The authors thank Dr. Qin Yu from AstraZeneca R&#38;D Boston, MA, USA, for providing the AZD4316 drug. The authors are grateful to the Cymages platform for access to the ScanR Olympus microscope, which was supported by grants from the region Ile-de-France (DIM ONE HEALTH). The authors acknowledge support from the INSERM and the Versailles Saint-Quentin University.

1. Material Preparation
<ol>
	<li>Purchase cell media (reduced serum media, minimum essential media [MEM], 10x MEM, and Dulbecco&#8217;s modified Eagle&#8217;s medium [DMEM]), transfection reagent, and microcrystalline cellulose (see Table of Materials).</li>
	<li>Obtain the following vectors for reverse genetics: the genomic vector(s) and the expression vectors encoding the N protein and the polymerase complex proteins. The genomic vectors contain the full cDNA genome of RSV-GFP (p-RSV-GFP) and of RSV...

<ol>
	<li>Shi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global,+regional,+and+national+disease+burden+estimates+of+acute+lower+respiratory+infections+due+to+respiratory+syncytial+virus+in+young+children+in+2015:+a+systematic+review+and+modelling+study.">Global, regional, and national disease burden estimates of acute lower respiratory infections due to respiratory syncytial virus in young children in 2015: a systematic review and modelling study.</a> The Lancet. 390 (10098), 946-958 (2017).</li><li>Falsey, A. R., Hennessey, P. A., Formica, M. A., Cox, C., Walsh, E. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Respiratory+Syncytial+Virus+Infection+in+Elderly+and+High-Risk+Adults.">Respiratory Syncytial Virus Infection in Elderly and High-Risk Adults.</a> The New England Journal of Medicine. 352 (17), 1749-1759 (2005).</li><li>DeVincenzo, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activity+of+Oral+ALS-008176+in+a+Respiratory+Syncytial+Virus+Challenge+Study.">Activity of Oral ALS-008176 in a Respiratory Syncytial Virus Challenge Study.</a> The New England Journal of Medicine. 373 (21), 2048-2058 (2015).</li><li>DeVincenzo, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oral+GS-5806+Activity+in+a+Respiratory+Syncytial+Virus+Challenge+Study.">Oral GS-5806 Activity in a Respiratory Syncytial Virus Challenge Study.</a> The New England Journal of Medicine. 371 (8), 711-722 (2014).</li><li>Afonso, C. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Taxonomy+of+the+order+Mononegavirales:+update+2016.">Taxonomy of the order Mononegavirales: update 2016.</a> Archives of Virology. 161 (8), 2351-2360 (2016).</li><li>Collins, P. L., Hill, M. G., Cristina, J., Grosfeld, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+elongation+factor+of+respiratory+syncytial+virus,+a+nonsegmented+negative-strand+RNA+virus.">Transcription elongation factor of respiratory syncytial virus, a nonsegmented negative-strand RNA virus.</a> Proceedings of the National Academy of Sciences of the United States of America. 93 (1), 81-85 (1996).</li><li>Hoenen, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inclusion+bodies+are+a+site+of+ebolavirus+replication.">Inclusion bodies are a site of ebolavirus replication.</a> Journal of Virology. 86 (21), 11779-11788 (2012).</li><li>Heinrich, B. S., Cureton, D. K., Rahmeh, A. A., Whelan, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+expression+redirects+vesicular+stomatitis+virus+RNA+synthesis+to+cytoplasmic+inclusions.">Protein expression redirects vesicular stomatitis virus RNA synthesis to cytoplasmic inclusions.</a> PLoS Pathogens. 6 (6), e1000958 (2010).</li><li>Lahaye, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+Characterization+of+Negri+Bodies+(NBs)+in+Rabies+Virus-Infected+Cells:+Evidence+that+NBs+Are+Sites+of+Viral+Transcription+and+Replication.">Functional Characterization of Negri Bodies (NBs) in Rabies Virus-Infected Cells: Evidence that NBs Are Sites of Viral Transcription and Replication.</a> Journal of Virology. 83 (16), 7948-7958 (2009).</li><li>Kolesnikova, L., M&#252;hlberger, E., Ryabchikova, E., Becker, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrastructural+organization+of+recombinant+Marburg+virus+nucleoprotein:+comparison+with+Marburg+virus+inclusions.">Ultrastructural organization of recombinant Marburg virus nucleoprotein: comparison with Marburg virus inclusions.</a> Journal of Virology. 74 (8), 3899-3904 (2000).</li><li>Dolnik, O., Stevermann, L., Kolesnikova, L., Becker, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Marburg+virus+inclusions:+A+virus-induced+microcompartment+and+interface+to+multivesicular+bodies+and+the+late+endosomal+compartment.">Marburg virus inclusions: A virus-induced microcompartment and interface to multivesicular bodies and the late endosomal compartment.</a> European Journal of Cell Biology. 94 (7-9), 323-331 (2015).</li><li>Rincheval, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+organization+of+cytoplasmic+inclusion+bodies+in+cells+infected+by+respiratory+syncytial+virus.">Functional organization of cytoplasmic inclusion bodies in cells infected by respiratory syncytial virus.</a> Nature Communications. 8 (1), 563 (2017).</li><li>Santangelo, P. J., Bao, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+filamentous+viral+RNPs+prior+to+egress.">Dynamics of filamentous viral RNPs prior to egress.</a> Nucleic Acids Research. 35 (11), 3602-3611 (2007).</li><li>Lifland, A. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+Respiratory+Syncytial+Virus+Nucleoprotein+and+Inclusion+Bodies+Antagonize+the+Innate+Immune+Response+Mediated+by+MDA5+and+MAVS.">Human Respiratory Syncytial Virus Nucleoprotein and Inclusion Bodies Antagonize the Innate Immune Response Mediated by MDA5 and MAVS.</a> Journal of Virology. 86 (15), 8245-8258 (2012).</li><li>Garcia, J., Garcia-Barreno, B., Vivo, A., Melero, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytoplasmic+inclusions+of+respiratory+syncytial+virus-infected+cells:+formation+of+inclusion+bodies+in+transfected+cells+that+coexpress+the+nucleoprotein,+the+phosphoprotein,+and+the+22K+protein.">Cytoplasmic inclusions of respiratory syncytial virus-infected cells: formation of inclusion bodies in transfected cells that coexpress the nucleoprotein, the phosphoprotein, and the 22K protein.</a> Virology. 195 (1), 243-247 (1993).</li><li>Brown, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+an+association+between+heat+shock+protein+70+and+the+respiratory+syncytial+virus+polymerase+complex+within+lipid-raft+membranes+during+virus+infection.">Evidence for an association between heat shock protein 70 and the respiratory syncytial virus polymerase complex within lipid-raft membranes during virus infection.</a> Virology. 338 (1), 69-80 (2005).</li><li>Radhakrishnan, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+analysis+of+purified+respiratory+syncytial+virus+particles+reveals+an+important+role+for+heat+shock+protein+90+in+virus+particle+assembly.">Protein analysis of purified respiratory syncytial virus particles reveals an important role for heat shock protein 90 in virus particle assembly.</a> Molecular &amp; Cellular Proteomics. 9 (9), 1829-1848 (2010).</li><li>Racaniello, V. R., Baltimore, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloned+poliovirus+complementary+DNA+is+infectious+in+mammalian+cells.">Cloned poliovirus complementary DNA is infectious in mammalian cells.</a> Science. 214 (4523), 916-919 (1981).</li><li>Schnell, M. J., Mebatsion, T., Conzelmann, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Infectious+rabies+viruses+from+cloned+cDNA.">Infectious rabies viruses from cloned cDNA.</a> The EMBO Journal. 13 (18), 4195-4203 (1994).</li><li>Collins, P. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+infectious+human+respiratory+syncytial+virus+from+cloned+cDNA+confirms+an+essential+role+for+the+transcription+elongation+factor+from+the+5'+proximal+open+reading+frame+of+the+M2+mRNA+in+gene+expression+and+provides+a+capability+for+vaccine.">Production of infectious human respiratory syncytial virus from cloned cDNA confirms an essential role for the transcription elongation factor from the 5' proximal open reading frame of the M2 mRNA in gene expression and provides a capability for vaccine.</a> Proceedings of the National Academy of Sciences of the United States of America. 92 (25), 11563-11567 (1995).</li><li>Rameix-Welti, M. -. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualizing+the+replication+of+respiratory+syncytial+virus+in+cells+and+in+living+mice.">Visualizing the replication of respiratory syncytial virus in cells and in living mice.</a> Nature Communications. 5, 5104 (2014).</li><li>Buchholz, U. J., Finke, S., Conzelmann, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+bovine+respiratory+syncytial+virus+(BRSV)+from+cDNA:+BRSV+NS2+is+not+essential+for+virus+replication+in+tissue+culture,+and+the+human+RSV+leader+region+acts+as+a+functional+BRSV+genome+promoter.">Generation of bovine respiratory syncytial virus (BRSV) from cDNA: BRSV NS2 is not essential for virus replication in tissue culture, and the human RSV leader region acts as a functional BRSV genome promoter.</a> Journal of Virology. 73 (1), 251-259 (1999).</li><li>Cianci, C., Meanwell, N., Krystal, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antiviral+activity+and+molecular+mechanism+of+an+orally+active+respiratory+syncytial+virus+fusion+inhibitor.">Antiviral activity and molecular mechanism of an orally active respiratory syncytial virus fusion inhibitor.</a> Journal of Antimicrobial Chemotherapy. 55 (3), 289-292 (2005).</li><li>Derscheid, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+respiratory+syncytial+virus+memphis+37+grown+in+HEp-2+cells+causes+more+severe+disease+in+lambs+than+virus+grown+in+vero+cells.">Human respiratory syncytial virus memphis 37 grown in HEp-2 cells causes more severe disease in lambs than virus grown in vero cells.</a> Viruses. 5 (11), 2881-2897 (2013).</li><li>McKimm-Breschkin, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simplified+plaque+assay+for+respiratory+syncytial+virus+-+direct+visualization+of+plaques+without+immunostaining.">A simplified plaque assay for respiratory syncytial virus - direct visualization of plaques without immunostaining.</a> Journal of Virological Methods. 120, 113-117 (2004).</li><li>Matrosovich, M., Matrosovich, T., Garten, W., Klenk, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+low-viscosity+overlay+medium+for+viral+plaque+assays.">New low-viscosity overlay medium for viral plaque assays.</a> Virology Journal. 7, 1-7 (2006).</li><li>Novina, C. D., Sharp, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+RNAi+revolution.">The RNAi revolution.</a> Nature. 430 (6996), 161-164 (2004).</li><li>Sintchak, M. D., Nimmesgern, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+structure+of+inosine+5'-monophosphate+dehydrogenase+and+the+design+of+novel+inhibitors.">The structure of inosine 5'-monophosphate dehydrogenase and the design of novel inhibitors.</a> Immunopharmacology. 47 (2-3), 163-184 (2000).</li><li>Beaucourt, S., Vignuzzi, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribavirin:+A+drug+active+against+many+viruses+with+multiple+effects+on+virus+replication+and+propagation.+Molecular+basis+of+ribavirin+resistance.">Ribavirin: A drug active against many viruses with multiple effects on virus replication and propagation. Molecular basis of ribavirin resistance.</a> Current Opinion in Virology. 8, 10-15 (2014).</li><li>Hruska, J. F., Bernstein, J. M., Douglas, R. G., Hall, C. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+Ribavirin+on+Respiratory+Syncytial+Virus+in+vitro.">Effects of Ribavirin on Respiratory Syncytial Virus in vitro.</a> Antimicrobial Agents and Chemotherapy. 17 (5), 770-775 (1980).</li><li>Sim&#245;es, E. A. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Past,+Present+and+Future+Approaches+to+the+Prevention+and+Treatment+of+Respiratory+Syncytial+Virus+Infection+in+Children.">Past, Present and Future Approaches to the Prevention and Treatment of Respiratory Syncytial Virus Infection in Children.</a> Infectious Diseases and Therapy. 7 (1), 87-120 (2018).</li><li>Alvarez, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference-mediated+silencing+of+the+respiratory+syncytial+virus+nucleocapsid+defines+a+potent+antiviral+strategy.">RNA interference-mediated silencing of the respiratory syncytial virus nucleocapsid defines a potent antiviral strategy.</a> Antimicrobial Agents and Chemotherapy. 53 (9), 3952-3962 (2009).</li><li>DeVincenzo, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+randomized,+double-blind,+placebo-comtrolled+study+of+an+RNAi-based+therapy+directed+against+respiratory+syncytial+virus.">A randomized, double-blind, placebo-comtrolled study of an RNAi-based therapy directed against respiratory syncytial virus.</a> Proceedings of the National Academy of Sciences of the United States of America. 107 (19), 8800-8805 (2010).</li><li>Zhou, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+screening+of+a+CRISPR/Cas9+library+for+functional+genomics+in+human+cells.">High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells.</a> Nature. 509 (7501), 487-491 (2014).</li><li>Nikolic, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Negri+bodies+are+viral+factories+with+properties+of+liquid+organelles.">Negri bodies are viral factories with properties of liquid organelles.</a> Nature Communications. 8 (1), 58 (2017).</li></ol>

Here we present a method of rescue of recombinant RSVs from five plasmids, and their amplification. The ability to manipulate the genome of viruses has revolutionized virology research to test mutations and express an additional gene or a tagged viral protein. The RSV we have described and used as an example in this article is a virus expressing a reporter gene, the RSV-GFP (unpublished), and expresses an M2-1 protein fused to a GFP tag12. RSV rescue is challenging and requires practice. The trans...

Human RSV is the leading cause of hospitalization for acute respiratory tract infection in infants worldwide1. In addition, RSV is associated with a substantial disease burden in adults comparable to influenza, with most of the hospitalization and mortality burden in the elderly2. There are no vaccines or specific antivirals available yet against RSV, but promising new drugs are in development3,4. The complexity and the heaviness of the techniques of quantification of RSV multiplication impede the search for antivirals or vaccines despite current considerable efforts. The quantification of RSV multiplication in vitro is generally based on laborious, time-consuming, and expensive methods, which consist mostly in the analysis of the cytopathic effect by microscopy, immunostaining, plaque reduction assays, quantitative reverse transcriptase (qRT)-polymerase chain reaction (PCR), and enzyme-linked immunosorbent assay tests. Viruses with modified genomes and expressing reporter genes, such as those coding for the GFP, are more suitable for such screenings. Coupled to the use of automated plate readers, reporter gene-carrying recombinant viruses can make these assays more suitable for standardization and high-throughput purposes.
RSV is an enveloped, nonsegmented negative-sense RNA virus that belongs to the Orthopneumovirus genus of the Pneumoviridae family, order Mononegavirales5. The RSV genome is a single-strand, negative-sense RNA of about 15 kb, which contains a noncoding region at the 3&#39; and 5&#39; extremities called Leader and Trailer and 10 transcriptional units encoding 11 proteins. The genes are ordered as follows: 3&#39;-NS1, NS2, N, P, M, SH, G, F, M2 (encoding for M2-1 and M2-2 proteins) and L-5&#39;. The genomic RNA is tightly packaged by the nucleoprotein N. Using the encapsidated genomic RNA as a template, viral RNA-dependent RNA polymerase (RdRp) will ensure transcription and replication of the viral RNA. Viral RdRp is composed of the large protein L which carries the nucleotide polymerase activity per se, its mandatory cofactor the phosphoprotein P and the M2-1 protein which functions as a viral transcription factor6. In infected cells, RSV induces the formation of cytoplasmic inclusions called inclusion bodies (IBs). Morphologically similar cytoplasmic inclusions have been observed for several Mononegavirales7,8,9,10. Recent studies on rabies virus, vesicular stomatitis virus (VSV), Ebola virus, and RSV showed that viral RNA synthesis occurs in IBs, which can thus be regarded as viral factories8,9,11,12. The virus factories concentrate the RNA and viral proteins required for viral RNA synthesis and also contain cellular proteins13,14,15,16,17. IBs exhibit a functional subcompartment called IB-associated granules (IBAGs), which concentrate the newly synthetized nascent viral mRNA together with the M2-1 protein. The genomic RNA and the L, P, and N are not detected in IBAGs. IBAGs are small dynamic spherical structures inside IBs that exhibit the properties of liquid organelles12. Despite the central role of IBs in viral multiplication, very little is known about the nature, internal structure, formation, and operation of these viral factories.
The expression of the genome of a poliovirus from a cDNA enabled the production of the first infectious viral clone in 198118. For single-stranded negative RNA viruses, it was not until 1994 that the production of a first rabies virus following transfection of plasmids into cells19 took place. The first plasmid-based reverse genetic system for RSV was published in 199520. Reverse genetics have led to major advances in the field of virology. The possibility of introducing specific modifications into the viral genome has provided critical insights into the replication and pathogenesis of RNA viruses. This technology has also greatly facilitated the development of vaccines by allowing specific attenuation through targeted series of modifications. Genome modifications allowing a rapid quantification of viral multiplication greatly improved the antiviral screening and study of their mode of action.
Although previously described, obtaining genetically modified RSVs remains delicate. Here, we detail a protocol to create two types of recombinant HRSV, respectively expressing RSV-GFP or RSV-M2-1-GFP. In this protocol, we describe the transfection conditions needed to rescue the new recombinant viruses, as well as their amplification to obtain viral stocks with high titer, suitable for reproducible experimentations. The construction of the reverse genetics&#39; vectors per se is not described here. We do describe methods for the optimal harvesting and freezing of viral stocks. The most accurate method to quantify viral infectious particles remains plaque assay. Cells are infected with serial dilutions of the analyzed suspension and incubated with an overlay that prohibits the diffusion of free viral particles in the supernatant. In such conditions, the virus will only infect contiguous cells forming a &#34;plaque&#34; for each initial infectious particle. In the conventional RSV titration assay, plaques are revealed by immunostaining and counted under microscopic observation. This method is expensive and time-consuming. Here we described a very simple protocol for an RSV plaque assay using microcrystalline cellulose overlay that enables the formation of plaques visible to the naked eye. We show how RSV-GFP can be used to measure RSV replication and, thus, to quantify the impact of antivirals. Combining reverse genetics and live imaging technology, we demonstrate how RSV-M2-1-GFP allows scientists to visualize M2-1 in live cells and to follow the dynamics of intracellular viral structures, such as IBs.

<table>
	<tbody>
		<tr>
			<td>35mm &#181; dish for live cell imaging</td>
			<td>Ibidi</td>
			<td>81156</td>
			<td></td>
		</tr>
		<tr>
			<td>A549</td>
			<td>ATCC</td>
			<td>ATCC CCL-185</td>
			<td></td>
		</tr>
		<tr>
			<td>Avicel RC-591</td>
			<td>FMC BioPolymer</td>
			<td>Avicel RC-591</td>
			<td>Technical and other information on Avicels is available at http://www.fmcbiopolymer.com. Store at room temperature. Protocol in step 4 is optimized for this reagent.</td>
		</tr>
		<tr>
			<td>BSRT7/5</td>
			<td></td>
			<td>not commercially available</td>
			<td>See ref 22. Buchholz et al, 1999</td>
		</tr>
		<tr>
			<td>Crystal violet solution</td>
			<td>Sigma</td>
			<td>HT90132</td>
			<td></td>
		</tr>
		<tr>
			<td>Fluorescence microscope for observations</td>
			<td>Olympus</td>
			<td>IX73 Olympus microscope</td>
			<td></td>
		</tr>
		<tr>
			<td>Fluorescence microscope for videomicroscopy</td>
			<td>Olympus</td>
			<td>ScanR Olympus microscope</td>
			<td></td>
		</tr>
		<tr>
			<td>HEp-2</td>
			<td>ATCC</td>
			<td>ATCC CCL-23</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES &#8805;99.5%</td>
			<td>Sigma</td>
			<td>H3375</td>
			<td></td>
		</tr>
		<tr>
			<td>L-Glutamine (200 mM)</td>
			<td>ThermoFisher Scientific</td>
			<td>25030024</td>
			<td></td>
		</tr>
		<tr>
			<td>LIPOFECTAMINE 2000 REAGENT</td>
			<td>ThermoFisher Scientific</td>
			<td>11668019</td>
			<td>Protocol in step 2.3. is optimized for this reagent.</td>
		</tr>
		<tr>
			<td>MEM (10X), no glutamine</td>
			<td>ThermoFisher Scientific</td>
			<td>11430030</td>
			<td></td>
		</tr>
		<tr>
			<td>MEM, GlutaMAX Supplement</td>
			<td>ThermoFisher Scientific</td>
			<td>41090-028</td>
			<td></td>
		</tr>
		<tr>
			<td>MgSO4 ReagentPlus, &#8805;99.5%</td>
			<td>Sigma</td>
			<td>M7506</td>
			<td></td>
		</tr>
		<tr>
			<td>Opti-MEM I Reduced Serum Medium</td>
			<td>ThermoFisher Scientific</td>
			<td>51985-026</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraformaldehyde Aqueous Solution, 32%, EM Grade</td>
			<td>Electron Microscopy Sciences</td>
			<td>15714</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin (10,000 U/mL)</td>
			<td>ThermoFisher Scientific</td>
			<td>15140122</td>
			<td></td>
		</tr>
		<tr>
			<td>Plasmids</td>
			<td></td>
			<td>not commercially available</td>
			<td>see ref 21. Rameix-Welti et al, 2014</td>
		</tr>
		<tr>
			<td>See Saw Rocker</td>
			<td>VWR</td>
			<td>444-0341</td>
			<td></td>
		</tr>
		<tr>
			<td>Si RNA GAPDH</td>
			<td>Dharmacon</td>
			<td>ON-TARGETplus siRNA 
			D-001810-10-05</td>
			<td>SMARTpool and 3 of 4 individual siRNAs designed by Dharmacon.</td>
		</tr>
		<tr>
			<td>Si RNA IMPDH2</td>
			<td>Dharmacon</td>
			<td>ON-TARGETplus siRNA IMPDH2 Pool- Human 
			L-004330-00-0005</td>
			<td>SMARTpool of 4 individual siRNAs designed by Dharmacon. 
			Individual references and sequences 
			J-004330-06: GGAAAGUUGCCCAUUGUAA; 
			J-004330-07: GCACGGCGCUUUGGUGUUC; 
			J-004330-08: AAGGGUCAAUCCACAAAUU; 
			J-004330-09: GGUAUGGGUUCUCUCGAUG;</td>
		</tr>
		<tr>
			<td>Si RNA RSV N</td>
			<td>Dharmacon</td>
			<td>ON-TARGETplus custom siRNA</td>
			<td>UUCAGAAGAACUAGAGGCUAU and UUUCAUAAAUUCACUGGGUUA</td>
		</tr>
		<tr>
			<td>SiRNA NT</td>
			<td>Dharmacon</td>
			<td>ON-TARGETplus Non-targeting Pool</td>
			<td></td>
		</tr>
		<tr>
			<td>SiRNA transfection reagent</td>
			<td>Dharmacon</td>
			<td>DharmaFECT 1 Ref: T-2001-03</td>
			<td>Protocol in steps 5.1.and 5.1.2 are optimized for this reagent.</td>
		</tr>
		<tr>
			<td>Sodium Bicarbonate 7.5% solution</td>
			<td>ThermoFisher Scientific</td>
			<td>25080094</td>
			<td></td>
		</tr>
		<tr>
			<td>Spectrofluorometer</td>
			<td>Tecan</td>
			<td>Tecan infinite M200PRO</td>
			<td></td>
		</tr>
	</tbody>
</table>

generation, amplification, and titration of recombinant respiratory syncytial viruses

The use of recombinant viruses has become crucial in basic or applied virology. Reverse genetics has been proven to be an extremely powerful technology, both to decipher viral replication mechanisms and to study antivirals or provide development platform for vaccines. The construction and manipulation of a reverse genetic system for a negative-strand RNA virus such as a respiratory syncytial virus (RSV), however, remains delicate and requires special know-how. The RSV genome is a single-strand, negative-sense RNA of about 15 kb that serves as a template for both viral RNA replication and transcription. Our reverse genetics system uses a cDNA copy of the human RSV long strain genome (HRSV). This cDNA, as well as cDNAs encoding viral proteins of the polymerase complex (L, P, N, and M2-1), are placed in individual expression vectors under T7 polymerase control sequences. The transfection of these elements in BSR-T7/5 cells, which stably express T7 polymerase, allows the cytoplasmic replication and transcription of the recombinant RSV, giving rise to genetically modified virions. A new RSV, which is present at the cell surface and in the culture supernatant of BSRT7/5, is gathered to infect human HEp-2 cells for viral amplification. Two or three rounds of amplification are needed to obtain viral stocks containing 1 x 106 to 1 x 107 plaque-forming units (PFU)/mL. Methods for the optimal harvesting, freezing, and titration of viral stocks are described here in detail. We illustrate the protocol presented here by creating two recombinant viruses respectively expressing free green fluorescent protein (GFP) (RSV-GFP) or viral M2-1 fused to GFP (RSV-M2-1-GFP). We show how to use RSV-GFP to quantify RSV replication and the RSV-M2-1-GFP to visualize viral structures, as well as viral protein dynamics in live cells, by using video microscopy techniques.

In this work, we described a detailed protocol to produce recombinant RSV viruses expressing a fluorescent protein (Figure 2). In pRSV-GFP, the GFP gene was introduced between the P and M genes, as described for the Cherry gene in previously published work21. In the pRSV-M2-1-GFP, the M2 gene was left untouched and an additional gene coding for M2-1-GFP was inserted between SH and G genes12. The first step, corr...

Watch this Scientific Journal Video about Generation, Amplification, and Titration of Recombinant Respiratory Syncytial Viruses at JoVE.com

Generation, Amplification, and Titration of Recombinant Respiratory Syncytial Viruses

We describe a method for generating and amplifying genetically modified respiratory syncytial viruses (RSVs) and an optimized plaque assay for RSVs. We illustrate this protocol by creating two recombinant viruses that respectively allow quantification of RSV replication and live analysis of RSV inclusion bodies and inclusion bodies-associated granules dynamics.

The use of recombinant viruses has become crucial in basic or applied virology. Reverse genetics has been proven to be an extremely powerful technology, ...

The use of recombinant viruses is a powerful technology both to decipher the viral replication mechanisms and to provide development platforms for vaccines. Likewise, generation of good quality viral stock is crucial for every viral study from the most fundamental research to the applied studies. Rescue of recombinant viruses, optimal harvesting, freezing, and titration of RSV stocks are critical methods for all virological studies.They might be considered traditional but remain delicate and require specific expertise. The day before transfection, suspend BSR-T7/5 cells in complete medium at 0.5 million cells per milliliter concentration. Distribute two milliliters of the cell suspension per well in a six-well plate.Incubate the plate at 37 degrees Celsius in 5%carbon dioxide until they reach 80-90%confluency the next day. To rescue each virus, first mix thawed reverse genetics vectors in a tube, then proceed to transfection, following the transfection reagent manufacturer's protocol. Next add 250 microliters of the reduced serum medium to the mixed vectors.In another tube, dilute 10 microliters of this transfection reagent in 250 microliters of the reduced serum medium. Gently vortex both tubes and wait for five minutes. Mix the contents of both tubes and wait for 20 minutes at room temperature.Meanwhile, rinse the BSR-T7/5 cells with one milliliter of the reduced serum medium and distribute 1.5 milliliter of minimum essential media antibiotics free supplemented with 10%fetal calf serum per well. If necessary, incubate at 37 degrees Celsius in 5%carbon dioxide environment. After the 20-minute incubation, add 500 microliters of the transfection mix into each well.Incubate the cells at 37 degrees Celsius in 5%carbon dioxide environment for three days. To monitor the rescue efficiency, observe at GFP fluorescence under an inverted fluorescence microscope at 20X magnification once per day. On the third day of transfection, scratch cells in each well of the transfected BSR-T7/5 six-well plate.Transfer cells and supernatant of each well into a sterile two-milliliter microcentrifuge tube. To release the rescued virus from the cell membranes, vortex each tube vigorously for at least 30 seconds. For the first amplification of the rescued viruses, first remove the culture medium from the HEp-2 plate seeded the day before, then quickly add 500 microliters per well of the fresh passage-zero viral suspension.Place the HEp-2 plate at 37 degrees Celsius on a seesaw rocker for soft agitation for two hours. To produce the first passage of the rescued viruses, discard 500 microliters of the inoculum and add two milliliters of MEM with 2%FCS. Incubate the plate at 37 degrees Celsius in 5%carbon dioxide for three days.To monitor the infection under an inverted fluorescence microscope at 20X magnification, observe GFP fluorescence of the HEp-2 cells infected with the passage-zero suspension once per day. Under a brightfield microscope, observe the appearance of small syncytia and cell detachment, which reflects the RSV cytopathic effect. To amplify the rescued viruses, first dilute the viral suspension of FCS-free MEM to obtain a three-milliliter suspension at 50, 000 PFU per milliliter, then remove the medium from the HEp-2 flask.Quickly add the three-milliliter viral suspension and incubate the flask at 37 degrees Celsius on a seesaw rocker for soft agitation for two hours. Next remove and discard the inoculum and add 15 milliliters of MEM with 2%FCS. Incubate at 37 degrees Celsius in 5%carbon dioxide for two to four days.To estimate the right time to harvest the viruses, check the cell morphology and GFP fluorescence under an inverted fluorescence microscope at 20X magnification. Note that this is usually when 50%to 80%of the HEp-2 cell layer is detached due to the RSV cytopathic effect that occurs between 48 and 72 hours post infection. Next scrape all the cells using a cell scraper.Collect both the cells and the supernatant together and transfer them to a 50-milliliter centrifuge tube. Add 1/10 of the volume of the 10X RSV conservation solution. Vortex the tubes vigorously for five seconds and centrifuge for five minutes at 200 times g to clarify the suspension.Transfer the supernatant to a 50-milliliter tube. Vortex briefly and aliquot the suspension in cryogenic tubes labeled with alcohol-resistant tags. Immerse the tube in pre-cooled, minus 80 degrees-Celsius alcohol for at least one hour and store them at minus 80 degrees Celsius.To perform a plaque titration assay, first make 2X minimum essential medium by diluting commercial 10X MEM with sterile water and adding L-glutamine, 1, 000 units per milliliter penicillin, and one milligram per milliliter streptomycin. Shake the dilution vigorously and store it at four degrees Celsius, then add 900 microliters of the FCS-free MEM to six tubes. Thaw the virus aliquots and vortex them vigorously for five seconds.To make serial dilutions, first add 100 microliters of the virus to 900 microliters of the medium in the first tube. Put the cap on the tube and mix its contents by vortexing for a few seconds, then add 100 microliters of the first dilution to 900 microliters of the medium in the second tube. Put the cap on the tube and vortex.Repeat this procedure until the sixth tube. Write the virus name and the full dilutions on the HEp-2 12-well plates. Add a mark to match the plate and its cover because they may be separated during staining.Remove the medium from the plates and distribute 400 microliters of one dilution per well. Incubate the plates at 37 degrees Celsius for two hours for virus adsorption. During the virus adsorption, prepare the microcrystalline cellulose overlay by first adjusting the pH of the 2X MEM to around 7.2 with a sterile sodium bicarbonate solution at 7.5%following the color indicator.To obtain 100 milliliters of the overlay, add 10 milliliters of 2X MEM, 10 milliliters of 2.4%monocrystalline cellulose suspension, and 80 milliliters of the MEM supplemented with 2%FCS and mix vigorously. At the end of the two-hour incubation, add two to three milliliters of the overlay to each well of the 12-well plates without removing the inoculum. Incubate the plate at 37 degrees Celsius in 5%carbon dioxide for six days.To stain the cells with crystal violet solution, first gently shake the plates to take off the microcrystalline cellulose overlay. Remove the supernatants and wash the cells twice with 1X PBS, then add one to two milliliters of the crystal violet solution and wait 10 to 15 minutes. Remove the solution, which can be reused for subsequent plate-staining.Finally calculate the virus titers as a fraction of the number of visible plaques in the wells of the dry plates and the inoculum volume and the dilution. Performing a plaque assay on the negative control, transfected with only the expression plasmids of N, P, L, and M2-1 revealed no plaque at the lowest dilution. The titers obtained from the transfected cells were expected to be above 100 PFU per milliliter if the rescue was efficient.The titers increased over the passages to reach one million to 10 million PFU per milliliter at passage one or two. Thanks to these fluorescent viruses, inhibition of RSV expression by siRNA targeting the protein N and the cellular protein IMPDH can be easily observed and measured. In contrast, a strong GFP signal on control cells transfected with non-targeting siRNA or cells transfected with siRNA against the cellular protein GAPDH was observed and measured.Likewise these viruses enabled easy observation of the inhibition of RSV multiplication by an antiviral drug compound. Tracking the fluorescent protein M2-1 in HEp-2-infected cells showed IBs and IB-associated granules as very dynamic structures. IBs were observed as mobile and spherical structures able to fuse and to form larger spherical inclusions.IB-associated granules underwent continuous assembly-disassembly cycles with the formation of small IB-associated granules that grew, fused into large IB-associated granules, and then disappeared. The protocol of plaque titration of RSV using microcrystalline cellulose overlay may be easily adapted to other cells and/or other viruses. It will require adjusting the concentration of the microcrystalline cellulose.

generation-amplification-titration-recombinant-respiratory-syncytial

Research

JoVE Journal

Immunology and Infection

14.2K Views.  Université de Versailles St. Quentin. The use of recombinant viruses is a powerful technology both to decipher the viral replication mechanisms and to provide development platforms for vaccines. Likewise, generation of good quality viral stock is crucial for every viral study from the most fundamental research to the applied studies. Rescue of recombinant viruses, optimal harvesting, freezing, and titration of RSV stocks are critical methods for all virological studies.They might be considered traditional but remain delica...