This work was supported in part by the Natural Science Foundation of China (grant numbers 31471703, A0201300537 and 31671854 to J.V. and L.L., grant number 31470435 to G.Y.), and the 100 Foreign Talents Plan (grant number JSB2014012 to J.V.).

NOTE: A schematic overview is shown in Figure 1.
1. Sample collection
<ol>
	<li>Obtain oyster specimens. Keep oysters on ice during the postharvest period, the transport and prior to laboratory use and process within 4-7 days after purchase. 
	NOTE: For this protocol, oysters were purchased from Zhong Cai Wholesale Market in Nanjing (originating from Ningde, Fujian, China and Lianyungang, Jiangsu, China), Haijie Aquatic Product Company in Qingdao (originating from Qingdao, Shandong, China), Jucheng Aquatic Product Company in Yantai (originating from Yantai, Shandong, China) and Jinxiu Aquatic Product Company in Qingdao (originating from Qingdao, Shandong, China)).</li>
</ol>
2. RNA isolation by guanidinium thiocyanate-phenol extraction
<ol>
	<li>Preparation of oyster tissue sample
	<ol>
		<li>Cut out approximately 100 mg of homogeneous soft tissue from the approximate geometric center of each oyster specimen with a sterilized scalpel, and transfer the samples into liquid nitrogen.</li>
		<li>Euthanize the remaining part of the oysters by freezing at -80 &#176;C for 1 h and discard as biological waste.</li>
		<li>Grind the flash-frozen oyster tissue into a fine powder in a mortar (200 mL) filled with 50 mL of liquid nitrogen.</li>
		<li>Weigh out 75 mg of each specimen&#8217;s frozen tissue into a sterile 1.5 mL centrifuge tube and mix with 1 mL of the guanidinium thiocyanate-phenol extraction reagent. Centrifuge the sample at 14,000 x g at 4 &#176;C for 15 min.</li>
	</ol>
	</li>
	<li>Transfer the supernatant to a new 1.5 mL centrifuge tube, add 200 &#181;L of chloroform and mix thoroughly by using a vortex mixer for 10-15 s until the mixture turns milky-white.</li>
	<li>Centrifuge at 14,000 x g at 4 &#176;C for 15 min, and transfer the upper aqueous layer carefully with a 200 &#181;L pipette without disturbing the interphase into a new 1.5 mL centrifuge tube.</li>
	<li>Add 500 &#181;L of isopropyl alcohol and mix the samples gently by inversion, then leave the samples for 20 min on ice. Centrifuge at 14,000 x g at 4 &#176;C for 8 min and remove the supernatant.</li>
	<li>Resuspend each of the pellets in 1 mL of 75% EtOH, and centrifuge at 14,000 x g at 4 &#176;C for 5 min. Remove all of the supernatant.</li>
	<li>Repeat step 2.5 once. Dry the pellets for 6 min at room temperature. Do not dry for longer; otherwise, it may be difficult to dissolve the RNA pellet in the next step.</li>
	<li>Dissolve the dried RNA pellet in 25 &#181;L of DEPC (diethylpyrocarbonate)-treated water and keep the tube on ice. Use RNA samples within 24 h.</li>
</ol>
3. cDNA library generation by reverse transcription
<ol>
	<li>For each RNA sample, prepare a reaction mixture using the a commercial reverse transcription system using a 10 &#181;L pipette: Add 4 &#181;L of MgCl2 solution, 2 &#181;L of 10x Reaction Buffer, 2 &#181;L of dNTP solution, 0.5 &#181;L of RNase inhibitor, 0.7 &#181;L of AMV Reverse Transcriptase, 0.5 &#181;L of Oligo(dT) 15 primer, 1 &#181;L of the extracted RNA sample and 9.3 &#181;L of H2O into a 300 &#181;L PCR tube.</li>
	<li>Incubate mixture in a PCR Thermocycler for 60 min at 42 &#176;C, and then increase the temperature to 95 &#176;C for 5 min.</li>
	<li>Store the generated cDNA library for up to 12 months at -20 &#176;C.</li>
</ol>
4. Mitochondrial gene amplification and purification
<ol>
	<li>Prepare PCR mixture using a 10 &#181;L pipette. Add 0.25 &#181;L (1.25 U) of high-fidelity DNA polymerase, 2 &#181;L of dNTP solution (2.5 mM of each dNTP), 0.5 &#181;L of the COX1 or ND forward primer (100 &#181;M), 0.5 &#181;L of the corresponding COX1 or ND reverse primer (100 &#181;M), 1 &#181;L of the cDNA library, 5 &#181;L of 5x buffer solution and 16 &#181;L of distilled H2O into a 300 &#181;L PCR tube.</li>
	<li>Perform the PCR amplification using the following parameters: After an initial denaturation step at 95 &#176;C (duration 5 min), 35 PCR reaction cycles consisting of an annealing step at 55 &#176;C (30 s), elongation step at 72 &#176;C (2 min), and denaturation step at 95 &#176;C (30 s), perform one finalizing elongation step for 5 min at 72 &#176;C.</li>
	<li>Use 5 &#181;L of the PCR product to verify by agarose gel electrophoresis the quality of the obtained PCR product. Observe the amplified COX1 or ND gene as a single band at either 759 or 748 base pairs, respectively.</li>
	<li>Purify the rest of the PCR product with a PCR clean-up kit.
	<ol>
		<li>Add 100 &#181;L of solution &#39;PCR-A&#39;&#160;(DNA binding buffer which contains high concentrations of chaotropic salts11) to the sample. Vortex briefly to mix the contents.</li>
		<li>Place the purification column into a 2 mL centrifuge tube. Pipette the reaction mixture of 4.4.1. into the column. Centrifuge at 14,000 x g for 1 min at room temperature.</li>
		<li>Discard the filtrate from the centrifuge tube. Return the column to the 2 mL centrifuge tube, add 700 &#181;L of solution &#39;W2&#39;&#160;into the column and centrifuge at 14,000 x g for 1 min at room temperature (&#39;W2&#39;&#160;is a washing solution which contains high concentrations of ethanol for the removal of residual chaotropic salts from the purification column).</li>
		<li>Discard the filtrate and return the column to the 2 mL centrifuge tube. Add 400 &#181;L of solution &#39;W2&#39;&#160;to the column and centrifuge at 14,000 x g for 1 min at room temperature.</li>
		<li>Pre-heat 1 mL of deionized water to 65 &#176;C in a metal block heater. Transfer the column into a new 1.5 mL centrifuge tube. Pipette 25 &#181;L of the 65 &#176;C hot pre-heated deionized water to the center of the white column membrane. Let the membrane soak for 1 min at room temperature.</li>
		<li>Centrifuge at 14,000 x g for 1 min at room temperature and discard the column.</li>
	</ol>
	</li>
	<li>Store the purified PCR product for up to 12 months at -20 &#176;C.</li>
</ol>
5. Mitochondrial gene sequencing and comparison
<ol>
	<li>Send the purified PCR samples from step 4.5 for Sanger sequencing using the relevant COX1 or ND forward primers as sequencing primers. Optionally, the COX1 or ND reverse primers can also be used for bidirectional sequencing.</li>
	<li>After retrieving the sequencing results, compare the sequences with the genome sequence of the Pacific oyster reference strain (NCBI Taxonomy ID: 29159) using the NCBI Nucleotide BLAST online tool (blast.ncbi.nlm.nih.gov) (Figure 2 and Figure 3).</li>
</ol>
6. Applying the cDNA library for cloning the genes MgUGD and MgUXS
<ol>
	<li>Amplify and purify the MgUGD and MgUXS genes using the respective forward and reverse primers of MgUGD and MgUXS by PCR following steps 4.1. to 4.4.</li>
	<li>Transfer 2 &#181;L of digestion buffer (10x concentrated) and 6 &#181;L of deionized water into a 1.5 mL centrifuge tube. Add 10 &#181;L of the purified MgUGD or MgUXS PCR products together with the restriction endonucleases Nde I and Xho I (1 &#181;L each, 20 U). Incubate at 37 &#176;C for 3 h.</li>
	<li>Prepare the predigested pET-30a vector: Transfer 500 ng of the pET-30a vector into a new 1.5 mL centrifuge tube and top up the volume to 16 &#181;L using deionized water. Add 2 &#181;L of digestion buffer (10x concentrated) together with the restriction endonucleases Nde I and Xho I (1 &#181;L each, 20 U).
	<ol>
		<li>After incubating the mixture at 37 &#176;C for 3 h, add 1 &#181;L of alkaline phosphatase (1 U) and incubate at 37 &#176;C for an additional hour. Inactivate the alkaline phosphatase by heating at 75 &#176;C for 10 min in a pre-heated metal block heater.</li>
	</ol>
	</li>
	<li>Transfer 4 &#181;L of the digested MgUGD or MgUXS DNA products into fresh 1.5 mL centrifuge tubes and add 4 &#181;L of the digested pET-30a vector. Add 1 &#181;L of Ligation Buffer (10x), 1 &#181;L of T4 ligase (3 U) and incubate the reaction mixture at 22 &#176;C for 3 h.</li>
	<li>Transform&#160; electrocompetent E. coli Mach1 Competent Cells by electroporation using the ligation products. Spread the transformed cells on LB agar plates containing 50 &#956;g/mL kanamycin. Incubate cells at 37 &#176;C for 16 h.</li>
	<li>Verify colonies for the desired insertion by Sanger sequencing using the plasmid-specific T7 promoter and terminator primers. Prepare plasmids from the validated bacterial clones.</li>
</ol>
7. Expression and activity tests of MgUGD and MgUXS
<ol>
	<li>Transform E. coli BL21 (DE3) Competent Cells &#160;with plasmids bearing the MgUGD and MgUXS genes and spread the transformed cells on LB agar plates containing 50 &#956;g/mL kanamycin. Incubate cells at 37 &#176;C for 16 h.</li>
	<li>Cultivate a single colony in 5 mL LB medium with 50 &#956;g/mL kanamycin overnight. Transfer the culture into 400 mL LB medium and continuously shake at 200 rpm at a temperature of 37 &#176;C until the optical density at a wavelength of 600 nm (OD600) reaches an absorption of approximately 0.5.
	<ol>
		<li>Reduce the incubation temperature to 20 &#176;C and add 400 &#181;L of isopropyl &#946;-D-thiogalactopyranoside (concentration 1 M). Induce the expression of the recombinant proteins for 3 h.</li>
	</ol>
	</li>
	<li>Harvest cells by centrifugation at 4,500 x g for 15 min at 4 &#176;C. Suspend pellets in 10 mL of lysis buffer (100 mM NaCl, 50 mM Tris/HCl, 1% Triton X-100, 1 mM phenylmethylsulfonyl- fluoride (PMSF), pH 8.0).</li>
	<li>Disrupt cells by sonication for 20 min (40 on/off cycles with 20 &#956;m amplitude for 15 s at 4 &#176;C). Centrifuge at 14,000 x g at 4&#176;C for 20 min and collect the supernatant for the activity test.</li>
	<li>Perform the activity assay of MgUGD by incubating 2 &#181;L of the cell lysate with 2 &#181;L of UDP-glucose (10 mM), 4 &#181;L of NAD+ (10mM), 4 &#181;L of MgCl2 (10 mM), 2 &#181;L of Tris/HCl buffer (500 mM, pH 7.5), and 6 &#181;L of deionized H2O in a new 1.5 mL centrifuge tube and incubate at 37 &#176;C for 30 min.</li>
	<li>Perform the activity assay of MgUXS by incubating 2 &#181;L of the cell lysate with 2 &#181;L of UDP-glucuronic acid (10 mM), 2 &#181;L of Tris/HCl buffer (500 mM, pH 7.5), and 14 &#181;L of deionized H2O in a new 1.5 mL centrifuge tube and incubate at 37 &#176;C for 30 min.</li>
	<li>Quench the reactions in step 7.5 and 7.6 by adding 20 &#956;L of methanol and 40 &#956;L of chloroform to each mixture. After vortexing the sample mixtures, centrifuge at 14,000 x g for 6 min at 4 &#176;C and collect the upper aqueous layer of each tube.</li>
	<li>Analyze the reaction products using MALDI-TOF mass spectrometry in negative ionization mode in the m/z range from 500-700. Mix 1 &#956;L of sample mixture with 1 &#956;L of 2,5-dihydroxybenzoic acid sample matrix (1% w/V in 50% aqueous acetonitrile). Observe the expected m/z values at 579 and 535 for UDP-glucuronic acid and UDP-xylose, respectively (Figure 4).</li>
</ol>

<ol>
	<li>Blaxter, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+promise+of+a+DNA+taxonomy.">The promise of a DNA taxonomy.</a> Philosophical transactions of the Royal Society of London. Series B, Biological. 359 (1444), 669-679 (2004).</li><li>Wen, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Species+identification+of+dried+shellfish+(oyster,+clam+and+mussel)+products+sold+on+the+Chinese+market.">Species identification of dried shellfish (oyster, clam and mussel) products sold on the Chinese market.</a> Food Control. 90, 199-204 (2018).</li><li>Zhang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+cob+and+cox1+genes+and+editing+of+the+corresponding+mRNAs+in+Dinophysis+acuminata+from+Narragansett+Bay,+with+special+reference+to+the+phylogenetic+position+of+the+genus+Dinophysis.">Mitochondrial cob and cox1 genes and editing of the corresponding mRNAs in Dinophysis acuminata from Narragansett Bay, with special reference to the phylogenetic position of the genus Dinophysis.</a> Applied and Environmental Microbiology. 74 (5), 1546-1554 (2007).</li><li>Sell, J., Spirkovski, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+DNA+differentiation+between+two+forms+of+trout+Salmo+letnica,+endemic+to+the+Balkan+Lake+Ohrid,+reflects+their+reproductive+isolation.">Mitochondrial DNA differentiation between two forms of trout Salmo letnica, endemic to the Balkan Lake Ohrid, reflects their reproductive isolation.</a> Molecular Ecology. 13, 3633-3644 (2004).</li><li>Karadjian, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+rearranged+mitochondrial+genome+in+Nycteria+parasites+(Haemosporidia)+from+bats.">Highly rearranged mitochondrial genome in Nycteria parasites (Haemosporidia) from bats.</a> Proceedings of the National Academy of Sciences of the United States of America. 113 (35), 9834-9839 (2018).</li><li>Morga, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+genes+from+flat+oyster+Ostrea+edulis+as+suitable+housekeeping+genes+for+quantitative+real+time+PCR.">Identification of genes from flat oyster Ostrea edulis as suitable housekeeping genes for quantitative real time PCR.</a> Fish and Shellfish Immunology. 29 (6), 937-945 (2010).</li><li>Delsuc, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+systematics+of+armadillos+(Xenarthra,+Dasypodidae):+contribution+of+maximum+likelihood+and+Bayesian+analyses+of+mitochondrial+and+nuclear+genes.">Molecular systematics of armadillos (Xenarthra, Dasypodidae): contribution of maximum likelihood and Bayesian analyses of mitochondrial and nuclear genes.</a> Molecular Phylogenetics and Evolution. 28 (2), 261-265 (2005).</li><li>Wei, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+and+Biochemical+Characterization+of+UDP-Glucose+Dehydrogenase+from+Akkermansia+muciniphila.">Discovery and Biochemical Characterization of UDP-Glucose Dehydrogenase from Akkermansia muciniphila.</a> Protein &amp; Peptide Letters. 24 (8), 735-741 (2017).</li><li>Gu, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+and+Biochemical+Characterization+of+the+UDP-Xylose+Biosynthesis+Pathway+in+Sphaerobacter+thermophilus.">Discovery and Biochemical Characterization of the UDP-Xylose Biosynthesis Pathway in Sphaerobacter thermophilus.</a> Protein &amp; Peptide Letters. 23 (12), 1103-1110 (2016).</li><li>Duan, X. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+characterization+of+the+UDP-xylose+biosynthesis+pathway+in+Rhodothermus+marinus.">Functional characterization of the UDP-xylose biosynthesis pathway in Rhodothermus marinus.</a> Applied Microbiology and Biotechnology. 99 (22), 9463-9472 (2015).</li><li>Vogelstein, B., Gillespie, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparative+and+analytical+purification+of+DNA+from+agarose.">Preparative and analytical purification of DNA from agarose.</a> Proceedings of the National Academy of Sciences of the United States of America. 76 (2), 615-619 (1979).</li><li>Song, H. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UDP-glucose+4-epimerase+and+&#946;-1,4-galactosyltransferase+from+the+oyster+Magallana+gigas+as+valuable+biocatalysts+for+the+production+of+galactosylated+products.">UDP-glucose 4-epimerase and &#946;-1,4-galactosyltransferase from the oyster Magallana gigas as valuable biocatalysts for the production of galactosylated products.</a> International Journal of Molecular Sciences. 19 (6), 1600 (2018).</li><li>Gainey, P. A., Phelps, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Uridine+diphosphate+glucuronic+acid+production+and+utilization+in+various+tissues+actively+synthesizing+glycosaminoglycans.">Uridine diphosphate glucuronic acid production and utilization in various tissues actively synthesizing glycosaminoglycans.</a> Biochemical Journal. 128 (2), 215-227 (1972).</li></ol>

The authors have nothing to disclose.

The presented protocol allows the genetic identification of unreferenced oyster specimens with similar phenotype from regional seafood markets by comparison of the COX1 and ND genes with a publicly available oyster DNA genome database. The significance of this method lies in its simplicity, as only a single PCR reaction is needed for the evaluation of the virtual cDNA library. The two conserved mitochondrial COX1 and ND genes were amplified from a cDNA library which was generated by reverse transcription of RNA extracts ...

The acquisition of living referenced biological material may be challenging due to long delivery times, entrepreneurial reasoning, or country-specific customs regulations. As an alternative, the required biological material may be also collected from phenotypically identical specimens. However, these samples may vary significantly at the level of genotype, and therefore comparisons with digitally-stored reference genomes of the same species are often rendered difficult or even futile due to incompatibility of the newly-sourced material with existing DNA amplification methods. Sequencing highly conserved genes of individual samples is a widely used and powerful tool for identifying species1, such as conserved mitochondrial genes that are frequently used as reference genes for the quality assessment of cDNA libraries2,3,4,5,6. The underlying rationale for the herein presented method is that high conservation of mitochondrial gene sequences in individual anonymous oyster samples compared to the corresponding sequences of the reference genome indicates that other genes may also show a low level of divergence, given the generally faster rate of mitochondrial DNA evolution relative to nuclear DNA7, allowing the amplification and isolation of a wide range of scientifically and industrially relevant genes by simply using publicly available sequencing data as a reference.
The overall goal of the herein described method is to present an optimized workflow for generating a virtually sequenced oyster cDNA library which can be used as template DNA for the cloning of oyster genes. In virtual sequencing, de novo genome sequencing is circumvented; instead, a known, digitally-stored reference sequence is used directly to utilize or design primers for production of cDNAs that will eventually comprise a library (or be added to a pre-existing one). The aim is to produce a convergent cDNA library, meaning that similarities between the generated cDNA sequences and the reference sequence can be ranked from low to high divergence. A key advantage of using Cytochrome C Oxidase subunit 1 (COX1) and NADH Dehydrogenase (ND) as reference genes is that even highly geographically disjunct oyster specimens can be profiled due to the high conservation of these mitochondrial genes. Having proven the approach with these well-established markers, we then demonstrate its application to two enzyme candidates which are involved in sugar nucleotide biosynthesis and may be of industrial relevance8,9,10. The biotechnological potential of the Pacific oyster is still unexplored. Thus, we believe that this converging method for preparing a virtually sequenced cDNA library will also be appropriate for non-specialist researchers who want to generate cDNA from this relevant biological material.

<table border="0" cellpadding="0" cellspacing="0" style="width:827px;" width="826">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:261px;">Chemicals:</td>
			<td style="width:199px;"></td>
			<td style="width:131px;"></td>
			<td style="width:236px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1% Triton X-100</td>
			<td>Solarbio</td>
			<td>9002-93-1</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:261px;">2,5-Dihydroxybenzoic acid</td>
			<td>Alfa Aesar</td>
			<td>490-79-9</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Acetonitrile</td>
			<td>Merck</td>
			<td>75-05-8</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Agarose for molecular biology</td>
			<td>Biowest Chemicals</td>
			<td>111860</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ampicilin</td>
			<td>Solarbio</td>
			<td>69-52-3</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Chloroform</td>
			<td>Lingfeng, Shanghai</td>
			<td>67-66-3</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DEPC water</td>
			<td>Thermo Scientific</td>
			<td>R0601</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ethanol</td>
			<td>Jinhuada, Guangzhou</td>
			<td>64-17-5</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Guanidinium thiocyanate-phenol reagent</td>
			<td>Invitrogen</td>
			<td>15596018</td>
			<td>TRIzol reagent</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Imidazole</td>
			<td>Energy Chemical</td>
			<td>288-32-4</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isopropyl alcohol</td>
			<td>Nanjing Chemical Reagent</td>
			<td>67-63-0</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isopropyl &#946;-D-thiogalactopyranoside</td>
			<td>Solarbio</td>
			<td>367-93-1</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Kanamycin</td>
			<td>Solarbio</td>
			<td>25389-94-0</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">LB Agar</td>
			<td>Thermo Fisher</td>
			<td>22700025</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">LB Broth</td>
			<td>Thermo Fisher</td>
			<td>10855021</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Methanol</td>
			<td>Jinhuada, Guangzhou</td>
			<td>67-56-1</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;">MgCl2 hexahydrate</td>
			<td>Xilong Huagong</td>
			<td>7791-18-6</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NaCl</td>
			<td>Xilong Huagong</td>
			<td>7647-14-5</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;">NAD+</td>
			<td>Duly Biotech</td>
			<td>53-84-9</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Phenyl-methylsulfonyl fluoride</td>
			<td>Macklin</td>
			<td>329-98-6</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Tris</td>
			<td>Solarbio</td>
			<td>77-86-1</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">UDP-glucose</td>
			<td>Wuhu Nuowei Chemicals</td>
			<td>28053-08-9</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">UDP-glucuronic acid</td>
			<td>SIGMA</td>
			<td>63700-19-6</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tools/Instruments:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">MALDI-TOF mass spectrometer</td>
			<td>Bruker</td>
			<td>Autoflex</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Metal block heater</td>
			<td>Long Yang Scientific Instruments</td>
			<td>Thermoshaker HB20</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PCR thermocycler</td>
			<td>Hema</td>
			<td>9600</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Enzyme and Kits:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10&#215;Ligation buffer</td>
			<td>Thermo Scientific</td>
			<td>B69</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5&#215;PrimeSTAR buffer</td>
			<td>Takara</td>
			<td>9158A</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Alkaline phosphatase</td>
			<td>ThermoFisher FastAP</td>
			<td>EF0654</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">COX forward primer</td>
			<td>Genscript</td>
			<td>ATGTCAACAAATCATTTAGACATTG</td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">COX reverse primer</td>
			<td>Genscript</td>
			<td>ACTTGACCAAAAACATAAGACATG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cutsmart Buffer</td>
			<td>NEB</td>
			<td>B7204S</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">dNTP mix</td>
			<td>Invitrogen</td>
			<td>18427088</td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">MgUGD forward primer</td>
			<td>Genscript</td>
			<td>ACATATGACCCTGTCCAAGATCTGTTGT</td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">MgUGD reverse primer</td>
			<td>Genscript</td>
			<td>ACTCGAGACTCTGTGAGGCGGTGGAG</td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">MgUXS forward primer</td>
			<td>Genscript</td>
			<td>CCATATGGCAGAATCCTCACAATCAC</td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">MgUXS reverse primer</td>
			<td>Genscript</td>
			<td>ACTCGAGCACATTTTTGAATTTGCAGACGT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ND forward primer</td>
			<td>Genscript</td>
			<td>ATGAGATGGCAATTATTTTTTAAT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ND reverse primer</td>
			<td>Genscript</td>
			<td>ATGTATTTTGGAAAAATCTCCAC</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">PCR Cleanup Kit</td>
			<td>AxyGen</td>
			<td>AP-PCR-250</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pET-30a(+) vector</td>
			<td>Merck Millipore</td>
			<td>69909</td>
			<td></td>
		</tr>
	</tbody>
</table>

a converging strategy for the generation of a virtually sequenced cdna library from unreferenced pacific oysters

The access to biological material of reference species, which were used previously in key experiments such as in the development of novel cell lines or genome sequencing projects, are often difficult to provide for further studies or third parties due to the consumptive nature of the samples. Although now widely distributed over the Pacific coasts of Asia, Australia and North America, individual Pacific oyster specimens are genetically quite diverse and are therefore not directly suitable as the starting material for gene libraries. In this article, we demonstrate the use of unreferenced Pacific oyster specimens obtained from regional seafood markets to generate cDNA libraries. These libraries were then compared to the publicly available oyster genome, and the closest related library was selected using the mitochondrial reference genes Cytochrome C Oxidase subunit I (COX1) and NADH Dehydrogenase (ND). The suitability of the generated cDNA library is also demonstrated by cloning and expression of two genes encoding the enzymes UDP-glucuronic acid dehydrogenase (UGD) and UDP-xylose synthase (UXS), which are responsible for the biosynthesis of UDP-xylose from UDP-glucose.

Figure 1 shows a schematic overview of the described preparation method of the convergent cDNA library derived from Pacific oyster individuals. Figure 2 shows the sequences of the COX1 and ND genes of a distantly related oyster specimen with high divergence from the COX1 and ND gene sequences of the reference material. Figure 3 shows the sequences of the COX1 and ND genes of a closely related oyster specimen with low divergence from...

Watch this Scientific Journal Video about A Converging Strategy for the Generation of a Virtually Sequenced cDNA Library from Unreferenced Pacific Oysters at JoVE.com

A Converging Strategy for the Generation of a Virtually Sequenced cDNA Library from Unreferenced Pacific Oysters

We describe a strategy for how to use RNA samples from unreferenced Pacific oyster specimens, and evaluate the genetic material by comparison with publicly available genome data to generate a virtually sequenced cDNA library.

The access to biological material of reference species, which were used previously in key experiments such as in the development of novel cell lines or ...

a-converging-strategy-for-generation-virtually-sequenced-cdna-library

Research

JoVE Journal

Bioengineering

5.4K Views.  Nanjing Agricultural University. We describe a strategy for how to use RNA samples from unreferenced Pacific oyster specimens, and evaluate the genetic material by comparison with publicly available genome data to generate a virtually sequenced cDNA library.

Video: A Converging Strategy for the Generation of a Virtually Sequenced cDNA Library from Unreferenced Pacific Oysters

Synthetic Spider Silk Production on a Laboratory Scale

As society progresses and resources become scarcer, it is becoming increasingly important to cultivate new technologies that engineer next generation biomaterials with high performance properties. The development of these new structural materials must be rapid, cost-efficient and involve processing methodologies and products that are environmentally friendly and sustainable. Spiders spin a multitude of different fiber types with diverse mechanical properties, offering a rich source of next generation engineering materials for biomimicry that rival the best manmade and natural materials. Since the collection of large quantities of natural spider silk is impractical, synthetic silk production has the ability to provide scientists with access to an unlimited supply of threads. Therefore, if the spinning process can be streamlined and perfected, artificial spider fibers have the potential use for a broad range of applications ranging from body armor, surgical sutures, ropes and cables, tires, strings for musical instruments, and composites for aviation and aerospace technology. In order to advance the synthetic silk production process and to yield fibers that display low variance in their material properties from spin to spin, we developed a wet-spinning protocol that integrates expression of recombinant spider silk proteins in bacteria, purification and concentration of the proteins, followed by fiber extrusion and a mechanical post-spin treatment. This is the first visual representation that reveals a step-by-step process to spin and analyze artificial silk fibers on a laboratory scale. It also provides details to minimize the introduction of variability among fibers spun from the same spinning dope. Collectively, these methods will propel the process of artificial silk production, leading to higher quality fibers that surpass natural spider silks.

Despite the outstanding mechanical and biochemical properties of spider silks, this material cannot be harvested in large quantities by conventional means. Here we describe an efficient strategy to spin artificial spider silk fibers, which is an important process for investigators studying spider silk production and their use as next-generation biomaterials.

As society progresses and resources become scarcer, it is becoming increasingly important to cultivate new technologies that engineer next generation ...

Designing a Bio-responsive Robot from DNA Origami

Nucleic acids are astonishingly versatile. In addition to their natural role as storage medium for biological information1, they can be utilized in parallel computing2,3 , recognize and bind molecular or cellular targets4,5 , catalyze chemical reactions6,7 , and generate calculated responses in a biological system8,9. Importantly, nucleic acids can be programmed to self-assemble into 2D and 3D structures10-12, enabling the integration of all these remarkable features in a single robot linking the sensing of biological cues to a preset response in order to exert a desired effect.
Creating shapes from nucleic acids was first proposed by Seeman13, and several variations on this theme have since been realized using various techniques11,12,14,15 . However, the most significant is perhaps the one proposed by Rothemund, termed scaffolded DNA origami16. In this technique, the folding of a long (&gt;7,000 bases) single-stranded DNA 'scaffold' is directed to a desired shape by hundreds of short complementary strands termed 'staples'. Folding is carried out by temperature annealing ramp. This technique was successfully demonstrated in the creation of a diverse array of 2D shapes with remarkable precision and robustness. DNA origami was later extended to 3D as well17,18 .
 
The current paper will focus on the caDNAno 2.0 software19 developed by Douglas and colleagues. caDNAno is a robust, user-friendly CAD tool enabling the design of 2D and 3D DNA origami shapes with versatile features. The design process relies on a systematic and accurate abstraction scheme for DNA structures, making it relatively straightforward and efficient.
In this paper we demonstrate the design of a DNA origami nanorobot that has been recently described20. This robot is 'robotic' in the sense that it links sensing to actuation, in order to perform a task. We explain how various sensing schemes can be integrated into the structure, and how this can be relayed to a desired effect. Finally we use Cando21 to simulate the mechanical properties of the designed shape. The concept we discuss can be adapted to multiple tasks and settings.

DNA origami is a powerful method for fabricating precise nanoscale objects by programming the self-assembly of DNA molecules. Here, we describe how DNA origami can be utilized to design a robotic robot capable of sensing biological cues and responding by shape shifting, subsequently relayed to a desired effect.

Nucleic acids are astonishingly versatile. In addition to their natural role as storage medium for biological information1, they can be utilized in ...

An Improved Method for the Preparation of Type I Collagen From Skin

Soluble type 1 collagen (COL1) is used extensively as an adhesive substrate for cell cultures and as a cellular scaffold for regenerative applications. Clinically, this protein is widely used for cosmetic surgery, dermal injections, bone grafting, and reconstructive surgery. The sources of COL1 for these procedures are commonly nonhuman, which increases the potential for inflammation and rejection as well as xenobiotic disease transmission. In view of this, a method to efficiently and quickly purify COL1 from limited quantities of autologously-derived tissues would circumvent many of these issues; however, standard isolation protocols are lengthy and often require large quantities of collagenous tissues. Here, we demonstrate an efficient COL1 extraction method that reduces the time needed to isolate and purify this protein from about 10 days to less than 3 hr. We chose the dermis as our tissue source because of its availability during many surgical procedures. This method uses traditional extraction buffers combined with forceful agitation and centrifugal filtration to obtain highly-pure, soluble COL1 from small amounts of corium. Briefly, dermal biopsies are washed thoroughly in ice-cold dH2O after removing fat, connective tissue, and hair. The skin samples are stripped of noncollagenous proteins and polysaccharides using 0.5 M sodium acetate and a high speed bench-top homogenizer. Collagen from residual solids is subsequently extracted with a 0.075 M sodium citrate buffer using the homogenizer. These extracts are purified using 100,000 MW cut-off centrifugal filters that yield COL1 preparations of comparable or superior quality to commercial products or those obtained using traditional procedures. We anticipate this method will facilitate the utilization of autologously-derived COL1 for a multitude of research and clinical applications.

Traditional procedures for the isolation of soluble type 1 collagen (COL1) require about 10 days from start to finish because of lengthy buffer incubations and laborious resuspensions of fibrils. Here, we describe a means to purify COL1 from small dermal biopsies in less than 3 hr.

Soluble type 1 collagen (COL1) is used extensively as an adhesive substrate for cell cultures and as a cellular scaffold for regenerative applications. ...

Lipid Bilayer Vesicle Generation Using Microfluidic Jetting

Bottom-up synthetic biology presents a novel approach for investigating and reconstituting biochemical systems and, potentially, minimal organisms. This emerging field engages engineers, chemists, biologists, and physicists to design and assemble basic biological components into complex, functioning systems from the bottom up. Such bottom-up systems could lead to the development of artificial cells for fundamental biological inquiries and innovative therapies1,2. Giant unilamellar vesicles (GUVs) can serve as a model platform for synthetic biology due to their cell-like membrane structure and size. Microfluidic jetting, or microjetting, is a technique that allows for the generation of GUVs with controlled size, membrane composition, transmembrane protein incorporation, and encapsulation3. The basic principle of this method is the use of multiple, high-frequency fluid pulses generated by a piezo-actuated inkjet device to deform a suspended lipid bilayer into a GUV. The process is akin to blowing soap bubbles from a soap film. By varying the composition of the jetted solution, the composition of the encompassing solution, and/or the components included in the bilayer, researchers can apply this technique to create customized vesicles. This paper describes the procedure to generate simple vesicles from a droplet interface bilayer by microjetting.

Microfluidic jetting against a droplet interface lipid bilayer provides a reliable way to generate vesicles with control over membrane asymmetry, incorporation of transmembrane proteins, and encapsulation of material. This technique can be applied to study a variety of biological systems where compartmentalized biomolecules are desired.

Bottom-up synthetic biology presents a novel approach for investigating and reconstituting biochemical systems and, potentially, minimal organisms. This ...

Generation of a Three-dimensional Full Thickness Skin Equivalent and Automated Wounding

In vitro models are a cost effective and ethical alternative to study cutaneous wound healing processes. Moreover, by using human cells, these models reflect the human wound situation better than animal models. Although two-dimensional models are widely used to investigate processes such as cellular migration and proliferation, models that are more complex are required to gain a deeper knowledge about wound healing. Besides a suitable model system, the generation of precise and reproducible wounds is crucial to ensure comparable results between different test runs. In this study, the generation of a three-dimensional full thickness skin equivalent to study wound healing is shown. The dermal part of the models is comprised of human dermal fibroblast embedded in a rat-tail collagen type I hydrogel. Following the inoculation with human epidermal keratinocytes and consequent culture at the air-liquid interface, a multilayered epidermis is formed on top of the models. To study the wound healing process, we additionally developed an automated wounding device, which generates standardized wounds in a sterile atmosphere.

The goal of this protocol is to build up a three-dimensional full thickness skin equivalent, which resembles natural skin. With a specifically constructed automated wounding device, precise and reproducible wounds can be generated under maintenance of sterility.

In vitro models are a cost effective and ethical alternative to study cutaneous wound healing processes. Moreover, by using human cells, these models ...

Qualitative Characterization of the Aqueous Fraction from Hydrothermal Liquefaction of Algae Using 2D Gas Chromatography with Time-of-flight Mass Spectrometry

Two-dimensional gas chromatography coupled with time-of-flight mass spectrometry is a powerful tool for identifying and quantifying chemical components in complex mixtures. It is often used to analyze gasoline, jet fuel, diesel, bio-diesel and the organic fraction of bio-crude/bio-oil. In most of those analyses, the first dimension of separation is non-polar, followed by a polar separation. The aqueous fractions of bio-crude and other aqueous samples from biofuels production have been examined with similar column combinations. However, sample preparation techniques such as derivatization, solvent extraction, and solid-phase extraction were necessary prior to analysis. In this study, aqueous fractions obtained from the hydrothermal liquefaction of algae were characterized by two-dimensional gas chromatography coupled with time-of-flight mass spectrometry without prior sample preparation techniques using a polar separation in the first dimension followed by a non-polar separation in the second. Two-dimensional plots from this analysis were compared with those obtained from the more traditional column configuration. Results from qualitative characterization of the aqueous fractions of algal bio-crude are discussed in detail. The advantages of using a polar separation followed by a non-polar separation for characterization of organics in aqueous samples by two-dimensional gas chromatography coupled with time-of-flight mass spectrometry are highlighted.

A two-dimensional gas chromatography-time-of-flight mass spectrometry method is described for characterization of the aqueous fraction of bio-crude produced from hydrothermal liquefaction of algae. This protocol can also be employed to analyze the aqueous fraction of liquid products from fast pyrolysis, catalytic fast pyrolysis, catalytic deoxygenation and hydro-treating.

Two-dimensional gas chromatography coupled with time-of-flight mass spectrometry is a powerful tool for identifying and quantifying chemical components in ...

A Microcontroller Operated Device for the Generation of Liquid Extracts from Conventional Cigarette Smoke and Electronic Cigarette Aerosol

Electronic cigarettes are the most popular tobacco product among middle and high schoolers and are the most popular alternative tobacco product among adults. High quality, reproducible research on the consequences of electronic cigarette use is essential for understanding emerging public health concerns and crafting evidence based regulatory policy. While a growing number of papers discuss electronic cigarettes, there is little consistency in methods across groups and very little consensus on results. Here, we describe a programmable laboratory device that can be used to create extracts of conventional cigarette smoke and electronic cigarette aerosol. This protocol details instructions for the assembly and operation of said device, and demonstrates the use of the generated extract in two sample applications: an in vitro cell viability assay and gas-chromatography mass-spectrometry. This method provides a tool for making direct comparisons between conventional cigarettes and electronic cigarettes, and is an accessible entry point into electronic cigarette research.

Here, we describe a programmable laboratory device that can be used to create extracts of conventional cigarette smoke and electronic cigarette aerosol. This method provides a useful tool for making direct comparisons between conventional cigarettes and electronic cigarettes, and is an accessible entry point into electronic cigarette research.

Electronic cigarettes are the most popular tobacco product among middle and high schoolers and are the most popular alternative tobacco product among ...

Scalable Generation of Mature Cerebellar Organoids from Human Pluripotent Stem Cells and Characterization by Immunostaining

The cerebellum plays a critical role in the maintenance of balance and motor coordination, and a functional defect in different cerebellar neurons can trigger cerebellar dysfunction. Most of the current knowledge about disease-related neuronal phenotypes is based on postmortem tissues, which makes understanding of disease progression and development difficult. Animal models and immortalized cell lines have also been used as models for neurodegenerative disorders. However, they do not fully recapitulate human disease. Human induced pluripotent stem cells (iPSCs) have great potential for disease modeling and provide a valuable source for regenerative approaches. In recent years, the generation of cerebral organoids from patient-derived iPSCs improved the prospects for neurodegenerative disease modeling. However, protocols that produce large numbers of organoids and a high yield of mature neurons in 3D culture systems are lacking. The protocol presented is a new approach for reproducible and scalable generation of human iPSC-derived organoids under chemically-defined conditions using scalable single-use bioreactors, in which organoids acquire cerebellar identity. The generated organoids are characterized by the expression of specific markers at both mRNA and protein level. The analysis of specific groups of proteins allows the detection of different cerebellar cell populations, whose localization is important for the evaluation of organoid structure. Organoid cryosectioning and further immunostaining of organoid slices are used to evaluate the presence of specific cerebellar cell populations and their spatial organization.

This protocol describes a dynamic culture system to produce controlled size aggregates of human pluripotent stem cells and further stimulate differentiation in cerebellar organoids under chemically-defined and feeder-free conditions using a single-use bioreactor.

The cerebellum plays a critical role in the maintenance of balance and motor coordination, and a functional defect in different cerebellar neurons can ...

Production of Membrane-Filtered Phase-Shift Decafluorobutane Nanodroplets from Preformed Microbubbles

There are many methods that can be used for the production of vaporizable phase-shift droplets for imaging and therapy. Each method utilizes different techniques and varies in price, materials, and purpose. Many of these fabrication methods result in polydisperse populations with non-uniform activation thresholds. Additionally, controlling the droplet sizes typically requires stable perfluorocarbon liquids with high activation thresholds that are not practical in vivo. Producing uniform droplet sizes using low-boiling point gases would be beneficial for in vivo imaging and therapy experiments. This article describes a simple and economical method for the formation of size-filtered lipid-stabilized phase-shift nanodroplets with low-boiling point decafluorobutane (DFB). A common method of generating lipid microbubbles is described, in addition to a novel method of condensing them with high-pressure extrusion in a single step. This method is designed to save time, maximize efficiency, and generate larger volumes of microbubble and nanodroplet solutions for a wide variety of applications using common laboratory equipment found in many biological laboratories.

This protocol describes a method of generating large volumes of lipid encapsulated decafluorobutane microbubbles using probe-tip sonication and subsequently condensing them into phase-shift nanodroplets using high-pressure extrusion and mechanical filtration.

There are many methods that can be used for the production of vaporizable phase-shift droplets for imaging and therapy. Each method utilizes different ...

Pattern Generation for Micropattern Traction Microscopy

Micropattern traction microscopy allows control of the shape of single cells and cell clusters. Furthermore, the ability to pattern at the micrometer length scale allows the use of these patterned contact zones for the measurement of traction forces, as each micropatterned dot allows for the formation of a single focal adhesion that then deforms the soft, underlying hydrogel. This approach has been used for a wide range of cell types, including endothelial cells, smooth muscle cells, fibroblasts, platelets, and epithelial cells. 
This review describes the evolution of techniques that allow the printing of extracellular matrix proteins onto polyacrylamide hydrogels in a regular array of dots of prespecified size and spacing. As micrometer-scale patterns are difficult to directly print onto soft substrates, patterns are first generated on rigid glass coverslips that are then used to transfer the pattern to the hydrogel during gelation. First, the original microcontact printing approach to generate arrays of small dots on the coverslip is described. A second step that removes most of the pattern to leave islands of small dots is required to control the shapes of cells and cell clusters on such arrays of patterned dots. 
Next, an evolution of this approach that allows for the generation of islands of dots using a single subtractive patterning step is described. This approach is greatly simplified for the user but has the disadvantage of a decreased lifetime for the master mold needed to make the patterns. Finally, the computational approaches that have been developed for the analysis of images of displaced dots and subsequent cell-generated traction fields are described, and updated versions of these analysis packages are provided.

We describe improvements to a standard method for measuring cellular traction forces, based on microcontact printing with a single subtractive patterning step of dot arrays of extracellular matrix proteins on soft hydrogels. This method allows for simpler and more consistent fabrication of island patterns, essential for controlling cell cluster shape.

Micropattern traction microscopy allows control of the shape of single cells and cell clusters. Furthermore, the ability to pattern at the micrometer ...