 &#181;L of 1x Protein-RNA binding buffer to the beads and resuspend by pipetting.</li>
		<li>In the meantime, prepare the following mix: 10 &#181;L of 10x Protein-RNA binding buffer, 30 &#181;L of 50% glycerol, 50 &#181;g of cytoplasmic proteins, and nuclease-free water up to 100 &#181;L. 
		NOTE: Prepare master mix B for 3 samples in excess (3.3) as follows: 33 &#181;L of 10x Protein-RNA binding buffer, 99 &#181;L of 50% glycerol, 165 &#181;g of cytoplasmic proteins and nuclease-free water up to 330 &#181;L. Keep the tube of master mix B on ice.</li>
		<li>Place the tubes into magnetic stand, wait 1 min and collect the supernatant. Add 100 &#181;L of master mix B, resuspend by gently pipetting up and down, and avoid creating bubbles. Incubate reaction tubes for 60 min at 4 &#176;C on a roller.</li>
	</ol>
	</li>
	<li>Washing and elution
	<ol>
		<li>Place the tubes into a magnetic stand, collect the supernatant (which is flow through - FT), and transfer into a new tube. 
		NOTE: Keep this FT on ice for later analysis.</li>
		<li>Pipette 100 &#181;L of 1x Wash buffer on the beads, resuspend gently, put back into the magnetic stand, wait 1 min, and discard the supernatant. Repeat this step 2 times.</li>
		<li>Add 40 &#181;L of Elution Buffer to the magnetic beads, mix by pipetting up and down, and incubate at 37 &#176;C on a tube shaker (950 rpm) for 30 min.</li>
		<li>Place the tubes into a magnetic stand, wait 1 min, and collect eluted sample (which is eluate - E). Place on ice and use for downstream analysis. 
		NOTE: At this step, each tested RNA probe consists of a flow-through (FT) and eluate (E) sample.</li>
	</ol>
	</li>
</ol>
4. Polyacrylamide Electrophoresis and Western Blot Analysis
NOTE: See Table 2 for recipes for the buffers used in this section. Perform a Western blot according to the Laemmli method12.
<ol>
	<li>Handcast 12% SDS-PAGE gels (10-wells, 1.5 mm spacer, 66 &#181;L). Prepare a running gel mix: 4 mL of 30% acrylamide-bisacrylamide stock solution, 2.4 mL of Lower Tris buffer, 3.2 mL of dH2O, 9.6 &#181;L of TEMED, 96 &#181;L of 10% ammonium persulfate solution (APS). Prepare stacking gel mix: 3.25 mL of dH2O, 0.5 mL of 30% acrylamide - bisacrylamide stock solution, 1.3 mL of Upper Tris buffer, 10 &#181;L of TEMED, 20 &#181;L of 10% APS.</li>
	<li>Add 16.6 &#181;L of 6x Laemmli buffer (e.g., 14 mL of Tris/HCl/SDS pH 6.8 (Upper Tris buffer), 2 g of SDS, 1.86 g of DTT, 6 mL of glycerol, and 0.012% bromophenol blue; stored at -20 &#176;C) into the FT sample, and 6.6 &#181;L of 6x Laemmli buffer into E sample. Incubate samples for 5 min at 95 &#176;C.</li>
	<li>Load the samples (20 &#181;L of FT and whole Elute ~40 &#181;L) and run them for 30 min at 60 V, continuing with 20 V overnight.</li>
	<li>Using a semi-dry electroblotting system, transfer proteins onto a PVDF membrane for 80 min at 15 V. 
	NOTE: The PVDF membrane must be activated before performing protein transfer. Incubate the membrane in 100% methanol for 1 min, followed by a 2 min incubation in ultrapure water.</li>
	<li>After the protein transfer, incubate the SDS-PAGE gel with Coomassie solution for 3 h, followed by three steps of washing with ultrapure water, each 30 min.</li>
	<li>At the end of protein transfer, let the PVDF membrane dry for 1 h. Reactivate the membrane as indicated in step 4.5. Block the membrane 1 h with 5% BSA in 1x TTBS.</li>
	<li>Incubate the membrane with the first antibody: HuR or mesothelin, both diluted 1:1000 in 5% BSA in 1x TTBS for 4h at room temperature or overnight at 4 &#176;C.</li>
	<li>Wash the membrane three times for 7 min in 1x TTBS, and incubate with rabbit anti-mouse horseradish peroxidase (HRP)-conjugated secondary antibody diluted 1:10,000 in 5% BSA, 1x TTBS.</li>
	<li>Visualize proteins using enhanced chemiluminescence and a digital imager.</li>
</ol>

<ol>
	<li>Glisovic, T., Bachorik, J. L., Yong, J., Dreyfuss, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-binding+proteins+and+post-transcriptional+gene+regulation.">RNA-binding proteins and post-transcriptional gene regulation.</a> FEBS Letters. 582 (14), 1977-1986 (2008).</li><li>Mayr, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolution+and+biological+roles+of+alternative+3'UTRs.">Evolution and biological roles of alternative 3'UTRs.</a> Trends in Cell Biology. 26 (3), 227-237 (2016).</li><li>Matoulkova, E., Michalova, E., Vojtesek, B., Hrstka, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+the+3'+untranslated+region+in+post-transcriptional+regulation+of+protein+expression+in+mammalian+cells.">The role of the 3' untranslated region in post-transcriptional regulation of protein expression in mammalian cells.</a> RNA Biology. 9 (5), 563-576 (2012).</li><li>von Roretz, C., Di Marco, S., Mazroui, R., Gallouzi, I. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Turnover+of+AU-rich-containing+mRNAs+during+stress:+a+matter+of+survival.">Turnover of AU-rich-containing mRNAs during stress: a matter of survival.</a> Wiley Interdisciplinary Reviews: RNA. 2 (3), 336-347 (2011).</li><li>Fallmann, J., Sedlyarov, V., Tanzer, A., Kovarik, P., Hofacker, I. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=AREsite2:+An+enhanced+database+for+the+comprehensive+investigation+of+AU/GU/U-rich+elements.">AREsite2: An enhanced database for the comprehensive investigation of AU/GU/U-rich elements.</a> Nucleic Acids Research. 44, D90-D95 (2016).</li><li>Kresoja-Rakic, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Posttranscriptional+regulation+controls+calretinin+expression+in+malignant+pleural+mesothelioma.">Posttranscriptional regulation controls calretinin expression in malignant pleural mesothelioma.</a> Frontiers in Genetics. 8 (70), (2017).</li><li>Chu, C., Spitale, R. C., Chang, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Technologies+to+probe+functions+and+mechanisms+of+long+noncoding+RNAs.">Technologies to probe functions and mechanisms of long noncoding RNAs.</a> Nature Structural &amp; Molecular Biology. 22 (1), 29-35 (2015).</li><li>Diamandis, E. P., Christopoulos, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biotin-(strept)avidin+system:+principles+and+applications+in+biotechnology.">The biotin-(strept)avidin system: principles and applications in biotechnology.</a> Clinical Chemistry. 37 (5), 625-636 (1991).</li><li>Hirsch, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Easily+reversible+desthiobiotin+binding+to+streptavidin,+avidin,+and+other+biotin-binding+proteins:+Uses+for+protein+labeling,+detection,+and+isolation.">Easily reversible desthiobiotin binding to streptavidin, avidin, and other biotin-binding proteins: Uses for protein labeling, detection, and isolation.</a> Analytical Biochemistry. 308 (2), 343-357 (2002).</li><li>. Magnetic bead technology for better assay development Available from: <a target="_blank" href="https://assets.thermofisher.com/TFS-Assets/LSG/brochures/1602577-Magnetic-Bead-Technology-Brochure.pdf">https://assets.thermofisher.com/TFS-Assets/LSG/brochures/1602577-Magnetic-Bead-Technology-Brochure.pdf</a> (2013)</li><li>Usami, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+and+characterization+of+four+malignant+pleural+mesothelioma+cell+lines+from+Japanese+patients.">Establishment and characterization of four malignant pleural mesothelioma cell lines from Japanese patients.</a> Cancer Science. 97 (5), 387-394 (2006).</li><li>Laemmli, U. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cleavage+of+structural+proteins+during+the+assembly+of+the+head+of+bacteriophage+T4.">Cleavage of structural proteins during the assembly of the head of bacteriophage T4.</a> Nature. 227 (5259), 680-685 (1970).</li><li>Coulson, R. M., Cleveland, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ferritin+synthesis+is+controlled+by+iron-dependent+translational+derepression+and+by+changes+in+synthesis/transport+of+nuclear+ferritin+RNAs.">Ferritin synthesis is controlled by iron-dependent translational derepression and by changes in synthesis/transport of nuclear ferritin RNAs.</a> Proceedings of the National Academy of Sciences of the United States of America. 90 (16), 7613-7617 (1993).</li><li>Leibold, E. A., Munro, H. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytoplasmic+protein+binds+in+vitro+to+a+highly+conserved+sequence+in+the+5'+untranslated+region+of+ferritin+heavy-+and+light-subunit+mRNAs.">Cytoplasmic protein binds in vitro to a highly conserved sequence in the 5' untranslated region of ferritin heavy- and light-subunit mRNAs.</a> Proceedings of the National Academy of Sciences of the United States of America. 85 (7), 2171-2175 (1988).</li><li>Srikantan, S., Gorospe, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HuR+function+in+disease.">HuR function in disease.</a> Frontiers in Bioscience (Landmark Edition). 17, 189-205 (2012).</li><li>Morris, K. V., Mattick, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+rise+of+regulatory+RNA.">The rise of regulatory RNA.</a> Nature Reviews: Genetics. 15 (6), 423-437 (2014).</li><li>Rinn, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+demarcation+of+active+and+silent+chromatin+domains+in+human+HOX+loci+by+noncoding+RNAs.">Functional demarcation of active and silent chromatin domains in human HOX loci by noncoding RNAs.</a> Cell. 129 (7), 1311-1323 (2007).</li><li>Zhao, J., Sun, B. K., Erwin, J. A., Song, J. J., Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polycomb+proteins+targeted+by+a+short+repeat+RNA+to+the+mouse+X+chromosome.">Polycomb proteins targeted by a short repeat RNA to the mouse X chromosome.</a> Science. 322 (5902), 750-756 (2008).</li><li>McHugh, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Xist+lncRNA+interacts+directly+with+SHARP+to+silence+transcription+through+HDAC3.">The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3.</a> Nature. 521 (7551), 232-236 (2015).</li></ol>

The authors declare that they have no competing financial interests.

3&#39; UTRs belong to the non-coding genome3, and all non-coding RNAs can interact with proteins in order to exert their function7. When the mammalian genome was found to be pervasively transcribed and produced a significant portion of long noncoding RNAs16, emerging evidences demonstrated that these long-noncoding RNAs function in regulating gene expression as they interact with chromatin-remodeling complexes17. This knowledge was gained by utilizing the RNA-pulldown assay. Thus, to start deciphering interactors of a specific RNA, the first step could be in vitro biochemical assays such as RNA-pulldown, as it is simple to perform.
Of note, not only sequence motifs but also the secondary structure of RNA plays a critical role in RNA functionality as they form domains essential for interacting with proteins. The secondary structure can vary in physiological and in vitro conditions, and RNA-pulldown may lead to the identification of falsepositives. For example, RNA-pulldown identified EZH2, a component of the polycomb repressive complex 2 (PRC2), as an interactor of X inactive specific transcript (Xist)18, whereas a recent study that used RNA antisense purification coupled with mass spectrometry (RAP-MS) identified other interactors such as SHARP (SMRT and HDAC associated repressor protein), SAF-1 (scaffold attachment factor A) and LBR (lamin B receptor)19. Therefore, if no other functional tests support the interaction between an RNA and a given protein, findings should be further supplemented with a complementary protein-centric approach, such as immunoprecipitating the given protein, followed by extraction and characterization of the bound RNA.
The herein protocol presented has been used to detect HuR binding to the ARE motif in CALB2 3&#39; UTR, which had previously been functionally characterized by pmiRGLO-luciferase assay6. Due to the small amount of proteins, this protocol is not suitable for downstream analysis such as mass-spectrometry where larger protein amounts are necessary. Instead, the protocol can be used to revalidate the RNA-interactors identified by mass spectrometry, but using a significantly lower amount of proteins.
Since the method includes working with RNA, which is susceptible to degradation, we recommend cleaning the working surfaces with a RNase-decontaminating solution in addition to standard laboratory good practice. If possible, perform preparation of RNA labeling and purification under laminar flow. The purity of the RNA oligo may also affect the binding conditions; thus, the commercially synthesized probes were HPLC purified. If modified, longer and extremely pure RNA oligos are required, use PAGE purification method. Prepare aliquots of native proteins by snap freezing, therefore avoiding damaging of proteins due to the slow freezing approach and repeated freezing and thawing.

Gene expression and the final level of the gene product can be tightly regulated by affecting the mRNA stability and mRNA translation rate1. These post-transcriptional regulatory mechanisms are exerted through the interactions of non-coding RNA and/or RNA-binding proteins (RBPs) with targeted mRNA. It is usually the 3&#39; untranslated region of mRNA (3&#39; UTR - belonging to the non-coding portion of the genome2) that contains specific cis-regulatory elements (CRE), which are recognized by trans-acting factors such as miRNA or RBPs3. The best-studied cis-element within the 3&#39; UTR, is the adenine-rich element (ARE) motif, which is recognized by specific AU-binding proteins (AUBP), and, in turn, induces either mRNA degradation/deadenylation (ARE-mediated decay) or mRNA stabilization4.
The size of the 3&#39; UTR of calretinin mRNA (CALB2) is 573 bp long and contains a putative AUUUA pentamer, as predicted by AREsite2, a bioinformatic tool5. Consistent with the presence of a putative ARE motif, the pmirGLO vector-reporter assay demonstrated a stabilization role of this element within CALB2 mRNA6. Finally, the in vitro RNA-pulldown was used to identify the AUBP that stabilizes calretinin mRNA through the ARE motif.
Since all non-coding RNAs interact with proteins7, the in vitro RNA-pulldown is a good way and first-of-choice assay for identifying RNA-interactors to aid in deciphering molecular mechanisms. In this RNA-pulldown method, commercially synthesized RNA probes, which were labeled with a modified form of biotin (desthiobiotin) at the 3&#39; terminus of the RNA strand, were used. The RNA-desthiobiotin is immobilized through interaction with streptavidin on magnetic beads, which are used to pull down proteins that specifically interact with the bound-RNA of interest. Non-denatured and active proteins from the cytosolic fraction of mesothelioma cells are used as the source of proteins. Such RNA-bound proteins are eluted from the magnetic beads, run through a 12% SDS-PAGE gel, transferred to a membrane, and probed with different antibodies.
In the standard streptavidin-biotin affinity purification procedure, harsh denaturation conditions are required to disrupt the strong irreversible biotin-streptavidin bond to elute the bound proteins8, which could lead to the dissociation of protein complexes. Unlike biotin, desthiobiotin reversibly binds to streptavidin and is competitively displaced with a buffered solution of biotin, allowing for the gentle elution of proteins, and avoiding the isolation of naturally biotinylated molecules9, suggesting that the technique is ideal for isolating native protein complexes under native conditions.
In vitro binding conditions and stringency, which are determined by salt concentration, reducing agents and detergent percentage, should be close to those present in the cellular context in order to identify true in vivo interactions. The binding conditions implemented herein have been previously demonstrated as appropriate for the identification of the HuR as an AU-binding protein10. This approach could save time, since optimization of proper binding conditions can be time-consuming and challenging. In addition, this method could be used as a starting protocol for any RNA-pulldown experiment and can be gradually optimized by changing the concentration of salts and detergents, changing the glycerol percentage, and adding other salts. Moreover, we demonstrated that even a short 25-nucleotide RNA-probe harboring a pentamer ARE-motif could be used to demonstrate interaction with a specific AUBP.

<table><tbody><tr><td>NE-PER Nuclear and cytoplasmic extraction kit</td><td>Thermo Fisher Scientific&amp;nbsp;</td><td>78833</td><td></td></tr><tr><td>Pierce Protease Inhibitor Tablets, EDTA-free</td><td>Thermo Fisher Scientific</td><td>A32965</td><td></td></tr><tr><td>Pierce BCA Protein Assay Kit</td><td>Thermo Fisher Scientific</td><td>23225</td><td></td></tr><tr><td>Pierce Magnetic RNA-protein Pull-Down Kit&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>20164</td><td>Includes magnetic beads and therefore the kit need to be stored at 4 &amp;deg;C</td></tr><tr><td>Pierce RNA 3&amp;rsquo; End Desthiobiotinylation Kit&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>20163</td><td>The kit is a part of the &quot;Pierce Magnetic RNA-protein Pull-Down Kit&quot;, and needs to be stored at -20 &amp;deg;C unlike the pull-down kit (4 &amp;deg;C).</td></tr><tr><td>DynaMag-2,&amp;nbsp; magnetic stand</td><td>Thermo Fisher Scientific</td><td>12321D</td><td></td></tr><tr><td>Anti - HuR (MOUSE) monoclonal antibody</td><td>Thermo Fisher Scientific</td><td>-</td><td>The antibody is included in the Pierce Magnetic RNA-protein Pull-Down Kit&amp;nbsp; - 1:1000 in 5% BSA 1x TTBS - rabbit anti-mouse secondary antibody 1:10,000 in 5% BSA 1x TTBS</td></tr><tr><td>Anti - &amp;alpha; - tubulin (MOUSE) monoclonal antibody</td><td>Santa Cruz</td><td>8035</td><td>1:1000 in 5% BSA 1x TTBS - rabbit anti-mouse secondary antibody 1:10,000 in 5% BSA 1x TTBS</td></tr><tr><td>Anti - PARP (RABBIT) Polyclonal antibody</td><td>Cell Signaling</td><td>9542</td><td>1:1000 in 5% BSA 1x TTBS - goat anti-rabbit secondary antibody 1:10,000 in 5% BSA 1x TTBS</td></tr><tr><td>Anti - Mesothelin (MOUSE) Monoclonal Antibody&amp;nbsp;</td><td>Rockland</td><td>200-301-A87</td><td></td></tr><tr><td>Secondary goat anti-rabbit antibody</td><td>Cell Signaling</td><td>7074</td><td></td></tr><tr><td>Secondary rabbit anti-mouse antibody</td><td>Sigma-Aldrich</td><td>A-9044</td><td></td></tr><tr><td>RPMI - 1640 medium</td><td>Sigma-Aldrich</td><td>R8758</td><td></td></tr><tr><td>FBS - Filtrated Bovine Serum</td><td>Pan Biotech&amp;nbsp;</td><td>P40-37500</td><td></td></tr><tr><td>Penicillin - streptomycin (100x)</td><td>Sigma-Aldrich&amp;nbsp;</td><td>P4333</td><td></td></tr><tr><td>L-Glutamine solution (200 mM)</td><td>Sigma-Aldrich&amp;nbsp;</td><td>G7513</td><td></td></tr><tr><td>0.25% Trypsin-EDTA (1x)</td><td>Gibco by Life technologies&amp;nbsp;</td><td>25200-056</td><td></td></tr><tr><td>Mini-PROTEAN 3 Cell</td><td>Bio-Rad</td><td>1653301</td><td></td></tr><tr><td>Mini Protean System Glass Plates&amp;nbsp;</td><td>Bio-Rad</td><td>1653308</td><td></td></tr><tr><td>Mini-PROTEAN Spacer Plates with 1.5 mm integrated spacer</td><td>Bio-Rad</td><td>1653312</td><td></td></tr><tr><td>Mini-PROTEAN Comb, 10-well, 1.5 mm, 66 &amp;micro;L</td><td>Bio-Rad</td><td>1653365</td><td></td></tr><tr><td>Mini-PROTEAN Tetra Cell Casting Modules</td><td>Bio-Rad</td><td>1658050</td><td></td></tr><tr><td>RNaseZap RNase Decontamination Solution</td><td>Thermo Fisher Scientific</td><td>AM9780</td><td></td></tr><tr><td>Rotiphorese gel 30 - aqueous 30% acrylamide and bisacrylamide stock solution at a ration of 37.5:1</td><td>Roth</td><td>3029</td><td></td></tr><tr><td>20% SDS&amp;nbsp;</td><td>PanReac AppliChem</td><td>A3942</td><td></td></tr><tr><td>PVDF transfer membrane&amp;nbsp;</td><td>Perkin Elmer</td><td>NEF1002</td><td>Need to be activated by incubating in pure methanol for 1 min followed by washing in water for 2 min&amp;nbsp;</td></tr><tr><td>Trans-Blot SD semi-dry transfer cell&amp;nbsp;</td><td>Bio-Rad</td><td>1703940</td><td></td></tr><tr><td>Clarity Western ECL Substrate</td><td>Bio-Rad</td><td>1705061</td><td></td></tr><tr><td>FusionFX&amp;nbsp; Digital Imager</td><td>Vilber</td><td>-</td><td></td></tr><tr><td>RNA oligo synthesis</td><td>Mycrosynth AG, Switzerland</td><td>-</td><td>the synthesis scale - 0.04 &amp;micro;mol - HPLC purified</td></tr><tr><td>Bovine serum albumin</td><td>Sigma-Aldrich</td><td>A7030</td><td></td></tr><tr><td>Hydrochloric Acid (HCl) 6 M</td><td>PanReac AppliChem</td><td>182883.1211</td><td></td></tr><tr><td>Ultra Pure 1 M Tris, pH 7.5&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>15567027</td><td></td></tr><tr><td>Glycerol&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>17904</td><td>50% sterile aliquots to be stored at -20&amp;deg;C</td></tr><tr><td>Pierce Streptavidin magnetic beads&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>88817</td><td>Please note that these magnetic beads have an average diameter of 1 &amp;micro;m (range from 0.5 - 1.5 &amp;micro;m). Furthermore, Dynabeads-M280 Streptavidin, which are beads of homogenouse size 2.8 &amp;micro;m, are also used in RNA-pulldown but be aware that this may affect purification process.</td></tr><tr><td>TEMED</td><td>Sigma-Aldrich</td><td>T9281</td><td></td></tr><tr><td>Ammonium persulfate&amp;nbsp;</td><td>Sigma-Aldrich</td><td>A3678</td><td></td></tr><tr><td>Coomassie G-250</td><td>Applichem</td><td>A3480</td><td></td></tr><tr><td>Aluminiumsulfate-(14-18)-hydrate&amp;nbsp;</td><td>Sigma-Aldrich</td><td>368458</td><td></td></tr><tr><td>ortho-phosphoric acid&amp;nbsp;</td><td>Applichem</td><td>A0637</td><td></td></tr></tbody></table>

desthiobiotin-streptavidin-affinity mediated purification of rna-interacting proteins in mesothelioma cells

The in vitro RNA-pulldown is still largely used in the first steps of protocols aimed at identifying RNA-binding proteins that recognize specific RNA structures and motifs. In this RNA-pulldown protocol, commercially synthesized RNA probes are labeled with a modified form of biotin, desthiobiotin, at the 3' terminus of the RNA strand, which reversibly binds to streptavidin and thus allows elution of proteins under more physiological conditions. The RNA-desthiobiotin is immobilized through interaction with streptavidin on magnetic beads, which are used to pull down proteins that specifically interact with the RNA of interest. Non-denatured and active proteins from the cytosolic fraction of mesothelioma cells are used as the source of proteins. The method described here can be applied to detect the interaction between known RNA binding proteins and a 25-nucleotide (nt) long RNA probe containing a sequence of interest. This is useful to complete the functional characterization of stabilizing or destabilizing elements present in RNA molecules achieved using a reporter vector assay.

In this experiment, a 25-nt long fragment of calretinin 3&#39; UTR harboring ARE motif (CALB2 3&#39; UTR (ARE) 25-nt) was used to test whether it binds specifically to the Human-antigen R (HuR) protein, a known mRNA stabilizer. To test the specificity of the ARE element, a 25-nt RNA probe CALB2 3&#39; UTR (mtARE) containing an ARE-motif mutation, which was previously shown to abolish the stabilization effect of the ARE motif, was used6. The third RNA probe represents the negative control, which is a 28-nt unrelated RNA that contains the well-defined iron-responsive element (Unrelated RNA (IRE)), known to bind cytosolic iron-responsive protein13,14. Since HuR is predominately localized within the nucleus but functions as a mRNA-stabilizer in the cytosol15, nuclear/cytosolic extraction was performed to obtain active proteins from the cytosol.
To demonstrate the purity of the nuclear/cytosolic fractions, proteins were analyzed by Western blot, which showed that &#945;-tubulin was only detected in the cytosolic fraction, whereas PARP protein was detected only in the nuclear fraction, as anticipated (Figure 1). The eluate from the CALB2 3&#39; UTR ARE-probe demonstrated binding of HuR whereas HuR was absent in the eluate from the mutant probe CALB 3&#39; UTR (mtARE). HuR was also absent in the eluate from the unrelated RNA probe which binds the iron-responsive protein (Figure 2A). To further demonstrate the specificity between the CALB 3&#39; UTR (ARE) and HuR, the membrane was additionally probed with anti-mesothelin (MSLN) antibody, as this protein does not interact with RNA. Eluates from all three samples showed no presence of mesothelin. Taken together, this indicates that the stabilizing ARE motif within CALB2 3&#39;UTR can specifically bind HuR protein.
Coomassie staining of the gel (Figure 2B) shows that equal amounts of proteins were used to incubate with the three different RNA probes. Because of the low amount of cytosolic extract used and transfer to the membrane, this staining did not allow for detection of proteins in the eluate (E) lanes, which were otherwise detected by Western blot analysis.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57516/57516fig1.jpg" /> 
Figure 1: Western blot analysis of 5 &#181;g of cytosolic and nuclear protein fraction. PARP protein is present in the nuclear fraction (N) but absent from the cytosolic (C) fraction. &#945;-tubulin is present in the cytosolic fraction (C) but absent in the nuclear fraction (N). <a href="/files/ftp_upload/57516/57516fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57516/57516fig2.jpg" /> 
Figure 2: Western blot shows that HuR is captured by 25-nt CALB2 3&#39; UTR (ARE). A) FT: flow through after incubation with RNA probe; E: proteins eluted upon incubation and binding to RNA probes. Probes: CALB2 3&#39; UTR (mtARE) - 25-nt fragment of calretinin 3&#39; UTR that contains 3 mutated nucleotides within the ARE motif; UR RNA (IRE) - 28-nt RNA probe with a well-defined iron-responsive element that binds the iron-responsive proteins. The membrane was further probed for mesothelin (MSLN), a protein that does not interact with RNA. B) Coomassie staining of the gel after protein transfer, demonstrating that equal amounts of proteins were incubated with RNA probes. <a href="/files/ftp_upload/57516/57516fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>RNA probe</td>
			<td>Sequence</td>
			<td>Concentration&#160;</td>
		</tr>
		<tr>
			<td>CALB2 3&#8217; UTR (ARE) 25nt</td>
			<td>UCGCUGUAUGAUUUAGGCUUCUAUG</td>
			<td>10 &#181;M</td>
		</tr>
		<tr>
			<td>CALB2 3&#8217; UTR (mtARE) 25nt</td>
			<td>UCGCUGUAUGGUCUGGGCUUCUAUG</td>
			<td>10 &#181;M</td>
		</tr>
		<tr>
			<td>Unrelated RNA - IRE 28nt&#160;</td>
			<td>UCCUGCUUCAACAGUGCUUGGACGGAAC</td>
			<td>10 &#181;M</td>
		</tr>
	</tbody>
</table>
Table 1: Sequences of RNA probes
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Lower Tris buffer for running gel</td>
			<td></td>
		</tr>
		<tr>
			<td>1.5 M</td>
			<td>Tris Base</td>
		</tr>
		<tr>
			<td>0.40%</td>
			<td>SDS solution</td>
		</tr>
		<tr>
			<td>addjust pH to 8.8 using HCL (6 mol/L)</td>
			<td></td>
		</tr>
		<tr>
			<td>fill up with</td>
			<td>dH2O</td>
		</tr>
		<tr>
			<td>Upper Tris for stacking gel SDS-PAGE</td>
			<td></td>
		</tr>
		<tr>
			<td>500 mM</td>
			<td>Tris base</td>
		</tr>
		<tr>
			<td>0.4%</td>
			<td>SDS solution</td>
		</tr>
		<tr>
			<td>Adjust pH to 6.8 using HCL (6 mol/L)</td>
			<td></td>
		</tr>
		<tr>
			<td>fill up with</td>
			<td>dH2O</td>
		</tr>
		<tr>
			<td>10X Running buffer</td>
			<td></td>
		</tr>
		<tr>
			<td>250 mM</td>
			<td>Tris base</td>
		</tr>
		<tr>
			<td>1.92 M</td>
			<td>Glycine</td>
		</tr>
		<tr>
			<td>Adjust pH to 8.3 using&#160; HCL (6 mol/L)</td>
			<td></td>
		</tr>
		<tr>
			<td>fill up with</td>
			<td>dH2O</td>
		</tr>
		<tr>
			<td>Filter or autoclave and store at 4&#176;C</td>
			<td></td>
		</tr>
		<tr>
			<td>1X Running buffer</td>
			<td></td>
		</tr>
		<tr>
			<td>100 mL</td>
			<td>10X Running buffer</td>
		</tr>
		<tr>
			<td>0.05%</td>
			<td>SDS solution</td>
		</tr>
		<tr>
			<td>Fill up to 1 L with</td>
			<td>dH2O</td>
		</tr>
		<tr>
			<td>10X Transfer Buffer </td>
			<td></td>
		</tr>
		<tr>
			<td>480 mM</td>
			<td>Tris base</td>
		</tr>
		<tr>
			<td>390 mM</td>
			<td>Glycine</td>
		</tr>
		<tr>
			<td>0.38%</td>
			<td>SDS solution</td>
		</tr>
		<tr>
			<td>fill up with</td>
			<td>dH2O</td>
		</tr>
		<tr>
			<td>Note: Filter 0.22 um and Store at 4 &#176;C</td>
			<td></td>
		</tr>
		<tr>
			<td>1X Transfer buffer (for semi-dry system)</td>
			<td></td>
		</tr>
		<tr>
			<td>20 mL</td>
			<td>10X Transfer Buffer</td>
		</tr>
		<tr>
			<td>40 mL</td>
			<td>methanol</td>
		</tr>
		<tr>
			<td>fill up to 200 mL</td>
			<td>dH20</td>
		</tr>
		<tr>
			<td>10X TBS (Tris-buffered saline)</td>
			<td></td>
		</tr>
		<tr>
			<td>250 mM</td>
			<td>Tris base</td>
		</tr>
		<tr>
			<td>1.36 M</td>
			<td>NaCl</td>
		</tr>
		<tr>
			<td>27 mM</td>
			<td>KCl</td>
		</tr>
		<tr>
			<td>Adjust pH to 7.4</td>
			<td></td>
		</tr>
		<tr>
			<td>fill up with</td>
			<td>dH2O</td>
		</tr>
		<tr>
			<td>Filter</td>
			<td></td>
		</tr>
		<tr>
			<td>1X TTBS (Tris-buffer saline with 0.1 Tween-20) </td>
			<td></td>
		</tr>
		<tr>
			<td>1X</td>
			<td>10X TBS</td>
		</tr>
		<tr>
			<td>0.10%</td>
			<td>Tween-20</td>
		</tr>
		<tr>
			<td>fill up with</td>
			<td>dH2O</td>
		</tr>
		<tr>
			<td>RNA Capture Buffer (1X)</td>
			<td></td>
		</tr>
		<tr>
			<td>20 mM</td>
			<td>Tris (pH 7.5)</td>
		</tr>
		<tr>
			<td>1 M</td>
			<td>NaCl</td>
		</tr>
		<tr>
			<td>1 mM</td>
			<td>EDTA</td>
		</tr>
		<tr>
			<td>Protein-RNA Binding Buffer (10x)</td>
			<td></td>
		</tr>
		<tr>
			<td>200 mM</td>
			<td>Tris (pH 7.5)</td>
		</tr>
		<tr>
			<td>500 mM</td>
			<td>NaCl</td>
		</tr>
		<tr>
			<td>20 mM</td>
			<td>MgCl2</td>
		</tr>
		<tr>
			<td>1%</td>
			<td>Tween-20</td>
		</tr>
		<tr>
			<td>Wash Buffer (1x) </td>
			<td></td>
		</tr>
		<tr>
			<td>20 mM</td>
			<td>Tris (pH 7.5)</td>
		</tr>
		<tr>
			<td>10 mM</td>
			<td>NaCl</td>
		</tr>
		<tr>
			<td>0.1%</td>
			<td>Tween-20</td>
		</tr>
		<tr>
			<td>Elution Buffer</td>
			<td></td>
		</tr>
		<tr>
			<td>4 mM</td>
			<td>biotin</td>
		</tr>
		<tr>
			<td>20 mM</td>
			<td>Tris (pH 7.5)</td>
		</tr>
		<tr>
			<td>50 mM</td>
			<td>NaCl</td>
		</tr>
		<tr>
			<td>Coomassie solution</td>
			<td></td>
		</tr>
		<tr>
			<td>0.02%</td>
			<td>Coomassie G-250</td>
		</tr>
		<tr>
			<td>5%</td>
			<td>Aluminiumsulfate-(14-18)-hydrate</td>
		</tr>
		<tr>
			<td>10%</td>
			<td>EtOH</td>
		</tr>
		<tr>
			<td>2%</td>
			<td>ortho-phosphoric acid</td>
		</tr>
	</tbody>
</table>
Table 2: Recipes

Watch this Scientific Journal Video about Desthiobiotin-Streptavidin-Affinity Mediated Purification of RNA-Interacting Proteins in Mesothelioma Cells at JoVE.com

Desthiobiotin-Streptavidin-Affinity Mediated Purification of RNA-Interacting Proteins in Mesothelioma Cells

Desthiobiotin labeling of a synthetic 25-nucleotide RNA oligo, which contains an adenine-rich element (ARE) motif, allows specific binding of cytosolic ARE-binding protein.

The in vitro RNA-pulldown is still largely used in the first steps of protocols aimed at identifying RNA-binding proteins that recognize specific RNA ...

desthiobiotin-streptavidin-affinity-mediated-purification-rna

Nanyang Technological University

Research

JoVE Journal

Cancer Research

7.9K Views.  University Hospital Zurich. Desthiobiotin labeling of a synthetic 25-nucleotide RNA oligo, which contains an adenine-rich element (ARE) motif, allows specific binding of cytosolic ARE-binding protein.

Video: Desthiobiotin-Streptavidin-Affinity Mediated Purification of RNA-Interacting Proteins in Mesothelioma Cells

Novel RNA-Binding Proteins Isolation by the RaPID Methodology

RNA-binding proteins (RBPs) play important roles in every aspect of RNA metabolism and regulation. Their identification is a major challenge in modern biology. Only a few in vitro and in vivo methods enable the identification of RBPs associated with a particular target mRNA. However, their main limitations are the identification of RBPs in a non-cellular environment (in vitro) or the low efficiency isolation of RNA of interest (in vivo). An RNA-binding protein purification and identification (RaPID) methodology was designed to overcome these limitations in yeast and enable efficient isolation of proteins that are associated in vivo. To achieve this, the RNA of interest is tagged with MS2 loops, and co-expressed with a fusion protein of an MS2-binding protein and a streptavidin-binding protein (SBP). Cells are then subjected to crosslinking and lysed, and complexes are isolated through streptavidin beads. The proteins that co-purify with the tagged RNA can then be determined by mass spectrometry. We recently used this protocol to identify novel proteins associated with the ER-associated PMP1 mRNA. Here, we provide a detailed protocol of RaPID, and discuss some of its limitations and advantages.

RNA-protein interactions lie at the heart of many cellular processes. Here, we describe an in vivo method to isolate specific RNA and identify novel proteins that are associated with it. This could shed new light on how RNAs are regulated in the cell.

RNA-binding proteins (RBPs) play important roles in every aspect of RNA metabolism and regulation. Their identification is a major challenge in modern ...

Genetics

Biotin-based Pulldown Assay to Validate mRNA Targets of Cellular miRNAs

MicroRNAs (miRNAs) are a class of small noncoding RNAs that post-transcriptionally regulate cellular gene expression. MiRNAs bind to the 3&#39; untranslated region (UTR) of target mRNA to inhibit protein translation or in some instances cause mRNA degradation. The binding of the miRNA to the 3&#39; UTR of the target mRNA is mediated by a 2&#8211;8 nucleotide seed sequence at the 5&#39; end of miRNA. While the role of miRNAs as cellular regulatory molecules is well established, identification of the target mRNAs with functional relevance remains a challenge. Bioinformatic tools have been employed to predict sequences within the 3&#39; UTR of mRNAs as potential targets for miRNA binding. These tools have also been utilized to determine the evolutionary conservation of such sequences among related species in an attempt to predict functional role. However, these computational methods often generate false positive results and are limited to predicting canonical interaction between miRNA and mRNA. Therefore, experimental procedures that measure direct binding of miRNA to its mRNA target are necessary to establish functional interaction. In this report, we describe a sensitive method for validating direct interaction between the cellular miRNA miR-125b and the 3&#39; UTR of PARP-1 mRNA. We elaborate a protocol in which synthetic biotinylated-miRNA mimics were transfected into mammalian cells and the miRNA-mRNA complex in the cellular lysate was pulled down with streptavidin-coated magnetic beads. Finally, the target mRNA in the pulled-down nucleic acid complex was quantified using a qPCR-based strategy.

This report describes a fast and reliable method for validating mRNA targets of cellular miRNAs. The method uses synthetic biotinylated Locked Nucleic Acid (LNA)-based miRNA mimics to capture target mRNA. Subsequently, streptavidin-coated magnetic beads are employed to pulldown the target mRNA for quantification by qPCR polymerase chain reaction.

MicroRNAs (miRNAs) are a class of small noncoding RNAs that post-transcriptionally regulate cellular gene expression. MiRNAs bind to the 3&#39; ...

An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes

RNA-binding proteins (RBPs) play key roles in the post-transcriptional control of gene expression. Therefore, biochemical characterization of mRNA-protein complexes is essential to understanding mRNA regulation inferred by interacting proteins or non-coding RNAs. Herein, we describe a tandem RNA isolation procedure (TRIP) that enables the purification of endogenously formed mRNA-protein complexes from cellular extracts. The two-step protocol involves the isolation of polyadenylated mRNAs with antisense oligo(dT) beads and subsequent capture of an mRNA of interest with 3&#39;-biotinylated 2&#39;-O-methylated antisense RNA oligonucleotides, which can then be isolated with streptavidin beads. TRIP was used to recover in vivo crosslinked mRNA-ribonucleoprotein (mRNP) complexes from yeast, nematodes and human cells for further RNA and protein analysis. Thus, TRIP is a versatile approach that can be adapted to all types of polyadenylated RNAs across organisms to study the dynamic re-arrangement of mRNPs imposed by intracellular or environmental cues.

A tandem RNA isolation procedure (TRIP) for recovery of endogenously formed mRNA-protein complexes is described. Specifically, RNA-protein complexes are crosslinked in vivo, polyadenylated RNAs are isolated from extracts with oligo(dT) beads, and particular mRNAs are captured with modified RNA antisense oligonucleotides. Proteins bound to mRNAs are detected by immunoblot analysis.

RNA-binding proteins (RBPs) play key roles in the post-transcriptional control of gene expression. Therefore, biochemical characterization of mRNA-protein ...

Biochemistry

In Vitro Biochemical Assays using Biotin Labels to Study Protein-Nucleic Acid Interactions

Protein-nucleic acid interactions play important roles in biological processes such as transcription, recombination, and RNA metabolism. Experimental methods to study protein-nucleic acid interactions require the use of fluorescent tags, radioactive isotopes, or other labels to detect and analyze specific target molecules. Biotin, a non-radioactive nucleic acid label, is commonly used in electrophoretic mobility shift assays (EMSA) but has not been regularly employed to monitor protein activity during nucleic acid processes. This protocol illustrates the utility of biotin labeling during in vitro enzymatic reactions, demonstrating that this label works well with a range of different biochemical assays. Specifically, in alignment with previous findings using radioisotope 32P-labeled substrates, it is confirmed via biotin-labeled EMSA that MEIOB (a protein specifically involved in the meiotic recombination) is a DNA-binding protein, that MOV10 (an RNA helicase) resolves biotin-labeled RNA duplex structures, and that MEIOB cleaves biotin-labeled single-stranded DNA. This study demonstrates that biotin is capable of substituting 32P in various nucleic acid-related biochemical assays in vitro.&#160;

Presented here are protocols for in vitro biochemical assays using biotin labels that may be widely&#160;applicable for studying protein-nucleic acid interactions.

Protein-nucleic acid interactions play important roles in biological processes such as transcription, recombination, and RNA metabolism. Experimental ...

Single-step Purification of Macromolecular Complexes Using RNA Attached to Biotin and a Photo-cleavable Linker

For many years, the exceptionally strong and rapidly formed interaction between biotin and streptavidin has been successfully utilized for partial purification of biologically important RNA/protein complexes. However, this strategy suffers from one major disadvantage that limits its broader utilization: the biotin/streptavidin interaction can be broken only under denaturing conditions that also disrupt the integrity of the eluted complexes, hence precluding their subsequent functional analysis and/or further purification by other methods. In addition, the eluted samples are frequently contaminated with the background proteins that nonspecifically associate with streptavidin beads, complicating the analysis of the purified complexes by silver staining and mass spectrometry. To overcome these limitations, we developed a variant of the biotin/streptavidin strategy in which biotin is attached to an RNA substrate via a photo-cleavable linker and the complexes immobilized on streptavidin beads are selectively eluted to solution in a native form by long wave UV, leaving the background proteins on the beads. Shorter RNA binding substrates can be synthesized chemically with biotin and the photo-cleavable linker covalently attached to the 5&#39; end of the RNA, whereas longer RNA substrates can be provided with the two groups by a complementary oligonucleotide. These two variants of the UV-elution method were tested for purification of the U7 snRNP-dependent processing complexes that cleave histone pre-mRNAs at the 3&#39; end and they both proved to compare favorably to other previously developed purification methods. The UV-eluted samples contained readily detectable amounts of the U7 snRNP that was free of major protein contaminants and suitable for direct analysis by mass spectrometry and functional assays. The described method can be readily adapted for purification of other RNA binding complexes and used in conjunction with single- and double-stranded DNA binding sites to purify DNA-specific proteins and macromolecular complexes.

RNA/protein complexes purified using botin-streptavidin strategy are eluted to solution under denaturing conditions in a form unsuitable for further purification and functional analysis. Here, we describe a modification of this strategy that utilizes a photo-cleavable linker in RNA and a gentle UV-elution step, yielding native and fully functional RNA/protein complexes.

For many years, the exceptionally strong and rapidly formed interaction between biotin and streptavidin has been successfully utilized for partial ...

Transcriptome-Wide Profiling of Protein-RNA Interactions by Cross-Linking and Immunoprecipitation Mediated by FLAG-Biotin Tandem Purification

RNA and RNA-binding proteins (RBPs) control multiple biological processes. The spatial and temporal arrangement of RNAs and RBPs underlies the delicate regulation of these processes. A strategy called CLIP-seq (cross-linking and immunoprecipitation) has been developed to capture endogenous protein-RNA interactions with UV cross-linking followed by immunoprecipitation. Despite the wide use of conventional CLIP-seq method in RBP study, the CLIP method is limited by the availability of high-quality antibodies, potential contaminants from the copurified RBPs, requirement of isotope manipulation, and potential loss of information during a tedious experimental procedure. Here we describe a modified CLIP-seq method called FbioCLIP-seq using the FLAG-biotin tag tandem purification. Through tandem purification and stringent wash conditions, almost all the interacting RNA-binding proteins are removed. Thus, the RNAs interacting indirectly mediated by these copurified RBPs are also reduced. Our FbioCLIP-seq method allows efficient detection of direct protein-bound RNAs without SDS-PAGE and membrane transfer procedures in an isotope-free and protein-specific antibody-free manner.

Here we present a modified CLIP-seq protocol called FbioCLIP-seq with FLAG-biotin tandem purification to determine the RNA targets of RNA-binding proteins (RBPs) in mammalian cells.

RNA and RNA-binding proteins (RBPs) control multiple biological processes. The spatial and temporal arrangement of RNAs and RBPs underlies the delicate ...

An Optimized Quantitative Pull-Down Analysis of RNA-Binding Proteins Using Short Biotinylated RNA

Protein-RNA interactions regulate gene expression and cellular functions at transcriptional and post-transcriptional levels. For this reason, identifying the binding partners of an RNA of interest remains of high importance to unveil the mechanisms behind many cellular processes. However, RNA molecules might interact transiently and dynamically with some RNA-binding proteins (RBPs), especially with non-canonical ones. Hence, improved methods to isolate and identify such RBPs are greatly needed.
To identify the protein partners of a known RNA sequence efficiently and quantitatively, we developed a method based on the pull-down and characterization of all interacting proteins, starting from cellular total protein extract. We optimized the protein pull-down using biotinylated RNA pre-loaded on streptavidin-coated beads. As a proof of concept, we employed a short RNA sequence known to bind the neurodegeneration-associated protein TDP-43 and a negative control of a different nucleotide composition but the same length. After blocking the beads with yeast tRNA, we loaded the biotinylated RNA sequences on the streptavidin beads and incubated them with the total protein extract from HEK 293T cells. After incubation and several washing steps to remove nonspecific binders, we eluted the interacting proteins with a high-salt solution, compatible with the most commonly used protein quantification reagents and with sample preparation for mass spectrometry. We quantified the enrichment of TDP-43 in the pull-down performed with the known RNA binder compared to the negative control by mass spectrometry. We used the same technique to verify the selective interactions of other proteins computationally predicted to be unique binders of our RNA of interest or of the control. Finally, we validated the protocol by western blot via the detection of TDP-43 with an appropriate antibody. 
This protocol will allow the study of the protein partners of an RNA of interest in near-to-physiological conditions, helping uncover unique and unpredicted protein-RNA interactions.

Here, we present an optimized in vitro method to uncover, quantify, and validate protein interactors of specific RNA sequences, using total protein extract from human cells, streptavidin beads coated with biotinylated RNA, and mass spectrometry analysis.

Protein-RNA interactions regulate gene expression and cellular functions at transcriptional and post-transcriptional levels. For this reason, identifying ...

Orthotopic Implantation and Peripheral Immune Cell Monitoring in the II-45 Syngeneic Rat Mesothelioma Model

The enormous upsurge of interest in immune-based treatments for cancer such as vaccines and immune checkpoint inhibitors, and increased understanding of the role of the tumor microenvironment in treatment response, collectively point to the need for immune-competent orthotopic models for pre-clinical testing of these new therapies. This paper demonstrates how to establish an orthotopic immune-competent rat model of pleural malignant mesothelioma. Monitoring disease progression in orthotopic models is confounded by the internal location of the tumors. To longitudinally monitor disease progression and its effect on circulating immune cells in this and other rat models of cancer, a single tube flow cytometry assay requiring only 25 &#181;l whole blood is described. This provides accurate quantification of seven immune parameters: total lymphocytes, monocytes and neutrophils, as well as the T-cell subsets CD4 and CD8, B-cells and Natural Killer cells. Different subsets of these parameters are useful in different circumstances and models, with the neutrophil to lymphocyte ratio having the greatest utility for monitoring disease progression in the mesothelioma model. Analyzing circulating immune cell levels using this single tube method may also assist in monitoring the response to immune-based treatments and understanding the underlying mechanisms leading to success or failure of treatment.

The generation of an orthotopic rat model of pleural malignant mesothelioma by implantation of II-45 mesothelioma cells into the pleural cavity of immune competent rats is presented. A flow cytometric method to analyze seven immune cell subsets in these animals from a 25 &#181;l&#160;blood sample is also described.

The enormous upsurge of interest in immune-based treatments for cancer such as vaccines and immune checkpoint inhibitors, and increased understanding of ...

Medicine

Isolation of Translating Ribosomes Containing Peptidyl-tRNAs for Functional and Structural Analyses

Recently, structural and biochemical studies have detailed many of the molecular events that occur in the ribosome during inhibition of protein synthesis by antibiotics and during nascent polypeptide synthesis. Some of these antibiotics, and regulatory nascent polypeptides mostly in the form of peptidyl-tRNAs, inhibit either peptide bond formation or translation termination1-7. These inhibitory events can stop the movement of the ribosome, a phenomenon termed "translational arrest". Translation arrest induced by either an antibiotic or a nascent polypeptide has been shown to regulate the expression of genes involved in diverse cellular functions such as cell growth, antibiotic resistance, protein translocation and cell metabolism8-13. Knowledge of how antibiotics and regulatory nascent polypeptides alter ribosome function is essential if we are to understand the complete role of the ribosome in translation, in every organism.
Here, we describe a simple methodology that can be used to purify, exclusively, for analysis, those ribosomes translating a specific mRNA and containing a specific peptidyl-tRNA14. This procedure is based on selective isolation of translating ribosomes bound to a biotin-labeled mRNA. These translational complexes are separated from other ribosomes in the same mixture, using streptavidin paramagnetic beads (SMB) and a magnetic field (MF). Biotin-labeled mRNAs are synthesized by run-off transcription assays using as templates PCR-generated DNA fragments that contain T7 transcriptional promoters. T7 RNA polymerase incorporates biotin-16-UMP from biotin-UTP; under our conditions approximately ten biotin-16-UMP molecules are incorporated in a 600 nt mRNA with a 25% UMP content. These biotin-labeled mRNAs are then isolated, and used in in vitro translation assays performed with release factor 2 (RF2)-depleted cell-free extracts obtained from Escherichia coli strains containing wild type or mutant ribosomes. Ribosomes translating the biotin-labeled mRNA sequences are stalled at the stop codon region, due to the absence of the RF2 protein, which normally accomplishes translation termination. Stalled ribosomes containing the newly synthesized peptidyl-tRNA are isolated and removed from the translation reactions using SMB and an MF. These beads only bind biotin-containing messages.
The isolated, translational complexes, can be used to analyze the structural and functional features of wild type or mutant ribosomal components, or peptidyl-tRNA sequences, as well as determining ribosome interaction with antibiotics or other molecular factors 1,14-16. To examine the function of these isolated ribosome complexes, peptidyl-transferase assays can be performed in the presence of the antibiotic puromycin1. To study structural changes in translational complexes, well established procedures can be used, such as i) crosslinking to specific amino acids14 and/or ii) alkylation protection assays1,14,17.

A major impediment to biochemical analyses of ribosomes containing nascent peptidyl-tRNAs has been the presence of other ribosomes in the same samples, ribosomes not involved in the translation of the specific mRNA sequence being analyzed. We developed a simple methodology to purify, exclusively, the ribosomes containing the nascent peptidyl-tRNA of interest.

Recently, structural and biochemical studies have detailed many of the molecular events that occur in the ribosome during inhibition of protein synthesis ...

Biology

Quantitative Analysis of RPA-ssDNA Binding Kinetics Using Label-Free Methods

Analyzing DNA-Protein Interactions with Streptavidin-Based Biolayer Interferometry

Protein-DNA interactions underpin essential cellular processes. Understanding these interactions is critical for elucidating the molecular mechanisms of various pathways. Key factors such as the structure, sequence, and length of a DNA molecule can significantly influence protein binding. Bio-layer interferometry (BLI) is a label-free technique that measures binding kinetics between molecules, offering a straightforward and precise approach to quantitatively study protein-DNA interactions. A major advantage of BLI over traditional gel-based methods is its ability to provide real-time data on binding kinetics, enabling accurate measurement of the equilibrium dissociation constant (KD) for dynamic protein-DNA interactions. This article presents a basic protocol for determining the KD value of the interaction between a DNA replication protein, replication protein A (RPA), and a single-stranded DNA (ssDNA) substrate. RPA binds ssDNA with high affinity but must also be easily displaced to facilitate subsequent protein interactions within biological pathways. In the described BLI assay, biotinylated ssDNA is immobilized on a streptavidin-coated biosensor. The binding kinetics (association and dissociation) of RPA to the biosensor-bound DNA are then measured. The resulting data are analyzed to derive precise values for the association rate constant (ka), dissociation rate constant (kd), and equilibrium binding constant (KD) using system software.

This article describes a protocol for studying DNA-protein interactions using a streptavidin-based biolayer interferometry (BLI) system. It outlines the essential steps and considerations for utilizing either basic or advanced binding kinetics to determine the equilibrium binding affinity (KD) of the interaction.

Protein-DNA interactions underpin essential cellular processes. Understanding these interactions is critical for elucidating the molecular mechanisms of ...