This work was supported in part by the Natural Science Foundation of China (grant numbers 31471703, A0201300537 and 31671854 to J.V. and L.L., grant number 31470435 to G.Y.), and the 100 Foreign Talents Plan (grant number JSB2014012 to J.V.).

NOTE: A schematic overview is shown in Figure 1.
1. Sample collection
<ol>
	<li>Obtain oyster specimens. Keep oysters on ice during the postharvest period, the transport and prior to laboratory use and process within 4-7 days after purchase. 
	NOTE: For this protocol, oysters were purchased from Zhong Cai Wholesale Market in Nanjing (originating from Ningde, Fujian, China and Lianyungang, Jiangsu, China), Haijie Aquatic Product Company in Qingdao (originating from Qingdao, Shandong, China), Jucheng Aquatic Product Company in Yantai (originating from Yantai, Shandong, China) and Jinxiu Aquatic Product Company in Qingdao (originating from Qingdao, Shandong, China)).</li>
</ol>
2. RNA isolation by guanidinium thiocyanate-phenol extraction
<ol>
	<li>Preparation of oyster tissue sample
	<ol>
		<li>Cut out approximately 100 mg of homogeneous soft tissue from the approximate geometric center of each oyster specimen with a sterilized scalpel, and transfer the samples into liquid nitrogen.</li>
		<li>Euthanize the remaining part of the oysters by freezing at -80 &#176;C for 1 h and discard as biological waste.</li>
		<li>Grind the flash-frozen oyster tissue into a fine powder in a mortar (200 mL) filled with 50 mL of liquid nitrogen.</li>
		<li>Weigh out 75 mg of each specimen&#8217;s frozen tissue into a sterile 1.5 mL centrifuge tube and mix with 1 mL of the guanidinium thiocyanate-phenol extraction reagent. Centrifuge the sample at 14,000 x g at 4 &#176;C for 15 min.</li>
	</ol>
	</li>
	<li>Transfer the supernatant to a new 1.5 mL centrifuge tube, add 200 &#181;L of chloroform and mix thoroughly by using a vortex mixer for 10-15 s until the mixture turns milky-white.</li>
	<li>Centrifuge at 14,000 x g at 4 &#176;C for 15 min, and transfer the upper aqueous layer carefully with a 200 &#181;L pipette without disturbing the interphase into a new 1.5 mL centrifuge tube.</li>
	<li>Add 500 &#181;L of isopropyl alcohol and mix the samples gently by inversion, then leave the samples for 20 min on ice. Centrifuge at 14,000 x g at 4 &#176;C for 8 min and remove the supernatant.</li>
	<li>Resuspend each of the pellets in 1 mL of 75% EtOH, and centrifuge at 14,000 x g at 4 &#176;C for 5 min. Remove all of the supernatant.</li>
	<li>Repeat step 2.5 once. Dry the pellets for 6 min at room temperature. Do not dry for longer; otherwise, it may be difficult to dissolve the RNA pellet in the next step.</li>
	<li>Dissolve the dried RNA pellet in 25 &#181;L of DEPC (diethylpyrocarbonate)-treated water and keep the tube on ice. Use RNA samples within 24 h.</li>
</ol>
3. cDNA library generation by reverse transcription
<ol>
	<li>For each RNA sample, prepare a reaction mixture using the a commercial reverse transcription system using a 10 &#181;L pipette: Add 4 &#181;L of MgCl2 solution, 2 &#181;L of 10x Reaction Buffer, 2 &#181;L of dNTP solution, 0.5 &#181;L of RNase inhibitor, 0.7 &#181;L of AMV Reverse Transcriptase, 0.5 &#181;L of Oligo(dT) 15 primer, 1 &#181;L of the extracted RNA sample and 9.3 &#181;L of H2O into a 300 &#181;L PCR tube.</li>
	<li>Incubate mixture in a PCR Thermocycler for 60 min at 42 &#176;C, and then increase the temperature to 95 &#176;C for 5 min.</li>
	<li>Store the generated cDNA library for up to 12 months at -20 &#176;C.</li>
</ol>
4. Mitochondrial gene amplification and purification
<ol>
	<li>Prepare PCR mixture using a 10 &#181;L pipette. Add 0.25 &#181;L (1.25 U) of high-fidelity DNA polymerase, 2 &#181;L of dNTP solution (2.5 mM of each dNTP), 0.5 &#181;L of the COX1 or ND forward primer (100 &#181;M), 0.5 &#181;L of the corresponding COX1 or ND reverse primer (100 &#181;M), 1 &#181;L of the cDNA library, 5 &#181;L of 5x buffer solution and 16 &#181;L of distilled H2O into a 300 &#181;L PCR tube.</li>
	<li>Perform the PCR amplification using the following parameters: After an initial denaturation step at 95 &#176;C (duration 5 min), 35 PCR reaction cycles consisting of an annealing step at 55 &#176;C (30 s), elongation step at 72 &#176;C (2 min), and denaturation step at 95 &#176;C (30 s), perform one finalizing elongation step for 5 min at 72 &#176;C.</li>
	<li>Use 5 &#181;L of the PCR product to verify by agarose gel electrophoresis the quality of the obtained PCR product. Observe the amplified COX1 or ND gene as a single band at either 759 or 748 base pairs, respectively.</li>
	<li>Purify the rest of the PCR product with a PCR clean-up kit.
	<ol>
		<li>Add 100 &#181;L of solution &#39;PCR-A&#39;&#160;(DNA binding buffer which contains high concentrations of chaotropic salts11) to the sample. Vortex briefly to mix the contents.</li>
		<li>Place the purification column into a 2 mL centrifuge tube. Pipette the reaction mixture of 4.4.1. into the column. Centrifuge at 14,000 x g for 1 min at room temperature.</li>
		<li>Discard the filtrate from the centrifuge tube. Return the column to the 2 mL centrifuge tube, add 700 &#181;L of solution &#39;W2&#39;&#160;into the column and centrifuge at 14,000 x g for 1 min at room temperature (&#39;W2&#39;&#160;is a washing solution which contains high concentrations of ethanol for the removal of residual chaotropic salts from the purification column).</li>
		<li>Discard the filtrate and return the column to the 2 mL centrifuge tube. Add 400 &#181;L of solution &#39;W2&#39;&#160;to the column and centrifuge at 14,000 x g for 1 min at room temperature.</li>
		<li>Pre-heat 1 mL of deionized water to 65 &#176;C in a metal block heater. Transfer the column into a new 1.5 mL centrifuge tube. Pipette 25 &#181;L of the 65 &#176;C hot pre-heated deionized water to the center of the white column membrane. Let the membrane soak for 1 min at room temperature.</li>
		<li>Centrifuge at 14,000 x g for 1 min at room temperature and discard the column.</li>
	</ol>
	</li>
	<li>Store the purified PCR product for up to 12 months at -20 &#176;C.</li>
</ol>
5. Mitochondrial gene sequencing and comparison
<ol>
	<li>Send the purified PCR samples from step 4.5 for Sanger sequencing using the relevant COX1 or ND forward primers as sequencing primers. Optionally, the COX1 or ND reverse primers can also be used for bidirectional sequencing.</li>
	<li>After retrieving the sequencing results, compare the sequences with the genome sequence of the Pacific oyster reference strain (NCBI Taxonomy ID: 29159) using the NCBI Nucleotide BLAST online tool (blast.ncbi.nlm.nih.gov) (Figure 2 and Figure 3).</li>
</ol>
6. Applying the cDNA library for cloning the genes MgUGD and MgUXS
<ol>
	<li>Amplify and purify the MgUGD and MgUXS genes using the respective forward and reverse primers of MgUGD and MgUXS by PCR following steps 4.1. to 4.4.</li>
	<li>Transfer 2 &#181;L of digestion buffer (10x concentrated) and 6 &#181;L of deionized water into a 1.5 mL centrifuge tube. Add 10 &#181;L of the purified MgUGD or MgUXS PCR products together with the restriction endonucleases Nde I and Xho I (1 &#181;L each, 20 U). Incubate at 37 &#176;C for 3 h.</li>
	<li>Prepare the predigested pET-30a vector: Transfer 500 ng of the pET-30a vector into a new 1.5 mL centrifuge tube and top up the volume to 16 &#181;L using deionized water. Add 2 &#181;L of digestion buffer (10x concentrated) together with the restriction endonucleases Nde I and Xho I (1 &#181;L each, 20 U).
	<ol>
		<li>After incubating the mixture at 37 &#176;C for 3 h, add 1 &#181;L of alkaline phosphatase (1 U) and incubate at 37 &#176;C for an additional hour. Inactivate the alkaline phosphatase by heating at 75 &#176;C for 10 min in a pre-heated metal block heater.</li>
	</ol>
	</li>
	<li>Transfer 4 &#181;L of the digested MgUGD or MgUXS DNA products into fresh 1.5 mL centrifuge tubes and add 4 &#181;L of the digested pET-30a vector. Add 1 &#181;L of Ligation Buffer (10x), 1 &#181;L of T4 ligase (3 U) and incubate the reaction mixture at 22 &#176;C for 3 h.</li>
	<li>Transform&#160; electrocompetent E. coli Mach1 Competent Cells by electroporation using the ligation products. Spread the transformed cells on LB agar plates containing 50 &#956;g/mL kanamycin. Incubate cells at 37 &#176;C for 16 h.</li>
	<li>Verify colonies for the desired insertion by Sanger sequencing using the plasmid-specific T7 promoter and terminator primers. Prepare plasmids from the validated bacterial clones.</li>
</ol>
7. Expression and activity tests of MgUGD and MgUXS
<ol>
	<li>Transform E. coli BL21 (DE3) Competent Cells &#160;with plasmids bearing the MgUGD and MgUXS genes and spread the transformed cells on LB agar plates containing 50 &#956;g/mL kanamycin. Incubate cells at 37 &#176;C for 16 h.</li>
	<li>Cultivate a single colony in 5 mL LB medium with 50 &#956;g/mL kanamycin overnight. Transfer the culture into 400 mL LB medium and continuously shake at 200 rpm at a temperature of 37 &#176;C until the optical density at a wavelength of 600 nm (OD600) reaches an absorption of approximately 0.5.
	<ol>
		<li>Reduce the incubation temperature to 20 &#176;C and add 400 &#181;L of isopropyl &#946;-D-thiogalactopyranoside (concentration 1 M). Induce the expression of the recombinant proteins for 3 h.</li>
	</ol>
	</li>
	<li>Harvest cells by centrifugation at 4,500 x g for 15 min at 4 &#176;C. Suspend pellets in 10 mL of lysis buffer (100 mM NaCl, 50 mM Tris/HCl, 1% Triton X-100, 1 mM phenylmethylsulfonyl- fluoride (PMSF), pH 8.0).</li>
	<li>Disrupt cells by sonication for 20 min (40 on/off cycles with 20 &#956;m amplitude for 15 s at 4 &#176;C). Centrifuge at 14,000 x g at 4&#176;C for 20 min and collect the supernatant for the activity test.</li>
	<li>Perform the activity assay of MgUGD by incubating 2 &#181;L of the cell lysate with 2 &#181;L of UDP-glucose (10 mM), 4 &#181;L of NAD+ (10mM), 4 &#181;L of MgCl2 (10 mM), 2 &#181;L of Tris/HCl buffer (500 mM, pH 7.5), and 6 &#181;L of deionized H2O in a new 1.5 mL centrifuge tube and incubate at 37 &#176;C for 30 min.</li>
	<li>Perform the activity assay of MgUXS by incubating 2 &#181;L of the cell lysate with 2 &#181;L of UDP-glucuronic acid (10 mM), 2 &#181;L of Tris/HCl buffer (500 mM, pH 7.5), and 14 &#181;L of deionized H2O in a new 1.5 mL centrifuge tube and incubate at 37 &#176;C for 30 min.</li>
	<li>Quench the reactions in step 7.5 and 7.6 by adding 20 &#956;L of methanol and 40 &#956;L of chloroform to each mixture. After vortexing the sample mixtures, centrifuge at 14,000 x g for 6 min at 4 &#176;C and collect the upper aqueous layer of each tube.</li>
	<li>Analyze the reaction products using MALDI-TOF mass spectrometry in negative ionization mode in the m/z range from 500-700. Mix 1 &#956;L of sample mixture with 1 &#956;L of 2,5-dihydroxybenzoic acid sample matrix (1% w/V in 50% aqueous acetonitrile). Observe the expected m/z values at 579 and 535 for UDP-glucuronic acid and UDP-xylose, respectively (Figure 4).</li>
</ol>

<ol>
	<li>Blaxter, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+promise+of+a+DNA+taxonomy.">The promise of a DNA taxonomy.</a> Philosophical transactions of the Royal Society of London. Series B, Biological. 359 (1444), 669-679 (2004).</li><li>Wen, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Species+identification+of+dried+shellfish+(oyster,+clam+and+mussel)+products+sold+on+the+Chinese+market.">Species identification of dried shellfish (oyster, clam and mussel) products sold on the Chinese market.</a> Food Control. 90, 199-204 (2018).</li><li>Zhang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+cob+and+cox1+genes+and+editing+of+the+corresponding+mRNAs+in+Dinophysis+acuminata+from+Narragansett+Bay,+with+special+reference+to+the+phylogenetic+position+of+the+genus+Dinophysis.">Mitochondrial cob and cox1 genes and editing of the corresponding mRNAs in Dinophysis acuminata from Narragansett Bay, with special reference to the phylogenetic position of the genus Dinophysis.</a> Applied and Environmental Microbiology. 74 (5), 1546-1554 (2007).</li><li>Sell, J., Spirkovski, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+DNA+differentiation+between+two+forms+of+trout+Salmo+letnica,+endemic+to+the+Balkan+Lake+Ohrid,+reflects+their+reproductive+isolation.">Mitochondrial DNA differentiation between two forms of trout Salmo letnica, endemic to the Balkan Lake Ohrid, reflects their reproductive isolation.</a> Molecular Ecology. 13, 3633-3644 (2004).</li><li>Karadjian, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+rearranged+mitochondrial+genome+in+Nycteria+parasites+(Haemosporidia)+from+bats.">Highly rearranged mitochondrial genome in Nycteria parasites (Haemosporidia) from bats.</a> Proceedings of the National Academy of Sciences of the United States of America. 113 (35), 9834-9839 (2018).</li><li>Morga, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+genes+from+flat+oyster+Ostrea+edulis+as+suitable+housekeeping+genes+for+quantitative+real+time+PCR.">Identification of genes from flat oyster Ostrea edulis as suitable housekeeping genes for quantitative real time PCR.</a> Fish and Shellfish Immunology. 29 (6), 937-945 (2010).</li><li>Delsuc, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+systematics+of+armadillos+(Xenarthra,+Dasypodidae):+contribution+of+maximum+likelihood+and+Bayesian+analyses+of+mitochondrial+and+nuclear+genes.">Molecular systematics of armadillos (Xenarthra, Dasypodidae): contribution of maximum likelihood and Bayesian analyses of mitochondrial and nuclear genes.</a> Molecular Phylogenetics and Evolution. 28 (2), 261-265 (2005).</li><li>Wei, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+and+Biochemical+Characterization+of+UDP-Glucose+Dehydrogenase+from+Akkermansia+muciniphila.">Discovery and Biochemical Characterization of UDP-Glucose Dehydrogenase from Akkermansia muciniphila.</a> Protein &amp; Peptide Letters. 24 (8), 735-741 (2017).</li><li>Gu, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+and+Biochemical+Characterization+of+the+UDP-Xylose+Biosynthesis+Pathway+in+Sphaerobacter+thermophilus.">Discovery and Biochemical Characterization of the UDP-Xylose Biosynthesis Pathway in Sphaerobacter thermophilus.</a> Protein &amp; Peptide Letters. 23 (12), 1103-1110 (2016).</li><li>Duan, X. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+characterization+of+the+UDP-xylose+biosynthesis+pathway+in+Rhodothermus+marinus.">Functional characterization of the UDP-xylose biosynthesis pathway in Rhodothermus marinus.</a> Applied Microbiology and Biotechnology. 99 (22), 9463-9472 (2015).</li><li>Vogelstein, B., Gillespie, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparative+and+analytical+purification+of+DNA+from+agarose.">Preparative and analytical purification of DNA from agarose.</a> Proceedings of the National Academy of Sciences of the United States of America. 76 (2), 615-619 (1979).</li><li>Song, H. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UDP-glucose+4-epimerase+and+&#946;-1,4-galactosyltransferase+from+the+oyster+Magallana+gigas+as+valuable+biocatalysts+for+the+production+of+galactosylated+products.">UDP-glucose 4-epimerase and &#946;-1,4-galactosyltransferase from the oyster Magallana gigas as valuable biocatalysts for the production of galactosylated products.</a> International Journal of Molecular Sciences. 19 (6), 1600 (2018).</li><li>Gainey, P. A., Phelps, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Uridine+diphosphate+glucuronic+acid+production+and+utilization+in+various+tissues+actively+synthesizing+glycosaminoglycans.">Uridine diphosphate glucuronic acid production and utilization in various tissues actively synthesizing glycosaminoglycans.</a> Biochemical Journal. 128 (2), 215-227 (1972).</li></ol>

The authors have nothing to disclose.

The presented protocol allows the genetic identification of unreferenced oyster specimens with similar phenotype from regional seafood markets by comparison of the COX1 and ND genes with a publicly available oyster DNA genome database. The significance of this method lies in its simplicity, as only a single PCR reaction is needed for the evaluation of the virtual cDNA library. The two conserved mitochondrial COX1 and ND genes were amplified from a cDNA library which was generated by reverse transcription of RNA extracts from each oyster. The method of RNA isolation (step 2.1) was simplified by directly grinding the oyster tissue in liquid nitrogen. After sequencing the COX1 and ND genes of each specimen, sequence alignments revealed that some samples show high similarity to the reference strain. The closest relative showed complete identity of both the COX1 and the ND gene sequences.
The most critical steps of this procedure are the RNA extraction step; in order to minimize RNA degradation, it is essential to reduce the time between harvesting the oyster tissue and the RNA extraction.
Successful cloning was recently exemplified by cloning the oyster UGE gene12 and herein by cloning the MgUGD and MgUXS genes13, which validated the practicality of the generated cDNA library, allowing cloning of any number of genes of interest without the need for cumbersome cloning strategies using degenerated primers. This method of molecular identification by amplification of the COX1 and ND genes to generate virtually sequenced cDNA libraries may also be used in future applications for other biological materials that do not have physical samples of referenced genomes available.

The acquisition of living referenced biological material may be challenging due to long delivery times, entrepreneurial reasoning, or country-specific customs regulations. As an alternative, the required biological material may be also collected from phenotypically identical specimens. However, these samples may vary significantly at the level of genotype, and therefore comparisons with digitally-stored reference genomes of the same species are often rendered difficult or even futile due to incompatibility of the newly-sourced material with existing DNA amplification methods. Sequencing highly conserved genes of individual samples is a widely used and powerful tool for identifying species1, such as conserved mitochondrial genes that are frequently used as reference genes for the quality assessment of cDNA libraries2,3,4,5,6. The underlying rationale for the herein presented method is that high conservation of mitochondrial gene sequences in individual anonymous oyster samples compared to the corresponding sequences of the reference genome indicates that other genes may also show a low level of divergence, given the generally faster rate of mitochondrial DNA evolution relative to nuclear DNA7, allowing the amplification and isolation of a wide range of scientifically and industrially relevant genes by simply using publicly available sequencing data as a reference.
The overall goal of the herein described method is to present an optimized workflow for generating a virtually sequenced oyster cDNA library which can be used as template DNA for the cloning of oyster genes. In virtual sequencing, de novo genome sequencing is circumvented; instead, a known, digitally-stored reference sequence is used directly to utilize or design primers for production of cDNAs that will eventually comprise a library (or be added to a pre-existing one). The aim is to produce a convergent cDNA library, meaning that similarities between the generated cDNA sequences and the reference sequence can be ranked from low to high divergence. A key advantage of using Cytochrome C Oxidase subunit 1 (COX1) and NADH Dehydrogenase (ND) as reference genes is that even highly geographically disjunct oyster specimens can be profiled due to the high conservation of these mitochondrial genes. Having proven the approach with these well-established markers, we then demonstrate its application to two enzyme candidates which are involved in sugar nucleotide biosynthesis and may be of industrial relevance8,9,10. The biotechnological potential of the Pacific oyster is still unexplored. Thus, we believe that this converging method for preparing a virtually sequenced cDNA library will also be appropriate for non-specialist researchers who want to generate cDNA from this relevant biological material.

<table><tbody><tr><td>&lt;strong&gt;Chemicals:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>1% Triton X-100</td><td>Solarbio</td><td>9002-93-1</td><td>*Alternative distributors possible</td></tr><tr><td>2,5-Dihydroxybenzoic acid</td><td>Alfa Aesar</td><td>490-79-9</td><td>*Alternative distributors possible</td></tr><tr><td>Acetonitrile</td><td>Merck</td><td>75-05-8</td><td>*Alternative distributors possible</td></tr><tr><td>Agarose for molecular biology</td><td>Biowest Chemicals</td><td>111860</td><td>*Alternative distributors possible</td></tr><tr><td>Ampicilin</td><td>Solarbio</td><td>69-52-3</td><td>*Alternative distributors possible</td></tr><tr><td>Chloroform</td><td>Lingfeng, Shanghai</td><td>67-66-3</td><td>*Alternative distributors possible</td></tr><tr><td>DEPC water</td><td>Thermo Scientific</td><td>R0601</td><td></td></tr><tr><td>Ethanol</td><td>Jinhuada, Guangzhou</td><td>64-17-5</td><td>*Alternative distributors possible</td></tr><tr><td>Guanidinium thiocyanate-phenol reagent</td><td>Invitrogen</td><td>15596018</td><td>TRIzol reagent</td></tr><tr><td>Imidazole</td><td>Energy Chemical</td><td>288-32-4</td><td>*Alternative distributors possible</td></tr><tr><td>Isopropyl alcohol</td><td>Nanjing Chemical Reagent</td><td>67-63-0</td><td>*Alternative distributors possible</td></tr><tr><td>Isopropyl &amp;beta;-D-thiogalactopyranoside</td><td>Solarbio</td><td>367-93-1</td><td>*Alternative distributors possible</td></tr><tr><td>Kanamycin</td><td>Solarbio</td><td>25389-94-0</td><td>*Alternative distributors possible</td></tr><tr><td>LB Agar</td><td>Thermo Fisher</td><td>22700025</td><td>*Alternative distributors possible</td></tr><tr><td>LB Broth</td><td>Thermo Fisher</td><td>10855021</td><td>*Alternative distributors possible</td></tr><tr><td>Methanol</td><td>Jinhuada, Guangzhou</td><td>67-56-1</td><td>*Alternative distributors possible</td></tr><tr><td>MgCl&lt;sub&gt;2&lt;/sub&gt; hexahydrate</td><td>Xilong Huagong</td><td>7791-18-6</td><td>*Alternative distributors possible</td></tr><tr><td>NaCl</td><td>Xilong Huagong</td><td>7647-14-5</td><td>*Alternative distributors possible</td></tr><tr><td>NAD&lt;sup&gt;+&lt;/sup&gt;</td><td>Duly Biotech</td><td>53-84-9</td><td>*Alternative distributors possible</td></tr><tr><td>Phenyl-methylsulfonyl fluoride</td><td>Macklin</td><td>329-98-6</td><td>*Alternative distributors possible</td></tr><tr><td>Tris</td><td>Solarbio</td><td>77-86-1</td><td>*Alternative distributors possible</td></tr><tr><td>UDP-glucose</td><td>Wuhu Nuowei Chemicals</td><td>28053-08-9</td><td>*Alternative distributors possible</td></tr><tr><td>UDP-glucuronic acid</td><td>SIGMA</td><td>63700-19-6</td><td>*Alternative distributors possible</td></tr><tr><td>&lt;strong&gt;Tools/Instruments:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>MALDI-TOF mass spectrometer</td><td>Bruker</td><td>Autoflex</td><td>*Alternative distributors possible</td></tr><tr><td>Metal block heater</td><td>Long Yang Scientific Instruments</td><td>Thermoshaker HB20</td><td>*Alternative distributors possible</td></tr><tr><td>PCR thermocycler</td><td>Hema</td><td>9600</td><td>*Alternative distributors possible</td></tr><tr><td>&lt;strong&gt;Enzyme and Kits:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>10&amp;times;Ligation buffer</td><td>Thermo Scientific</td><td>B69</td><td>*Alternative distributors possible</td></tr><tr><td>5&amp;times;PrimeSTAR buffer</td><td>Takara</td><td>9158A</td><td></td></tr><tr><td>Alkaline phosphatase</td><td>ThermoFisher FastAP</td><td>EF0654</td><td>*Alternative distributors possible</td></tr><tr><td>COX forward primer</td><td>Genscript</td><td>ATGTCAACAAATCATTTAGACATTG</td><td></td></tr><tr><td>COX reverse primer</td><td>Genscript</td><td>ACTTGACCAAAAACATAAGACATG</td><td></td></tr><tr><td>Cutsmart Buffer</td><td>NEB</td><td>B7204S</td><td>*Alternative distributors possible</td></tr><tr><td>dNTP mix</td><td>Invitrogen</td><td>18427088</td><td></td></tr><tr><td>MgUGD forward primer</td><td>Genscript</td><td>ACATATGACCCTGTCCAAGATCTGTTGT</td><td></td></tr><tr><td>MgUGD reverse primer</td><td>Genscript</td><td>ACTCGAGACTCTGTGAGGCGGTGGAG</td><td></td></tr><tr><td>MgUXS forward primer</td><td>Genscript</td><td>CCATATGGCAGAATCCTCACAATCAC</td><td></td></tr><tr><td>MgUXS reverse primer</td><td>Genscript</td><td>ACTCGAGCACATTTTTGAATTTGCAGACGT</td><td></td></tr><tr><td>ND forward primer</td><td>Genscript</td><td>ATGAGATGGCAATTATTTTTTAAT</td><td></td></tr><tr><td>ND reverse primer</td><td>Genscript</td><td>ATGTATTTTGGAAAAATCTCCAC</td><td></td></tr><tr><td>PCR Cleanup Kit</td><td>AxyGen</td><td>AP-PCR-250</td><td>*Alternative distributors possible</td></tr><tr><td>pET-30a(+) vector</td><td>Merck Millipore</td><td>69909</td><td></td></tr></tbody></table>

a converging strategy for the generation of a virtually sequenced cdna library from unreferenced pacific oysters

The access to biological material of reference species, which were used previously in key experiments such as in the development of novel cell lines or genome sequencing projects, are often difficult to provide for further studies or third parties due to the consumptive nature of the samples. Although now widely distributed over the Pacific coasts of Asia, Australia and North America, individual Pacific oyster specimens are genetically quite diverse and are therefore not directly suitable as the starting material for gene libraries. In this article, we demonstrate the use of unreferenced Pacific oyster specimens obtained from regional seafood markets to generate cDNA libraries. These libraries were then compared to the publicly available oyster genome, and the closest related library was selected using the mitochondrial reference genes Cytochrome C Oxidase subunit I (COX1) and NADH Dehydrogenase (ND). The suitability of the generated cDNA library is also demonstrated by cloning and expression of two genes encoding the enzymes UDP-glucuronic acid dehydrogenase (UGD) and UDP-xylose synthase (UXS), which are responsible for the biosynthesis of UDP-xylose from UDP-glucose.

Figure 1 shows a schematic overview of the described preparation method of the convergent cDNA library derived from Pacific oyster individuals. Figure 2 shows the sequences of the COX1 and ND genes of a distantly related oyster specimen with high divergence from the COX1 and ND gene sequences of the reference material. Figure 3 shows the sequences of the COX1 and ND genes of a closely related oyster specimen with low divergence from the COX1 and ND gene sequences of the reference material. Figure 4 shows the successful application of the cDNA library to clone the industrially relevant genes MgUGD and MgUXS.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59462/59462fig1.jpg" /> 
Figure 1: Schematic overview of the described analysis method for molecular identification of Pacific oyster specimen using COX1 and ND as reference genes. <a href="https://www.jove.com/files/ftp_upload/59462/59462fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/59462/59462fig2.jpg" /> 
Figure 2: Sequence alignment of the COX1 and ND gene sequences of a highly-divergent specimen compared with the COX1 and ND gene sequences from the reference Pacific oyster strain. <a href="https://www.jove.com/files/ftp_upload/59462/59462fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/59462/59462fig3.jpg" /> 
Figure 3: Sequence alignment of the COX1 and ND gene sequences of a closely related specimen compared with the COX1 and ND gene sequences from the reference Pacific oyster strain. <a href="https://www.jove.com/files/ftp_upload/59462/59462fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/59462/59462fig4.jpg" /> 
Figure 4: Schematic overview of molecular cloning, recombinant expression and detection of the reaction products of MgUGD and MgUXS. <a href="https://www.jove.com/files/ftp_upload/59462/59462fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about A Converging Strategy for the Generation of a Virtually Sequenced cDNA Library from Unreferenced Pacific Oysters at JoVE.com

A Converging Strategy for the Generation of a Virtually Sequenced cDNA Library from Unreferenced Pacific Oysters

We describe a strategy for how to use RNA samples from unreferenced Pacific oyster specimens, and evaluate the genetic material by comparison with publicly available genome data to generate a virtually sequenced cDNA library.

The access to biological material of reference species, which were used previously in key experiments such as in the development of novel cell lines or ...

a-converging-strategy-for-generation-virtually-sequenced-cdna-library

Nanyang Technological University

Research

JoVE Journal

Bioengineering

5.4K Views.  Nanjing Agricultural University. We describe a strategy for how to use RNA samples from unreferenced Pacific oyster specimens, and evaluate the genetic material by comparison with publicly available genome data to generate a virtually sequenced cDNA library.

Video: A Converging Strategy for the Generation of a Virtually Sequenced cDNA Library from Unreferenced Pacific Oysters

A Universal Protocol for Large-scale gRNA Library Production from any DNA Source

The popularity of the CRISPR/Cas9 system for both genome and epigenome engineering stems from its simplicity and adaptability. An effector (the Cas9 nuclease or a nuclease-dead dCas9 fusion protein) is targeted to a specific site in the genome by a small synthetic RNA known as the guide RNA, or gRNA. The bipartite nature of the CRISPR system enables its use in screening approaches since plasmid libraries containing expression cassettes of thousands of individual gRNAs can be used to interrogate many different sites in a single experiment. 
To date, gRNA sequences for the construction of libraries have been almost exclusively generated by oligonucleotide synthesis, which limits the achievable complexity of sequences in the library and is relatively cost-intensive. Here, a detailed protocol for CORALINA (comprehensive gRNA library generation through controlled nuclease activity), a simple and cost-effective method for the generation of highly complex gRNA libraries based on enzymatic digestion of input DNA, is described. Since CORALINA libraries can be generated from any source of DNA, plenty of options for customization exist, enabling a large variety of CRISPR-based screens.

Methods for generating large-scale gRNA libraries should be simple, efficient and cost-effective. We describe a protocol for the production of gRNA libraries based on enzymatic digestion of target DNA. This method, CORALINA (comprehensive gRNA library generation through controlled nuclease activity) presents an alternative to costly custom oligonucleotide synthesis.

The popularity of the CRISPR/Cas9 system for both genome and epigenome engineering stems from its simplicity and adaptability. An effector (the Cas9 ...

Genetics

Functional Cloning Using a Xenopus Oocyte Expression System

Identification of genes responsible for embryonic induction poses a number of challenges; to name a few, secreted molecules of interest may be low in abundance, may not be secreted but tethered to the signaling cell(s), or may require the presence of binding partners or upstream regulatory molecules. Thus in a search for gene products capable of eliciting an early lens-inductive response in competent ectoderm, we utilized an expression cloning system that would allow identification of paracrine or juxtacrine factors as well as transcriptional or other regulatory proteins. Pools of mRNA were injected into Xenopus oocytes, and responding tissue placed directly on the oocytes and co-cultured. Following functional cloning of ldb1 from a neural plate stage cDNA library based on its ability to elicit the expression of the early lens placode marker foxe3 in lens-competent animal cap ectoderm, we characterized the mRNA expression pattern, and assayed developmental progression following overexpression or knockdown of ldb1. This system is suitable in a very wide variety of contexts where identification of an inducer or its upstream regulatory molecules is sought using a functional response in competent tissue.

Functional Cloning Using a Xenopus Oocyte Expression System

We describe a Xenopus oocyte and animal cap system for the expression cloning of genes capable of inducing a response in competent ectoderm, and discuss techniques for the subsequent analysis of such genes. This system is useful in the functional identification of a wide range of gene products.

Identification of genes responsible for embryonic induction poses a number of challenges; to name a few, secreted molecules of interest may be low in ...

Developmental Biology

Ultralow Input Genome Sequencing Library Preparation from a Single Tardigrade Specimen

Tardigrades are microscopic animals that enter an ametabolic state called anhydrobiosis when facing desiccation and can return to their original state when water is supplied. The genomic sequencing of microscopic animals such as tardigrades risks bacterial contamination that sometimes leads to erroneous interpretations, for example, regarding the extent of horizontal gene transfer in these animals. Here, we provide an ultralow input method to sequence the genome of the tardigrade, Hypsibius dujardini, from a single specimen. By employing rigorous washing and contaminant exclusion along with an efficient extraction of the 50 ~ 200 pg genomic DNA from a single individual, we constructed a library sequenced with a DNA sequencing instrument. These libraries were highly reproducible and unbiased, and an informatics analysis of the sequenced reads with other H. dujardini genomes showed a minimal amount of contamination. This method can be applied to unculturable tardigrades that could not be sequenced using previous methods.

Contamination during the genomic sequencing of microscopic organisms remains a large problem. Here, we show a method to sequence the genome of a tardigrade from a single specimen with as little as 50 pg of genomic DNA without whole genome amplification to minimize the risk of contamination.

Tardigrades are microscopic animals that enter an ametabolic state called anhydrobiosis when facing desiccation and can return to their original state ...

Genome-wide Surveillance of Transcription Errors in Eukaryotic Organisms

Accurate transcription is required for the faithful expression of genetic information. Surprisingly though, little is known about the mechanisms that control the fidelity of transcription. To fill this gap in scientific knowledge, we recently optimized the circle-sequencing assay to detect transcription errors throughout the transcriptome of Saccharomyces cerevisiae, Drosophila melanogaster, and Caenorhabditis elegans. This protocol will provide researchers with a powerful new tool to map the landscape of transcription errors in eukaryotic cells so that the mechanisms that control the fidelity of transcription can be elucidated in unprecedented detail.

This protocol provides researchers with a new tool to monitor the fidelity of transcription in multiple model organisms.

Accurate transcription is required for the faithful expression of genetic information. Surprisingly though, little is known about the mechanisms that ...

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

A genetic screen for mutant alleles that suppress phenotypic defects caused by a mutation is a powerful approach to identify genes that belong to closely related biochemical pathways. Previous methods such as the Synthetic Genetic Array (SGA) analysis, and random mutagenesis techniques using ultraviolet (UV) or chemicals like ethyl methanesulfonate (EMS) or N-ethyl-N- nitrosourea (ENU), have been widely used but are often costly and laborious. Also, these mutagen-based screening methods are frequently associated with severe side effects on the organism, inducing multiple mutations that add to the complexity of isolating the suppressors. Here, we present a simple and effective protocol to identify suppressor mutations in mutants which confer a growth defect in Schizosaccharomyces pombe. The fitness of cells with a growth deficiency in standard rich liquid media or synthetic liquid media can be monitored for recovery using an automated 96-well plate reader over an extended period. Once a cell acquires a suppressor mutation in the culture, its descendants outcompete those of the parental cells. The recovered cells that have a competitive growth advantage over the parental cells can then be isolated and backcrossed with the parental cells. The suppressor mutations are then identified using whole-genome sequencing. Using this approach, we have successfully isolated multiple suppressors that alleviate the severe growth defects caused by loss of Elf1, an AAA+ family ATPase that is important in nuclear mRNA transport and maintenance of genomic stability. There are currently over 400 genes in S. pombe with mutants conferring a growth defect. As many of these genes are uncharacterized, we propose that our method will hasten the identification of novel functional interactions with this user-friendly, high-throughput approach.

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

We present a simple suppressor screen protocol in fission yeast. This method is efficient, mutagen-free, and&#160; selective&#160; for&#160; mutations that&#160; often&#160; occur at&#160; &#160;a&#160; single&#160; genomic&#160; locus.&#160; The protocol is suitable for isolating suppressors that alleviate growth defects in liquid culture that are caused by a mutation or a drug.

A genetic screen for mutant alleles that suppress phenotypic defects caused by a mutation is a powerful approach to identify genes that belong to closely ...

A High-Throughput UAS-cDNA/ORF Plasmid Library Construction Using CRISPRmass

CRISPR-Based Modular Assembly for High-Throughput Construction of a UAS-cDNA/ORF Plasmid Library

Functional genomics screening offers a powerful approach to probe gene function and relies on the construction of genome-wide plasmid libraries. Conventional approaches for plasmid library construction are time-consuming and laborious. Therefore, we recently developed a simple and efficient method, CRISPR-based modular assembly (CRISPRmass), for high-throughput construction of a genome-wide upstream activating sequence-complementary DNA/open reading frame (UAS-cDNA/ORF) plasmid library. Here, we present a protocol for CRISPRmass, taking as an example the construction of a GAL4/UAS-based UAS-cDNA/ORF plasmid library. The protocol includes massively parallel two-step test tube reactions followed by bacterial transformation. The first step is to linearize the existing complementary DNA (cDNA) or open reading frame (ORF) cDNA or ORF library plasmids by cutting the shared upstream vector sequences adjacent to the 5&#39; end of cDNAs or ORFs using CRISPR/Cas9 together with single guide RNA (sgRNA), and the second step is to insert a UAS module into the linearized cDNA or ORF plasmids using a single step reaction. CRISPRmass allows the simple, fast, efficient, and cost-effective construction of various plasmid libraries. The UAS-cDNA/ORF plasmid library can be utilized for gain-of-function screening in cultured cells and for constructing a genome-wide transgenic UAS-cDNA/ORF library in Drosophila.&#160;

Author Spotlight: Simplifying Genome-Wide Plasmid Library Construction Using CRISPRmass

We present a protocol for CRISPR-based modular assembly (CRISPRmass), a method for high-throughput construction of UAS-cDNA/ORF plasmid library in Drosophila using publicly available cDNA/ORF resources. CRISPRmass can be applied to editing various plasmid libraries.

Functional genomics screening offers a powerful approach to probe gene function and relies on the construction of genome-wide plasmid libraries. ...

Single Read and Paired End mRNA-Seq Illumina Libraries from 10 Nanograms Total RNA

Whole transcriptome sequencing by mRNA-Seq is now used extensively to perform global gene expression, mutation, allele-specific expression and other genome-wide analyses. mRNA-Seq even opens the gate for gene expression analysis of non-sequenced genomes. mRNA-Seq offers high sensitivity, a large dynamic range and allows measurement of transcript copy numbers in a sample. Illumina&#x2019;s genome analyzer performs sequencing of a large number (&gt; 107) of relatively short sequence reads (&lt; 150 bp).The &quot;paired end&quot; approach, wherein a single long read is sequenced at both its ends, allows for tracking alternate splice junctions, insertions and deletions, and is useful for de novo transcriptome assembly.
One of the major challenges faced by researchers is a limited amount of starting material. For example, in experiments where cells are harvested by laser micro-dissection, available starting total RNA may measure in nanograms. Preparation of mRNA-Seq libraries from such samples have been described1, 2 but involves significant PCR amplification that may introduce bias. Other RNA-Seq library construction procedures with minimal PCR amplification have been published3, 4 but require microgram amounts of starting total RNA.
Here we describe a protocol for the Illumina Genome Analyzer II platform for mRNA-Seq sequencing for library preparation that avoids significant PCR amplification and requires only 10 nanograms of total RNA. While this protocol has been described previously and validated for single-end sequencing5, where it was shown to produce directional libraries without introducing significant amplification bias, here we validate it further for use as a paired end protocol. We selectively amplify polyadenylated messenger RNAs from starting total RNA using the T7 based Eberwine linear amplification method, coined &quot;T7LA&quot; (T7 linear amplification). The amplified poly-A mRNAs are fragmented, reverse transcribed and adapter ligated to produce the final sequencing library. For both single read and paired end runs, sequences are mapped to the human transcriptome6 and normalized so that data from multiple runs can be compared. We report the gene expression measurement in units of transcripts per million (TPM), which is a superior measure to RPKM when comparing samples7.

Here we describe a method for preparation of both single read and paired end Illumina mRNA-Seq sequencing libraries for gene expression analysis based on T7 linear RNA amplification. This protocol requires only 10 nanograms of starting total RNA and generates highly consistent libraries representing whole transcripts.

Whole transcriptome sequencing by mRNA-Seq is now used extensively to perform global gene expression, mutation, allele-specific expression and other ...

Biology

Detecting Somatic Genetic Alterations in Tumor Specimens by Exon Capture and Massively Parallel Sequencing

Efforts to detect and investigate key oncogenic mutations have proven valuable to facilitate the appropriate treatment for cancer patients. The establishment of high-throughput, massively parallel "next-generation" sequencing has aided the discovery of many such mutations. To enhance the clinical and translational utility of this technology, platforms must be high-throughput, cost-effective, and compatible with formalin-fixed paraffin embedded (FFPE) tissue samples that may yield small amounts of degraded or damaged DNA. Here, we describe the preparation of barcoded and multiplexed DNA libraries followed by hybridization-based capture of targeted exons for the detection of cancer-associated mutations in fresh frozen and FFPE tumors by massively parallel sequencing. This method enables the identification of sequence mutations, copy number alterations, and select structural rearrangements involving all targeted genes. Targeted exon sequencing offers the benefits of high throughput, low cost, and deep sequence coverage, thus conferring high sensitivity for detecting low frequency mutations.

We describe the preparation of barcoded DNA libraries and subsequent hybridization-based exon capture for detection of key cancer-associated mutations in clinical tumor specimens by massively parallel "next generation" sequencing. Targeted exon sequencing offers the benefits of high throughput, low cost, and deep sequence coverage, thus yielding high sensitivity for detecting low frequency mutations.

Efforts  to detect and investigate key oncogenic mutations have proven valuable to  facilitate the appropriate treatment for cancer patients. The ...

Next-generation Sequencing of 16S Ribosomal RNA Gene Amplicons

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the long-lasting gold standards is to sequence 16S ribosomal RNA (rRNA) gene amplicons generated by domain-level PCR reactions amplifying from genomic DNA. Traditionally, this was performed by cloning and Sanger (capillary electrophoresis) sequencing of PCR amplicons. The advent of next-generation sequencing has tremendously simplified and increased the sequencing depth for 16S rRNA gene sequencing. The introduction of benchtop sequencers now allows small labs to perform their 16S rRNA sequencing in-house in a matter of days. Here, an approach for 16S rRNA gene amplicon sequencing using a benchtop next-generation sequencer is detailed. The environmental DNA is first amplified by PCR using primers that contain sequencing adapters and barcodes. They are then coupled to spherical particles via emulsion PCR. The particles are loaded on a disposable chip and the chip is inserted in the sequencing machine after which the sequencing is performed. The sequences are retrieved in fastq format, filtered and the barcodes are used to establish the sample membership of the reads. The filtered and binned reads are then further analyzed using publically available tools. An example analysis where the reads were classified with a taxonomy-finding algorithm within the software package Mothur is given. The method outlined here is simple, inexpensive and straightforward and should help smaller labs to take advantage from the ongoing genomic revolution.

Characterizing microbial community has been a longstanding goal in environmental microbiology. Next-generation sequencing methods now allow for the characterization of microbial communities at an unprecedented depth with minimal cost and labor. We detail here our approach to sequence bacterial 16S ribosomal RNA genes using a benchtop sequencer.

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the ...

3' End Sequencing Library Preparation with A-seq2

Studies in the last decade have revealed a complex and dynamic variety of pre-mRNA cleavage and polyadenylation reactions. mRNAs with long 3&#39; untranslated regions (UTRs) are generated in differentiated cells whereas proliferating cells preferentially express transcripts with short 3&#39;UTRs. We describe the A-seq protocol, now at its second version, which was developed to map polyadenylation sites genome-wide and study the regulation of pre-mRNA 3&#39; end processing. Also this current protocol takes advantage of the polyadenylate (poly(A)) tails that are added during the biogenesis of most mammalian mRNAs to enrich for fully processed mRNAs. A DNA adaptor with deoxyuracil at its fourth position allows the precise processing of mRNA 3&#39; end fragments for sequencing. Not including the cell culture and the overnight ligations, the protocol requires about 8 h hands-on time. Along with it, an easy-to-use software package for the analysis of the derived sequencing data is provided. A-seq2 and the associated analysis software provide an efficient and reliable solution to the mapping of pre-mRNA 3&#39; ends in a wide range of conditions, from 106 or fewer cells.

This protocol describes a method for mapping pre-mRNA 3&#39; end processing sites.

A Converging Strategy for the Generation of a Virtually Sequenced cDNA Library from Unreferenced Pacific Oysters

Summary

Explore More Videos

Chapters in this video

A Universal Protocol for Large-scale gRNA Library Production from any DNA Source

Functional Cloning Using a Xenopus Oocyte Expression System

Ultralow Input Genome Sequencing Library Preparation from a Single Tardigrade Specimen

Genome-wide Surveillance of Transcription Errors in Eukaryotic Organisms

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

CRISPR-Based Modular Assembly for High-Throughput Construction of a UAS-cDNA/ORF Plasmid Library

Single Read and Paired End mRNA-Seq Illumina Libraries from 10 Nanograms Total RNA

Detecting Somatic Genetic Alterations in Tumor Specimens by Exon Capture and Massively Parallel Sequencing

Next-generation Sequencing of 16S Ribosomal RNA Gene Amplicons

3' End Sequencing Library Preparation with A-seq2