This work was supported by NIAID U19AI131126 to Dr. Isberg (Tufts University School of Medicine) and Dr. Kaplan (Tufts University); (JM is Project 2 leader) and NIAID R21AI128093 to JM. ACF was supported in part by NIAID T32AI007077. SEB and MKE were supported by NIAID U19AI116497-05. We thank members of the Mecsas lab, the Ng lab, and Dr. Isberg at Tufts University School of Medicine for useful discussions.&#160;<span style="font-size: 11pt; line-height: 115%; font-family: Calibri, sans-serif; color: black; background-image: initial; background-position: initial; background-size: initial; background-repeat: initial; background-attachment: initial; background-origin: initial; background-clip: initial;">The confocal imaging was performed at the Tufts Center for Neuroscience Research, P30 NS047243.

All methods described here have been approved by the Tufts University IBC and IRB.
1. Inducing M Cell Differentiation in Human Ileal Enteroid-derived Monolayers
NOTE: This protocol uses ileal enteroids derived from human tissue biopsy. Please refer to published protocols for methods on how to grow and passage these cells18,24. The following methods for developing monolayers were adapted from Zou et al.24. Methods for inducing M cells in ileal enteroid-derived cultures were adapted from previous reports21,22,23. All work is carried out in a sterile tissue culture hood and incubations are in hood or tissue culture incubator as indicated. See Table of Materials needed to prepare ileal enteroid monolayers and various medias.
<ol>
	<li>Grow ileal enteroids for 4-10 days in extracellular matrix (ECM) (see Table of Materials) (Figure 1), depending on their intrinsic growth rates, before seeding onto transwells.</li>
	<li>Coating transwell membranes
	<ol>
		<li>Place desired number of transwells in a 24-well plate creating a two-chamber system.</li>
		<li>Dilute ECM 25-fold in cold sterile phosphate-buffered saline (PBS) and add 100 &#181;L of cold diluted solution into each upper chamber onto the membrane. 
		NOTE: ECM and diluted ECM solution must be kept on ice until immediately before addition.</li>
		<li>Cover the 24-well plate with lid and place the plate into a tissue culture incubator at 37 &#176;C for 2 h to permit ECM solidification on the membrane.</li>
		<li>After 2 h, remove the plate from the incubator and place in a tissue culture hood. Using sterile tweezers, invert each transwell to gently remove remaining solution. Allow the membranes to airdry in hood with the lid open while cells are being collected (Steps 1.3.1- 1.3.11).</li>
	</ol>
	</li>
	<li>Dissociating the ileal enteroids into single cells
	<ol>
		<li>Remove the plate of ileal enteroids from the incubator and gently remove the culture media from each well by vacuum aspiration or with a pipette. 
		NOTE: One well of ileal enteroids containing approximately 100 healthy cysts is sufficient to seed 1.5-2 wells.</li>
		<li>Add 500 &#181;L of ice cold 0.5 mM ethylenediaminetetraacetic acid (EDTA) to each well containing ileal enteroids suspended in ECM to break up the ECM. Pipette up and down vigorously with a P1000 pipettor set at 500 &#181;L to break up ECM thereby releasing ileal enteroids into the solution. To improve dissolution of ECM, after pipetting, shake the plate vigorously at 4 &#176;C for 30 min.</li>
		<li>Collect the solution from each well into 15 mL conical tubes. 
		NOTE: Collect up to 10 wells per 15 mL conical tube for optimal single cell collection.</li>
		<li>Pellet the cells in a centrifuge at 140 x g and 4 &#176;C for 5 min. Pellet should be visible but can easily be dislodged, so slowly remove the supernatant by vacuum aspiration or with a pipette. 
		NOTE: If concerned about loss of pellet and cells, use a pipette and save the supernatant in a separate tube.</li>
		<li>To digest tight junction linkages and break up the ileal enteroids into single cells, resuspend the pellet in 500 &#181;L of room temperature trypsin per every 5 wells collected in step 1.3.3. Using a P1000, pipette up and down to disaggregate the clumps and incubate the tubes in a 37 &#176;C water bath for 5 min or less. 
		NOTE: Optimization is needed to determine the appropriate amount of time required to incubate the tubes so that the cells are broken up but not over-trypsinized to the point that they die. Use Trypan blue in step 1.3.9 to ensure that the cells are viable after trypsin treatment.</li>
		<li>Add 1 mL of Advanced DMEM/F12 with 10% Fetal Bovine Serum (FBS) per 500 &#181;L of trypsin to inactivate the trypsin.</li>
		<li>Pipette up and down with a P1000 set at 500 &#956;L at least 50 times against the side of the conical tube to further disaggregate remaining clumps into single cells.</li>
		<li>Place a 40 &#181;m cell strainer over a 50 mL conical and add 1 mL of Advanced DMEM/F12 with 10% FBS to wet the cell strainer. Pipette the single cell suspension from the 15 mL conical onto the strainer. Wash the strainer with 1 mL of Advanced DMEM/F12 with 10% FBS.</li>
		<li>Transfer the cells that went through the cell strainer from the 50 mL conical into a new 15 mL conical tube. During the centrifugation step 1.3.10, the cellular pellet will be more easily seen in a 15 mL conical tube. Count the cells using a hemocytometer. Use Trypan blue to verify that cells are still alive. Typically, &#62;95% viability is observed.</li>
		<li>While counting the cells, centrifuge the cells in the new 15 mL tube at 400 x g and room temperature for 5 min. Cell pellet should be visible. Carefully remove the supernatant with a pipette, again saving the supernatant in case the pellet becomes dislodged.</li>
		<li>Prepare modified complete growth media25 (MCMGF+ media) supplemented with 10 &#181;M Y-27632. Resuspend pelleted cells at 2.5 x 105 cells/200 &#956;L in MCMGF+. See remarks in discussion about optimizing cell seeding number. 
		NOTE: MCMGF+ media is Advanced DMEM/F12 with 75% L-Wnt3a conditioned media, 10% R-spondin conditioned media, 5% Noggin conditioned media, 1x B27 Supplement, 1x N2 Supplement, 1 mM N-acetylcysteine, 50 ng/mL mouse recombinant EGF, 500 nM A-8301, 10 nM [Leu15]-Gastrin I, 10 mM HEPES, 2 mM GlutaMAX, and 1x Penicillin/Streptomycin (optional).</li>
		<li>Ensure that the ECM-coated membranes prepared in step 1.2 have fully dried, as assessed by eye. Wash the upper chamber with 200 &#956;L of MCMGF+. Add 200 &#956;L of cell solution into each upper chamber.</li>
		<li>Add 700 &#956;L of MCMGF+ with 10 &#956;M Y-27632 to each lower chamber. Place the plate in a 37 &#176;C tissue culture incubator with 5% CO2.</li>
		<li>After 1 day of growth, remove the media from the upper chamber and replace with 200 &#956;L of fresh MCMGF+, to prevent growth of multiple cell layers.</li>
	</ol>
	</li>
	<li>Replacing medium
	<ol>
		<li>Once monolayers are ~80% confluent, usually between days 1-3 post-seeding, replace basolateral media with differentiation media (DM) for control wells (see step 1.4.2 for more detail) or with M cell media for M cell induction wells (see step 1.4.3 for more detail). Replace the media in upper chamber with DM for both conditions. 
		NOTE: DM is Advanced DMEM/F12 with 5% Noggin conditioned media, 1x B27 Supplement, 1x N2 Supplement, 1 mM N-acetylcysteine, 50 ng/mL mouse recombinant EGF, 500 nM A-8301, 10 nM [Leu15]-Gastrin I, 10 mM HEPES Buffer, 2 mM GlutaMAX, and 1x Penicillin/Streptomycin (optional). M cell media is DM supplemented with 200 ng/mL RANKL and 50 ng/mL TNF&#945;.</li>
		<li>For control wells that should not contain M cells, add 200 &#956;L of DM to the upper chamber and 700 &#956;L DM to the bottom chamber.</li>
		<li>To induce M cells, add 200 &#181;L of DM to the upper chamber and 700 &#181;L of M cell media to the bottom chamber.</li>
		<li>Replace the media every 2 days. For control wells, replace DM in the upper and lower chambers. For M cell wells, replace DM in the upper chamber and M cell media in the lower chamber. 
		NOTE: By day 7 post cell-seeding, M cells are fully induced in the monolayers.</li>
	</ol>
	</li>
</ol>
2. Verifying M Cell Differentiation by qRT-PCR
NOTE: Perform the following work at a sterile RNAse-free bench space. See Table of Materials for a list of preferred materials for qRT-PCR.
<ol>
	<li>Remove the media from upper and bottom chambers and wash the upper chamber 2x gently with 300 &#181;L of room temperature PBS.</li>
	<li>Add 300 &#181;L of Trizol to each upper chamber. Incubate at room temperature for 5 min. 
	CAUTION: Wear gloves and eye protection when using Trizol to avoid contact with skin as indicated in manufacturer&#8217;s instructions.</li>
	<li>Meanwhile, label microcentrifuge tubes for each well and add 700 &#181;L of Trizol to each tube.</li>
	<li>Collect cell homogenate by pipetting up and down 3x gently with a P1000 and transfer the contents into corresponding microcentrifuge tube. Vortex for 5 s to mix.</li>
	<li>Keep the samples at room temperature for an additional 3 min. Then store at -80 &#176;C for up to one month.</li>
	<li>Follow standard qRT-PCR methodology for RNA isolation, DNase treatment, Reverse Transcription and qRT-PCR reactions. Refer to primer list in Table of Materials.</li>
</ol>
3. Verifying M Cell Differentiation by Immunofluorescence
NOTE: Always keep the lower chamber of the plate filled with PBS so that the membranes remain wet. This procedure is performed on the bench. See Table of Materials for a list of preferred materials for immunofluorescence.
<ol>
	<li>Remove the media from the upper chamber and wash 2x gently with 300 &#181;L of room temperature PBS. Add 100 &#181;L of room temperature 4% PFA in PBS to the upper chamber. Cover the plate with foil and let stand for 25 min at room temperature. Remove 4% PFA. 
	CAUTION: 4% PFA should be properly disposed of as hazardous chemical waste.</li>
	<li>Wash the upper chamber 3x with 300 &#181;L of room temperature PBS. At this point, samples can remain at 4 &#176;C for up to a month prior to staining. Once stained, samples should be visualized within a week for best quality images.</li>
	<li>Incubate the monolayers with 100 &#181;L of 5% Bovine Serum Albumin (BSA) dissolved in PBS for 30 min in dark at room temperature to block the monolayers.</li>
	<li>Prepare GP2 primary antibody solution in 1% BSA in PBS at a dilution of 1:100. Add 100 &#181;L per well. Stain for 1 h at room temperature in the dark. Remove the solution. 
	NOTE: Do not permeabilize the monolayers before primary stain for GP2 occurs because optimal primary GP2 surface staining of M cells is achieved without permeabilization.</li>
	<li>Wash the upper chamber 3x times with 300 &#181;L of room temperature PBS.</li>
	<li>Prepare secondary stain solution of fluorescently tagged goat anti-mouse IgG at 1:200, phalloidin at 1:100 and DAPI in 1% BSA+ 0.1% triton in PBS. Add 100 &#181;L per well. Stain for 30 min at room temperature in the dark. 
	NOTE: Triton is added to the secondary stain solution to permeabilize the cells during this step for proper phalloidin stain.</li>
	<li>Wash 3x with 300 &#181;L PBS.</li>
	<li>Place a 5 &#181;L drop of mounting solution (Table of Materials) on a glass slide. Remove the well from the 24 well plate and invert. Carefully cut the membrane from the well using a scalpel. Place the membrane with the cells facing up onto the droplet of mounting solution on the glass slide. Add 10 &#181;L of mounting solution onto the top and center of the membrane and place a coverslip on top to seal the membrane between the glass slide and coverslip.</li>
	<li>Dry the slides at room temperature in the dark for 24 h. Stained slides should be visualized on confocal microscope within 1 week post-staining.</li>
</ol>

<ol>
	<li>Kraehenbuhl, J. P., Neutra, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial+M+cells:+differentiation+and+function.">Epithelial M cells: differentiation and function.</a> Annual Review of Cell and Developmental Biology. 16, 301-332 (2000).</li><li>Neutra, M. R., Frey, A., Kraehenbuhl, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial+M+cells:+gateways+for+mucosal+infection+and+immunization.">Epithelial M cells: gateways for mucosal infection and immunization.</a> Cell. 86 (3), 345-348 (1996).</li><li>Nakamura, Y., Kimura, S., Hase, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=cell-dependent+antigen+uptake+on+follicle-associated+epithelium+for+mucosal+immune+surveillance.">cell-dependent antigen uptake on follicle-associated epithelium for mucosal immune surveillance.</a> Inflammation and Regeneration. 38, 15 (2018).</li><li>Clark, M. A., Hirst, B. H., Jepson, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=M-cell+surface+beta1+integrin+expression+and+invasin-mediated+targeting+of+Yersinia+pseudotuberculosis+to+mouse+Peyer's+patch+M+cells.">M-cell surface beta1 integrin expression and invasin-mediated targeting of Yersinia pseudotuberculosis to mouse Peyer's patch M cells.</a> Infection and Immunity. 66 (3), 1237-1243 (1998).</li><li>Jensen, V. B., Harty, J. T., Jones, B. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+of+the+invasive+pathogens+Salmonella+typhimurium,+Listeria+monocytogenes,+and+Shigella+flexneri+with+M+cells+and+murine+Peyer's+patches.">Interactions of the invasive pathogens Salmonella typhimurium, Listeria monocytogenes, and Shigella flexneri with M cells and murine Peyer's patches.</a> Infection and Immunity. 66 (8), 3758-3766 (1998).</li><li>Jones, B. D., Ghori, N., Falkow, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Salmonella+typhimurium+initiates+murine+infection+by+penetrating+and+destroying+the+specialized+epithelial+M+cells+of+the+Peyer's+patches.">Salmonella typhimurium initiates murine infection by penetrating and destroying the specialized epithelial M cells of the Peyer's patches.</a> Journal of Experimental Medicine. 180 (1), 15-23 (1994).</li><li>Marra, A., Isberg, R. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Invasin-dependent+and+invasin-independent+pathways+for+translocation+of+Yersinia+pseudotuberculosis+across+the+Peyer's+patch+intestinal+epithelium.">Invasin-dependent and invasin-independent pathways for translocation of Yersinia pseudotuberculosis across the Peyer's patch intestinal epithelium.</a> Infection and Immunity. 65 (8), 3412-3421 (1997).</li><li>Ohno, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+M+cells.">Intestinal M cells.</a> Journal of Biochemistry. 159 (2), 151-160 (2016).</li><li>Kerneis, S., Bogdanova, A., Kraehenbuhl, J. P., Pringault, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conversion+by+Peyer's+patch+lymphocytes+of+human+enterocytes+into+M+cells+that+transport+bacteria.">Conversion by Peyer's patch lymphocytes of human enterocytes into M cells that transport bacteria.</a> Science. 277 (5328), 949-952 (1997).</li><li>Gullberg, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+specific+markers+and+particle+transport+in+a+new+human+intestinal+M-cell+model.">Expression of specific markers and particle transport in a new human intestinal M-cell model.</a> Biochemical and Biophysical Research Communications. 279 (3), 808-813 (2000).</li><li>Giannasca, P. J., Giannasca, K. T., Leichtner, A. M., Neutra, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+intestinal+M+cells+display+the+sialyl+Lewis+A+antigen.">Human intestinal M cells display the sialyl Lewis A antigen.</a> Infection and Immunity. 67 (2), 946-953 (1999).</li><li>Jang, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+villous+M+cells:+an+antigen+entry+site+in+the+mucosal+epithelium.">Intestinal villous M cells: an antigen entry site in the mucosal epithelium.</a> Proceedings of the National Academy of Sciences of the United States of America. 101 (16), 6110-6115 (2004).</li><li>Beloqui, A., Brayden, D. J., Artursson, P., Preat, V., des Rieux, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+human+intestinal+M-cell-like+model+for+investigating+particle,+antigen+and+microorganism+translocation.">A human intestinal M-cell-like model for investigating particle, antigen and microorganism translocation.</a> Nature Protocols. 12 (7), 1387-1399 (2017).</li><li>Martinez-Argudo, I., Jepson, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Salmonella+translocates+across+an+in+vitro+M+cell+model+independently+of+SPI-1+and+SPI-2.">Salmonella translocates across an in vitro M cell model independently of SPI-1 and SPI-2.</a> Microbiology. 154 (Pt 12), 3887-3894 (2008).</li><li>Lee, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+lab-to-lab+variability+in+Caco-2+permeability+assays.">Quantitative analysis of lab-to-lab variability in Caco-2 permeability assays.</a> European Journal of Pharmaceutics and Biopharmaceutics. 114, 38-42 (2017).</li><li>Mabbott, N. A., Donaldson, D. S., Ohno, H., Williams, I. R., Mahajan, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfold+(M)+cells:+important+immunosurveillance+posts+in+the+intestinal+epithelium.">Microfold (M) cells: important immunosurveillance posts in the intestinal epithelium.</a> Mucosal Immunology. 6 (4), 666-677 (2013).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+Lgr5+stem+cells+build+crypt-villus+structures+in+vitro+without+a+mesenchymal+niche.">Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche.</a> Nature. 459 (7244), 262-265 (2009).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+expansion+of+epithelial+organoids+from+human+colon,+adenoma,+adenocarcinoma,+and+Barrett's+epithelium.">Long-term expansion of epithelial organoids from human colon, adenoma, adenocarcinoma, and Barrett's epithelium.</a> Gastroenterology. 141 (5), 1762-1772 (2011).</li><li>Knoop, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RANKL+is+necessary+and+sufficient+to+initiate+development+of+antigen-sampling+M+cells+in+the+intestinal+epithelium.">RANKL is necessary and sufficient to initiate development of antigen-sampling M cells in the intestinal epithelium.</a> Journal of Immunology. 183 (9), 5738-5747 (2009).</li><li>Taylor, R. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lymphotoxin-independent+expression+of+TNF-related+activation-induced+cytokine+by+stromal+cells+in+cryptopatches,+isolated+lymphoid+follicles,+and+Peyer's+patches.">Lymphotoxin-independent expression of TNF-related activation-induced cytokine by stromal cells in cryptopatches, isolated lymphoid follicles, and Peyer's patches.</a> Journal of Immunology. 178 (9), 5659-5667 (2007).</li><li>de Lau, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Peyer's+patch+M+cells+derived+from+Lgr5(+)+stem+cells+require+SpiB+and+are+induced+by+RankL+in+cultured+&amp;#34;miniguts&amp;#34;.">Peyer's patch M cells derived from Lgr5(+) stem cells require SpiB and are induced by RankL in cultured &amp;#34;miniguts&amp;#34;.</a> Molecular and Cellular Biology. 32 (18), 3639-3647 (2012).</li><li>Rouch, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+Functional+Microfold+(M)+Cells+from+Intestinal+Stem+Cells+in+Primary+Human+Enteroids.">Development of Functional Microfold (M) Cells from Intestinal Stem Cells in Primary Human Enteroids.</a> PloS One. 11 (1), e0148216 (2016).</li><li>Wood, M. B., Rios, D., Williams, I. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TNF-alpha+augments+RANKL-dependent+intestinal+M+cell+differentiation+in+enteroid+cultures.">TNF-alpha augments RANKL-dependent intestinal M cell differentiation in enteroid cultures.</a> American Journal of Physiology: Cell Physiology. 311 (3), C498-C507 (2016).</li><li>Zou, W. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+Intestinal+Enteroids:+New+Models+to+Study+Gastrointestinal+Virus+Infections.">Human Intestinal Enteroids: New Models to Study Gastrointestinal Virus Infections.</a> Methods in Molecular Biology. , (2017).</li><li>Kozuka, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Characterization+of+a+Human+and+Mouse+Intestinal+Epithelial+Cell+Monolayer+Platform.">Development and Characterization of a Human and Mouse Intestinal Epithelial Cell Monolayer Platform.</a> Stem Cell Reports. 9 (6), 1976-1990 (2017).</li><li>Barker, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+stem+cells+in+small+intestine+and+colon+by+marker+gene+Lgr5.">Identification of stem cells in small intestine and colon by marker gene Lgr5.</a> Nature. 449 (7165), 1003-1007 (2007).</li><li>Mantis, N. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+adherence+of+IgA+to+murine+Peyer's+patch+M+cells:+evidence+for+a+novel+IgA+receptor.">Selective adherence of IgA to murine Peyer's patch M cells: evidence for a novel IgA receptor.</a> Journal of Immunology. 169 (4), 1844-1851 (2002).</li><li>Rios, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antigen+sampling+by+intestinal+M+cells+is+the+principal+pathway+initiating+mucosal+IgA+production+to+commensal+enteric+bacteria.">Antigen sampling by intestinal M cells is the principal pathway initiating mucosal IgA production to commensal enteric bacteria.</a> Mucosal Immunology. 9 (4), 907-916 (2016).</li><li>Miller, H., Zhang, J., Kuolee, R., Patel, G. B., Chen, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+M+cells:+the+fallible+sentinels?.">Intestinal M cells: the fallible sentinels?.</a> World Journal of Gastroenterology. 13 (10), 1477-1486 (2007).</li><li>Heijmans, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ER+stress+causes+rapid+loss+of+intestinal+epithelial+stemness+through+activation+of+the+unfolded+protein+response.">ER stress causes rapid loss of intestinal epithelial stemness through activation of the unfolded protein response.</a> Cell Reports. 3 (4), 1128-1139 (2013).</li></ol>

The authors have nothing to disclose.

To develop monolayers that differentiate properly into the major intestinal cell types and M cells, it is critical to be aware of several factors. Ileal enteroids must be harvested from ECM cultures that are undifferentiated and have a high proportion of Lgr5+ stem cells. Visually, the majority of the ileal enteroids in the ECM cultures should not be darkened and multilobular, and LGR5 expression should be detected in these cultures by qRT-PCR analysis. Quality control of conditioned media is essential for the propagation of undifferentiated cultures over time and must be completed for each batch of conditioned media that is produced. Quality control can be completed by testing a new batch of media on some ECM cultures and comparing the morphology of the ileal enteroids to a previous batch of media over the course of a week. LGR5 expression should remain relatively similar in the ileal enteroid cultures grown in the new batch of media compared to the previous batch.
During preparation of the ileal enteroids for seeding as monolayers, it is important to vigorously pipette the cell solution after incubation with trypsin to break up the ileal enteroids into single cells. Cell clumps can lead to multi-layer formation when seeded for monolayers. In addition, it is essential to empirically determine the number of cells required to form a monolayer for each individual ileal enteroid line that is obtained. Typically, this value can range from 2.5 x 105 &#8211; 5.0 x 105 cells/well but depends on the degree of cystic to non-cystic ileal enteroids in cultures and varies for each individual ileal enteroid line. From experience, ileal enteroids grown in ECM that appear less cystic require higher cell seeding density to achieve monolayers. It is advisable to wash the upper chamber after 1 day of growth by gently pipetting the media up and down 2-3 times and replacing with fresh growth media. This process dislodges cells that have landed on top of other cells reducing the likelihood of multi-layer formation. Switching the media in the upper chamber from growth media to M cell media when the monolayers are ~80% confluent, which usually occurs at day 2 post-seeding, helps achieve good M cell differentiation. Addition of RANKL/TNF&#945; to the upper chamber during M cell induction does not lead to the development of a greater number of M cells per monolayer and therefore can be left out of the upper chamber media. Transwells of varying pore sizes can be used in this protocol without affecting M cell development; however, cell seeding density must be optimized for those with larger pore sizes. Collagen IV can be substituted for ECM as a basement membrane protein coating for transwells or well plates which may be better suited for certain applications.
Ileal enteroid-derived monolayers on transwells provide a two-chamber system that allows for the creation of defined apical and basolateral surfaces such that the 4-5 different types of epithelial intestinal cells can polarize to express surface markers on each side relative to that found in the intestine. Additional factors can be added to either side such as particles, infectious agents, or other cell types. However, to date some limitations remain. As described, this system is a static system that lacks physiological flow, intestinal contractions, and intestinal contents. In addition, the villus-crypt architecture is lost by the formation of a flat monolayer. These systems lack Peyer&#8217;s patch regions, immune cells, and stromal cells. Whether the lack of immune and stromal cells residing closely underneath M cells affects the invaginations which are not observed in this system and other physiological functioning is an important future area of investigation. This protocol can be adapted to a 96-well plate or a multi-well plate format. The procedure for coating the 96-well plate with ECM and seeding with single cells from ileal enteroids remains the same as for transwells. Titration of the cell seeding density required to obtain monolayers must be done, but typically ranges from 1.0 x 105 &#8211; 3.0 x 105 cells/well in a 96-well plate format. M cells are induced by replacing the growth media with M cell media when the monolayers are 80% confluent typically by days 1-3 depending on initial cell seeding density.
This method of differentiating M cells from ileal enteroids in vitro provides significant improvements over the Caco-2 method. The ileal enteroids are primary cells and at least 4-5 epithelial cells types are present in the system. In addition, ileal enteroid lines derived from different people can be studied to investigate how genetics or disease state influence M cell development and behavior. Additional manipulation of the ileal enteroids during M cell differentiation will allow a better understanding of M cell development including characterizing M cell precursor cells. Finally, since the molecular mechanisms of M cell phagocytosis and transcytosis are still not completely understood3,29, this model provides the opportunity to study and visualize antigen and particle uptake by M cells.

M (microfold) cells are specialized intestinal epithelial cells found primarily in the follicle associated epithelium (FAE) of the intestine overlying small lymphoid regions termed Peyer&#8217;s patches1. M cells have short irregular apical microvilli and are deeply invaginated on their basolateral side, which allows immune cells to reside closely to their cell body2. This unique morphology enables M cells to sample antigen from the apical lumen of the intestine and deliver it directly to the underlying immune cells2. In this way, M cells are important for immune surveillance in the intestine but can also be exploited by pathogens for entry into the lamina propria1,2,3,4,5,6,7.
The study of M cells has been hindered by several factors. First, M cells are found at a low frequency in the mouse and human intestine8. In cultured cells systems, M cell-like cells have been induced to differentiate by co-culturing a polarized adenocarcinoma cell line, Caco-2, with either B lymphocytes from mouse Peyer&#8217;s patches or the B cell lymphoma cell line, Raji B9,10. This results in a subset of Caco-2 cells that express the M cell markers Sialyl Lewis A antigen and UEA-1 in the polarized epithelium9,10. (These markers are also expressed on goblet cells in intestinal tissues, so nowadays are less frequently used as definitive M cell markers11,12.) This Caco-2-M cell system has been used to study particle uptake and bacteria translocation13,14. However, Caco-2 cells are an established cell line from a large intestinal adenocarcinoma with the confounding factor that different sources of Caco-2 cells display different phenotypes among labs15. Further, they may not fully recapitulate the transcription levels of true M cells, as they lack expression of currently known M cell markers GP2 and SpiB16. Therefore, additional and more physiologically relevant culture models are needed to be able to study M cell development and functions.
Within the past ten years, the field of enteroid-derived model systems of the intestine has rapidly been progressing forward from the initial discovery that intestinal stem cells derived from human intestinal biopsy could self-propagate and self-renew in culture17,18. Importantly, removal of stem cell promoting factors from the growth media allows these stem cell cultures to differentiate into the many cell types found in the intestine18. Furthermore, recent work suggests the importance of RANKL-RANK signaling in M cell development in the intestine19,20. The RANK receptor is a member of the TNF family of receptors that is expressed on epithelial precursor cells in the intestine19 while RANKL (the RANK receptor ligand) is released by stromal cells of the Peyer&#8217;s patches20. Since the epithelial cell types present in ileal enteroids do not produce RANKL, M cell differentiation in ileal enteroid cultures can be induced by the addition of RANKL to the culture media21,22. Inclusion of TNF&#945; in the culture media helps support M cell development in ileal enteroids23. Here, we describe the methods for inducing differentiation of M cells in intestinal monolayers derived from human ileal enteroids. Our methods are based in part on modifications from the following protocols21,22,23.

<table>
	<tbody>
		<tr>
			<td>[Leu15]-Gastrin I</td>
			<td>Sigma-Aldrich</td>
			<td>G9145</td>
			<td>MCMGF+ and DM ingredient 
			Solvent: PBS 
			Stock Concentration: 10 &#181;M 
			Final Concentration: 10 nM</td>
		</tr>
		<tr>
			<td>0.5M EDTA</td>
			<td>Invitrogen</td>
			<td>15575020</td>
			<td>For breaking up ECM 
			Solvent: PBS 
			Stock Concentration: 0.5 M 
			Final Concentration: 0.5 mM</td>
		</tr>
		<tr>
			<td>40 &#181;m cell strainer</td>
			<td>Corning</td>
			<td>352340</td>
			<td>For excluding clumps from single cells 
			Solvent: 
			Stock Concentration: 
			Final Concentration:</td>
		</tr>
		<tr>
			<td>A-8301</td>
			<td>Sigma-Aldrich</td>
			<td>SML0788-5MG</td>
			<td>MCMGF+ and DM ingredient 
			Solvent: DMSO 
			Stock Concentration: 500 &#181;M 
			Final Concentration: 500 nM</td>
		</tr>
		<tr>
			<td>Advanced DMEM/F12</td>
			<td>Invitrogen</td>
			<td>12634-028</td>
			<td>MCMGF+ and DM Basal medium 
			Solvent: 
			Stock Concentration: 
			Final Concentration:</td>
		</tr>
		<tr>
			<td>Alexa Fluor 594 goat anti-mouse IgG</td>
			<td>Thermo Fisher</td>
			<td>A-11005</td>
			<td>For secondary stain 
			Solvent: 
			Stock Concentration: 
			Final Concentration: 1:200</td>
		</tr>
		<tr>
			<td>Alexa Fluor 647 Phalloidin</td>
			<td>Invitrogen</td>
			<td>A22287</td>
			<td>Optional secondary stain for F-actin 
			Solvent: 
			Stock Concentration: 
			Final Concentration: 1:100</td>
		</tr>
		<tr>
			<td>B27 Supplement</td>
			<td>Invitrogen</td>
			<td>17504-044</td>
			<td>MCMGF+ and DM ingredient 
			Solvent: 
			Stock Concentration: 50x 
			Final Concentration: 1x</td>
		</tr>
		<tr>
			<td>Bovine Serum Albumin</td>
			<td>Chem-Impex</td>
			<td>00535</td>
			<td>5% for blocking solution 
			Solvent: PBS 
			Stock Concentration: 
			Final Concentration: 0.01</td>
		</tr>
		<tr>
			<td>Chloroform</td>
			<td>Fisher Scientific</td>
			<td>C298-500</td>
			<td>For RNA isolation 
			Solvent: 
			Stock Concentration: 
			Final Concentration:</td>
		</tr>
		<tr>
			<td>Circle coverslips</td>
			<td>Thomas Scientific</td>
			<td>1157B50</td>
			<td>For mounting membrane on glass slide 
			Solvent: 
			Stock Concentration: 
			Final Concentration:</td>
		</tr>
		<tr>
			<td>DAPI (4&#8242;,6-diamidino-2-phenylindole)</td>
			<td>Thermo Fisher</td>
			<td>62247</td>
			<td>For secondary stain 
			Solvent: PBS 
			Stock Concentration: 100x 
			Final Concentration: 1x</td>
		</tr>
		<tr>
			<td>DEPC Treated RNAse free H2O</td>
			<td>Fisher Scientific</td>
			<td>BP561-1</td>
			<td>For RNA isolation 
			Solvent: 
			Stock Concentration: 
			Final Concentration:</td>
		</tr>
		<tr>
			<td>DNA Removal Kit</td>
			<td>Invitrogen</td>
			<td>AM1906</td>
			<td>For RNA isolation 
			Solvent: 
			Stock Concentration: 
			Final Concentration:</td>
		</tr>
		<tr>
			<td>Ethyl Alcohol, 200 proof</td>
			<td>Sigma Aldrich</td>
			<td>EX0276-4</td>
			<td>For RNA isolation 
			Solvent: 
			Stock Concentration: 
			Final Concentration:</td>
		</tr>
		<tr>
			<td>Feather Scalpels</td>
			<td>VWR</td>
			<td>100499-580</td>
			<td>For cutting membrane from transwells 
			Solvent: 
			Stock Concentration: 
			Final Concentration:</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Gibco</td>
			<td>26140079</td>
			<td>For inactivating trypsin 
			Solvent: Advanced DMEM/F12 
			Stock Concentration: 1 
			Final Concentration: 0.1</td>
		</tr>
		<tr>
			<td>Glass slides</td>
			<td>Mercedes Scientific</td>
			<td>MER 7200/90/WH</td>
			<td>For mounting membrane on glass slide 
			Solvent: 
			Stock Concentration: 
			Final Concentration:</td>
		</tr>
		<tr>
			<td>GlutaMAX</td>
			<td>Invitrogen</td>
			<td>35050-061</td>
			<td>MCMGF+ and DM ingredient 
			Solvent: 
			Stock Concentration: 200 mM 
			Final Concentration: 2 mM</td>
		</tr>
		<tr>
			<td>GP2 Antibody</td>
			<td>MBL International</td>
			<td>D277-3</td>
			<td>Surface stain for M cells 
			Solvent: 
			Stock Concentration: 
			Final Concentration: 1:100</td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Invitrogen</td>
			<td>15630-080</td>
			<td>MCMGF+ and DM ingredient 
			Solvent: 
			Stock Concentration: 1 M 
			Final Concentration: 10 mM</td>
		</tr>
		<tr>
			<td>Human Serum IgA</td>
			<td>Lee BioSolutions</td>
			<td>340-12-1</td>
			<td>For functional analysis of M cells 
			Solvent: PBS 
			Stock Concentration: 1 mg/mL 
			Final Concentration: 10 &#181;g</td>
		</tr>
		<tr>
			<td>L-Wnt3a conditioned media</td>
			<td>Cell line from ATCC</td>
			<td>CRL-2647</td>
			<td>Refer to ATCC Product Sheet for L Wnt&#173;3A (ATCC CRL2647) for conditioned media protocol; MCMGF+ ingredient 
			Solvent: 
			Stock Concentration: 
			Final Concentration: 75% in MCMGF+ 
			0% in DM</td>
		</tr>
		<tr>
			<td>Matrigel, GFR, phenol free</td>
			<td>Corning</td>
			<td>356231</td>
			<td>Extracellular Matrix (ECM) 
			Solvent: 
			Stock Concentration: 
			Final Concentration:</td>
		</tr>
		<tr>
			<td>Mouse recombinant EGF</td>
			<td>Invitrogen</td>
			<td>PMG8043</td>
			<td>MCMGF+ and DM ingredient 
			Solvent: PBS 
			Stock Concentration: 50 &#181;g/mL 
			Final Concentration: 50 ng/mL</td>
		</tr>
		<tr>
			<td>N2 Supplement</td>
			<td>Invitrogen</td>
			<td>17502-048</td>
			<td>MCMGF+ and DM ingredient 
			Solvent: 
			Stock Concentration: 100x 
			Final Concentration: 1x</td>
		</tr>
		<tr>
			<td>N-acetylcysteine</td>
			<td>Sigma-Aldrich</td>
			<td>A9165-5G</td>
			<td>MCMGF+ and DM ingredient 
			Solvent: H2O 
			Stock Concentration: 500 mM 
			Final Concentration: 1 mM</td>
		</tr>
		<tr>
			<td>Noggin conditioned media</td>
			<td>Cell line gift from Dr. Gijs van den Brink (University of Amsterdam)</td>
			<td></td>
			<td>Ref 30 for conditioned media protocol; MCMGF+ and DM Ingredient 
			Solvent: 
			Stock Concentration: 
			Final Concentration: 5% in MCMGF+ 
			5% in DM</td>
		</tr>
		<tr>
			<td>Paraformaldehyde (PFA)</td>
			<td>MP Biomedicals</td>
			<td>2199983</td>
			<td>For fixing monolayers 
			Solvent: PBS 
			Stock Concentration: 0.16 
			Final Concentration: 0.04</td>
		</tr>
		<tr>
			<td>PBS, -Mg, -Ca</td>
			<td>Corning</td>
			<td>MT21040CV</td>
			<td>Solvent for 0.5 mM EDTA 
			Solvent: 
			Stock Concentration: 
			Final Concentration:</td>
		</tr>
		<tr>
			<td>Penicillin/Streptomycin</td>
			<td>Invitrogen</td>
			<td>15140-122</td>
			<td>Optional ingredient of MCMGF+ and DM 
			Solvent: 
			Stock Concentration: 100x 
			Final Concentration: 1x</td>
		</tr>
		<tr>
			<td>Prolong Gold</td>
			<td>Invitrogen</td>
			<td>P36930</td>
			<td>Antifade mounting solution 
			Solvent: 
			Stock Concentration: 
			Final Concentration:</td>
		</tr>
		<tr>
			<td>Qiagen RNeasy Kit</td>
			<td>Qiagen</td>
			<td>74106</td>
			<td>For RNA isolation 
			Solvent: 
			Stock Concentration: 
			Final Concentration:</td>
		</tr>
		<tr>
			<td>Recombinant human RANKL</td>
			<td>Peprotech</td>
			<td>310-01</td>
			<td>Used to induce M cells 
			Solvent: H2O 
			Stock Concentration: 0.1 mg/mL 
			Final Concentration: 200 ng/mL</td>
		</tr>
		<tr>
			<td>Recombinant murine TNFa</td>
			<td>Peprotech</td>
			<td>315-01A</td>
			<td>Used to induce M cells 
			Solvent: H2O 
			Stock Concentration: 5 mg/mL 
			Final Concentration: 50 ng/mL</td>
		</tr>
		<tr>
			<td>R-spondin conditioned media</td>
			<td>Cell line from Trevigen</td>
			<td>3710-001-01</td>
			<td>Refer to Trevigen Cultrex Rspo1 Cells product manual (HA-R-Spondin1 293T cell line) for conditioned media protocol; MCMGF+ Ingredient 
			Solvent: 
			Stock Concentration: 
			Final Concentration: 10% in MCMGF+ 
			0% in DM</td>
		</tr>
		<tr>
			<td>Secondary anti-human IgA antibody</td>
			<td>Jackson Immuno Research</td>
			<td>109-545-011</td>
			<td>For secondary stain 
			Solvent: 
			Stock Concentration: 
			Final Concentration: 1:200</td>
		</tr>
		<tr>
			<td>Super Script IV Reverse Transcriptase</td>
			<td>Thermo Fisher</td>
			<td>18091200</td>
			<td>For conversion of RNA to DNA 
			Solvent: 
			Stock Concentration: 
			Final Concentration:</td>
		</tr>
		<tr>
			<td>Transwell inserts, 24 well-sized</td>
			<td>Greiner Bio-One</td>
			<td>662641</td>
			<td>0.4 &#181;m pore size 
			Solvent: 
			Stock Concentration: 
			Final Concentration:</td>
		</tr>
		<tr>
			<td>TritonX-100</td>
			<td>Sigma-Aldrich</td>
			<td>T8787</td>
			<td>Not required during GP2 primary stain 
			Solvent: 1% BSA 
			Stock Concentration: 
			Final Concentration: 0.001</td>
		</tr>
		<tr>
			<td>TRIzol</td>
			<td>Invitrogen</td>
			<td>15596018</td>
			<td>For RNA isolation 
			Solvent: 
			Stock Concentration: 
			Final Concentration:</td>
		</tr>
		<tr>
			<td>TrypLE Express</td>
			<td>Invitrogen</td>
			<td>12605010</td>
			<td>Trypsin for breaking up enteroids into single cells 
			Solvent: 
			Stock Concentration: 
			Final Concentration:</td>
		</tr>
		<tr>
			<td>Y-27632</td>
			<td>Sigma-Aldrich</td>
			<td>Y-0503</td>
			<td>MCMGF+ ingredient on day 0 
			Solvent: H2O 
			Stock Concentration: 5 mM 
			Final Concentration: 10 &#181;M</td>
		</tr>
		<tr>
			<td>GAPDH forward primer</td>
			<td></td>
			<td></td>
			<td>CATGAGAAGTATGACAACAGCCT</td>
		</tr>
		<tr>
			<td>GAPDH reverse primer</td>
			<td></td>
			<td></td>
			<td>CGTTTCCCGCAAGACGTAAC</td>
		</tr>
		<tr>
			<td>GP2 forward primer</td>
			<td></td>
			<td></td>
			<td>CAATGTGCCTACCCACTGGA</td>
		</tr>
		<tr>
			<td>GP2 reverse primer</td>
			<td></td>
			<td></td>
			<td>ATGGCACCCACATACAGCAC</td>
		</tr>
		<tr>
			<td>LYZ forward primer</td>
			<td></td>
			<td></td>
			<td>CGCTACTGGTGTAATGATGG</td>
		</tr>
		<tr>
			<td>LYZ reverse primer</td>
			<td></td>
			<td></td>
			<td>TTTGCACAAGCTACAGCATC</td>
		</tr>
		<tr>
			<td>MUC2 forward primer</td>
			<td></td>
			<td></td>
			<td>ATGCCCTTGCGTCCATAACA</td>
		</tr>
		<tr>
			<td>MUC2 reverse primer</td>
			<td></td>
			<td></td>
			<td>AGGAGCAGTGTCCGTCAAAG</td>
		</tr>
		<tr>
			<td>SI forward primer</td>
			<td></td>
			<td></td>
			<td>TCCAGCTACTACTCGTGTGAC</td>
		</tr>
		<tr>
			<td>SI reverse primer</td>
			<td></td>
			<td></td>
			<td>CCCTCTGTTGGGAATTGTTCTG</td>
		</tr>
		<tr>
			<td>SPIB forward primer</td>
			<td></td>
			<td></td>
			<td>CAGCAGCCGCTTTTAGCCAC</td>
		</tr>
		<tr>
			<td>SPIB reverse primer</td>
			<td></td>
			<td></td>
			<td>GCATATGCCGGGGGAACC</td>
		</tr>
	</tbody>
</table>

induced differentiation of m cell-like cells in human stem cell-derived ileal enteroid monolayers

M (microfold) cells of the intestine function to transport antigen from the apical lumen to the underlying Peyer&#8217;s patches and lamina propria where immune cells reside and therefore contribute to mucosal immunity in the intestine. A complete understanding of how M cells differentiate in the intestine as well as the molecular mechanisms of antigen uptake by M cells is lacking. This is because M cells are a rare population of cells in the intestine and because in vitro models for M cells are not robust. The discovery of a self-renewing stem cell culture system of the intestine, termed enteroids, has provided new possibilities for culturing M cells. Enteroids are advantageous over standard cultured cell lines because they can be differentiated into several major cell types found in the intestine, including goblet cells, Paneth cells, enteroendocrine cells and enterocytes. The cytokine RANKL is essential in M cell development, and addition of RANKL and TNF-&#945; to culture media promotes a subset of cells from ileal enteroids to differentiate into M cells. The following protocol describes a method for the differentiation of M cells in a transwell epithelial polarized monolayer system of the intestine using human ileal enteroids. This method can be applied to the study of M cell development and function.

Ileal enteroids grown in ECM are analyzed visually and by qRT-PCR for their relative health status and differentiation states as a means of quality control for ileal enteroid cultures and for use in monolayers. Undifferentiated ileal enteroids grown in ECM appear clear and cystic in morphology, indicating the presence of many stem cells (Figure 1A). Over time, undifferentiated ileal enteroids grown in growth media may take on an intermediate phenotype where some will appear cystic and some appear opaque (Figure 1B). Frequently, our undifferentiated samples resemble those shown in Figure 1B rather than Figure 1A. These intermediate cultures contain more terminally differentiated enterocytes as measured by expression of the enterocyte marker, sucrase isomaltase (SI), and presumably extruded dead enterocytes in the lumen contribute to their dense appearance. Ileal enteroids can be used in this intermediate state for monolayer development, but it must be kept in mind that the quantity of intestinal stem cells present in the cultures may be low, and some differentiated cell types may be present (for example, see qRT-PCR levels in undifferentiated samples grown in ECM resembling Figure 1B in Figure 2). For comparison, ileal enteroids cultured with differentiation media in ECM for 5+ days will appear uniformly darkened and lobular and cultures with this morphology are not good candidates for seeding monolayers (Figure 1C).
Expression of stem cell genes and genes of intestinal cell differentiation can be analyzed by qRT-PCR as another means to assess the health status of ileal enteroids grown in ECM and their differentiation capabilities once seeded as monolayers on transwells. The expression of a stem cell gene, LGR5, an enterocyte gene, SI, a goblet cell gene, MUC2, and a Paneth cell gene, LYZ, is compared between undifferentiated ileal enteroid cultures grown in ECM and differentiated ileal enteroid monolayers in the presence or absence of RANKL/TNF&#945; (Figure 2). While the values may differ between experiments, expression of LGR5 should decrease after differentiation of monolayers18,26. LGR5 expression is usually not detected in the differentiated ileal monolayers without RANKL and TNF&#945; by day 7. Conversely, expression of markers of differentiation of specific cell types, such SI and MUC2, increase after differentiation18. Expression of LYZ generally decreases after differentiation in our cultures. If the ileal enteroid cultures used for making monolayers look more like Figure 1B than Figure 1A, increases in intestinal differentiation markers may be modest after differentiation because these initial cultures are heterogeneous in intestinal cell types and have a higher basal level of SI and MUC2. However, differentiation in monolayers still occurs as assessed by loss of LGR5 expression and microscopy (see below). Furthermore, addition of RANKL and TNF&#945; to the differentiation media reduces the loss of LGR5 expression (Figure 2). In parallel, the expression of SI and MUC2 are slightly lower than in the differentiated condition lacking RANKL and TNF&#945; although their levels increase above the undifferentiated condition.
M cell differentiation in monolayers is determined both by qRT-PCR and immunofluorescence using two M cell specific markers including cell surface glycoprotein 2 (GP2) and transcription factor SpiB21. Expression of GP2 and SPIB is upregulated in the ileal enteroid-derived monolayers in the presence of RANKL and TNF&#945; and is not detected in non-RANKL and TNF&#945; treated samples (Figure 3). Expression of these markers can also be normalized to a piece of small bowel tissue22, if available. This permits the fold change of these M cell markers to be compared to tissue that has M cells rather than to control monolayers that have no expression of these markers and allows standardization between experiments in one lab. M cells are also detected by surface expression of GP2 by immunofluorescence (Figure 4). Typically, in a confluent monolayer, 1 to 5 M cells are observed in a given microscope field at 40X magnification by days 6 through 8 post-seeding in samples treated with RANKL and TNF&#945; (Figure 4A-D). No GP2 expression is seen in the untreated samples (Figure 4E). The orthogonal view of the XZ plane overlaid with a phalloidin probe shows actin structures surrounding each cell and GP2 expression on the apical surface of M cells (Figure 4F-G). This model recapitulates the low frequency of M cells found in the human intestine1,2,8. To purify and isolate M cells for further study, M cells can be stained using GP2 surface expression and sorted using FACS for GP2+ cells.
M cells bind to and transport antigen from the intestinal lumen to the immune cells residing beneath the epithelium2. Secretory IgA produced in the intestine binds to bacteria and can bind to the apical surface of M cells to facilitate transport of the microbes27,28. To determine if the M cells developed in this model are able to bind to IgA, human serum IgA is added to the upper chamber, allowed to bind for 1 h, and then the monolayers are prepared for immunofluorescence analysis. The presence of IgA on M cells is visualized using a fluor-conjugated secondary antibody that recognizes the heavy chain of human serum IgA. M cells treated with IgA for 1 h have IgA bound to the apical surface (Figure 5A), whereas M cells in control wells that were only treated with the secondary antibody to IgA have no detectable signal (Figure 5B). Further, IgA specifically binds to the apical surface of M cells and is not found bound to any cells lacking GP2 surface stain. In addition, M cells have characteristically shorter dense actin on their apical surface2. To analyze M cell morphology in this model, ileal enteroid-derived monolayers are grown for 7 days and harvested for immunofluorescence analysis of F-actin using phalloidin. Measurements of actin pixel intensity are calculated for M cells and for non-M cells that are directly adjacent to each M cell using ImageJ software (Figure 6A). Actin intensity is reduced on GP2+ M cells in this model and a representative image is shown in Figure 6B. Overall, the M cells developed in this ileal enteroid-derived monolayer model have characteristic gene expression, morphology and some M cell functions of human intestinal M cells, such as binding to IgA.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59894/59894fig01.jpg" /> 
Figure 1: Representative morphology of human ileal enteroids in ECM one-week post-splitting.&#160;(A) Clear and cystic undifferentiated ileal enteroids. (B) Intermediate phenotype with some cystic ileal enteroids and some opaque lobular ileal enteroids. (C) Darkened and lobular differentiated ileal enteroids. Images taken through the lens of an optical light microscope at 4x magnification using an iPhone7 camera. <a href="https://www.jove.com/files/ftp_upload/59894/59894fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/59894/59894fig02.jpg" /> 
Figure 2: Relative expression of stem cell and differentiation markers of human ileal enteroids grown in ECM or differentiated as monolayers.&#160;Ileal enteroids were grown for 7 days in ECM (Undifferentiated) or grown and differentiated as monolayers without (Differentiated) or with RANKL and TNF&#945; (Differentiated +R/T). Ileal enteroid cultures or monolayers were harvested in Trizol for RNA extraction. Gene expression was determined by qRT-PCR and is expressed relative to GAPDH. Data is average of 3 independent wells of ileal enteroids or monolayers per condition. Error bars indicate SEM. ND is not detected. Statistical significance was determined on log-transformed values using one-way ANOVA with Dunnett&#39;s multiple comparisons test comparing to the Undifferentiated. ** p &#60; 0.01, *** p &#60; 0.001 <a href="https://www.jove.com/files/ftp_upload/59894/59894fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/59894/59894fig03.jpg" /> 
Figure 3: Relative expression of M cell specific markers GP2 and SPIB from human ileal enteroid-derived monolayers.&#160;RANKL/TNF&#945; treated and non-treated human ileal enteroid-derived monolayers were harvested in Trizol for RNA extraction after 7 days post-seeding. Gene expression was determined by qRT-PCR and is expressed relative to GAPDH. Data is average of 6 independent monolayers per condition. Error bars indicate SEM. ND is not detected. <a href="https://www.jove.com/files/ftp_upload/59894/59894fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/59894/59894fig04.jpg" /> 
Figure 4: Immunofluorescence of surface GP2 expression on M cells in human ileal enteroid-derived monolayers over time.&#160;RANKL/TNF&#945; treated and non-treated human ileal enteroid-derived monolayers were fixed in 4% PFA and stained for immunofluorescence on various indicated days post-seeding. Images were analyzed using ImageJ software. DAPI = Blue; Glycoprotein 2 (GP2) = Red. (A-D) RANKL/TNF&#945; treated monolayers at various days post-seeding. (E) Non-treated monolayer harvested at day 7 post-seeding. (F-G) Orthogonal XZ plane of monolayers at day 7 post-seeding overlaid with phalloidin probe for F-actin. Phalloidin = Cyan. <a href="https://www.jove.com/files/ftp_upload/59894/59894fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/59894/59894fig05.jpg" /> 
Figure 5: IgA binds specifically to the apical surface of M cells.&#160;RANKL/TNF&#945;-treated human ileal enteroid-derived monolayers were grown for 7 days and then (A) treated with 10 &#956;g of human serum IgA for 1 h or (B) mock-treated with PBS only (No IgA control). After 1 h, monolayers were washed 2x in PBS, were fixed in 4% PFA, permeabilized with 0.1% TritonX-100, and stained for immunofluorescence. Images were analyzed using ImageJ software and are representative of 3 independent experiments. DAPI = Blue; Glycoprotein 2 (GP2) = Red; Antibody to human serum IgA = Green; Phalloidin = Cyan. Black arrows denote IgA bound to apical surface of M cell. <a href="https://www.jove.com/files/ftp_upload/59894/59894fig05large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/59894/59894fig06.jpg" /> 
Figure 6: M cells have reduced actin intensity compared to adjacent non-M cells.&#160;RANKL/TNF&#945;-treated human ileal enteroid-derived monolayers were grown for 7 days and then fixed in 4% PFA and were stained for immunofluorescence. (A) Using ImageJ, GP2+ M cells were outlined using the Freehand Selection Tool and measurements of Area and Integrated Density were taken in the Phalloidin channel. The same analysis was then completed for each adjacent non-M cell that neighbors the M cell. The Raw Integrated Density was divided by the Area of each individual cell for normalization. The average Integrated Density/Area was calculated for each adjacent non-M cells for each M cell. Images were analyzed from 3 independent experiments; each dot is an M cell or average of neighboring cells. Error bars indicate SD. Statistical significance was determined on log-transformed values using a Paired t test. *** p = 0.0001 (B) Representative image of XZ Plane from plot in A. Images were analyzed using ImageJ software. DAPI = Blue; Glycoprotein 2 (GP2) = Red; Phalloidin = Cyan. <a href="https://www.jove.com/files/ftp_upload/59894/59894fig06large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Induced Differentiation of M Cell-like Cells in Human Stem Cell-derived Ileal Enteroid Monolayers at JoVE.com

Induced Differentiation of M Cell-like Cells in Human Stem Cell-derived Ileal Enteroid Monolayers

This protocol describes how to induce the differentiation of M cells in human stem cell-derived ileal monolayers and methods to assess their development.

M (microfold) cells of the intestine function to transport antigen from the apical lumen to the underlying Peyer&#8217;s patches and lamina propria where ...

induced-differentiation-m-cell-like-cells-human-stem-cell-derived

Research

JoVE Journal

Immunology and Infection

8.5K Views.  Sackler School of Graduate Biomedical Sciences. This protocol describes how to induce the differentiation of M cells in human stem cell-derived ileal monolayers and methods to assess their development.

Video: Induced Differentiation of M Cell-like Cells in Human Stem Cell-derived Ileal Enteroid Monolayers

Directed Differentiation of Induced Pluripotent Stem Cells towards T Lymphocytes

Adoptive cell transfer (ACT) of antigen-specific CD8+ cytotoxic T lymphocytes (CTLs) is a promising treatment for a variety of malignancies 1. CTLs can recognize malignant cells by interacting tumor antigens with the T cell receptors (TCR), and release cytotoxins as well as cytokines to kill malignant cells. It is known that less-differentiated and central-memory-like (termed highly reactive) CTLs are the optimal population for ACT-based immunotherapy, because these CTLs have a high proliferative potential, are less prone to apoptosis than more differentiated cells and have a higher ability to respond to homeostatic cytokines 2-7. However, due to difficulties in obtaining a high number of such CTLs from patients, there is an urgent need to find a new approach to generate highly reactive Ag-specific CTLs for successful ACT-based therapies.
TCR transduction of the self-renewable stem cells for immune reconstitution has a therapeutic potential for the treatment of diseases 8-10. However, the approach to obtain embryonic stem cells (ESCs) from patients is not feasible. Although the use of hematopoietic stem cells (HSCs) for therapeutic purposes has been widely applied in clinic 11-13, HSCs have reduced differentiation and proliferative capacities, and HSCs are difficult to expand in in vitro cell culture 14-16. Recent iPS cell technology and the development of an in vitro system for gene delivery are capable of generating iPS cells from patients without any surgical approach. In addition, like ESCs, iPS cells possess indefinite proliferative capacity in vitro, and have been shown to differentiate into hematopoietic cells. Thus, iPS cells have greater potential to be used in ACT-based immunotherapy compared to ESCs or HSCs.
Here, we present methods for the generation of T lymphocytes from iPS cells in vitro, and in vivo programming of antigen-specific CTLs from iPS cells for promoting cancer immune surveillance. Stimulation in vitro with a Notch ligand drives T cell differentiation from iPS cells, and TCR gene transduction results in iPS cells differentiating into antigen-specific T cells in vivo, which prevents tumor growth. Thus, we demonstrate antigen-specific T cell differentiation from iPS cells. Our studies provide a potentially more efficient approach for generating antigen-specific CTLs for ACT-based therapies and facilitate the development of therapeutic strategies for diseases.

Generation of T lymphocytes from induced pluripotent stem (iPS) cells gives an alternative approach of using embryonic stem cells for T cell-based immunotherapy. The method shows that by utilizing either in vitro or in vivo induction system, iPS cells are able to differentiate into both conventional and antigen-specific T lymphocytes.

Adoptive cell transfer (ACT) of antigen-specific CD8+  cytotoxic T lymphocytes (CTLs) is a promising treatment for a variety of  malignancies 1. CTLs can  ...

Development of Stem Cell-derived Antigen-specific Regulatory T Cells Against Autoimmunity

Autoimmune diseases arise due to the loss of immunological self-tolerance. Regulatory T cells (Tregs) are important mediators of immunologic self-tolerance. Tregs represent about 5 - 10% of the mature CD4+ T cell subpopulation in mice and humans, with about 1 - 2% of those Tregs circulating in the peripheral blood. Induced pluripotent stem cells (iPSCs) can be differentiated into functional Tregs, which have a potential to be used for cell-based therapies of autoimmune diseases. Here, we present a method to develop antigen (Ag)-specific Tregs from iPSCs (i.e., iPSC-Tregs). The method is based on incorporating the transcription factor FoxP3 and an Ag-specific T cell receptor (TCR) into iPSCs and then differentiating on OP9 stromal cells expressing Notch ligands delta-like (DL) 1 and DL4. Following in vitro differentiation, the iPSC-Tregs express CD4, CD8, CD3, CD25, FoxP3, and Ag-specific TCR and are able to respond to Ag stimulation. This method has been successfully applied to cell-based therapy of autoimmune arthritis in a murine model. Adoptive transfer of these Ag-specific iPSC-Tregs into Ag-induced arthritis (AIA)-bearing mice has the ability to reduce joint inflammation and swelling and to prevent bone loss.

We present here a method to develop functional antigen (Ag)-specific regulatory T cells (Tregs) from induced pluripotent stem cells (iPSCs) for immunotherapy of autoimmune arthritis in a murine model.

Autoimmune diseases arise due to the loss of immunological self-tolerance. Regulatory T cells (Tregs) are important mediators of immunologic ...

In Vitro Differentiation of Human CD4+FOXP3+ Induced Regulatory T Cells (iTregs) from Na&#239;ve CD4+ T Cells Using a TGF-&#946;-containing Protocol

Regulatory T cells (Tregs) are an integral part of peripheral tolerance, suppressing immune reactions against self-structures and thus preventing autoimmune diseases. Clinical approaches to adoptively transfer Tregs, or to deplete Tregs in cancer, are underway with promising first outcomes. 
Because the number of naturally occurring Tregs (nTregs) is very limited, studying certain Treg features using in vitro induced Tregs (iTregs) can be advantageous. To date, the best although not absolutely specific protein marker to delineate Tregs is the transcription factor FOXP3. Despite the importance of Tregs including non-redundant roles of peripherally induced Tregs, the protocols to generate iTregs are currently controversial, particularly for human cells. This protocol therefore describes the in vitro differentiation of human CD4+FOXP3+ iTregs from human na&#239;ve T cells using a range of Treg-inducing factors (TGF-&#946; plus IL-2 only, or their combination with retinoic acid, rapamycin or butyrate) in parallel. It also describes the phenotyping of these cells by flow cytometry and qRT-PCR. 
These protocols result in reproducible expression of FOXP3 and other Treg signature genes and enable the study of general FOXP3-regulatory mechanisms as well as protocol-specific effects to delineate the impact of certain factors. iTregs can be utilized to study various phenotypic aspects as well as molecular mechanisms of Treg induction. Detailed molecular studies are facilitated by relatively large cell numbers that can be obtained. 
A limitation for the application of iTregs is the relative instability of FOXP3 expression in these cells compared to nTregs. iTregs generated by these protocols can also be used for functional assays such as studying their suppressive function, in which iTregs induced by TGF-&#946; plus retinoic acid and rapamycin display superior suppressive activity. However, the suppressive capacity of iTregs can differ from nTregs and the use of appropriate controls is crucial.

&lt;em&gt;In Vitro&lt;/em&gt; Differentiation of Human CD4&lt;sup&gt;+&lt;/sup&gt;FOXP3&lt;sup&gt;+&lt;/sup&gt; Induced Regulatory T Cells (iTregs) from Na&amp;#239;ve CD4&lt;sup&gt;+&lt;/sup&gt; T Cells Using a TGF-&amp;#946;-containing Protocol

This protocol describes the reproducible generation and phenotyping of human induced regulatory T cells (iTregs) from na&#239;ve CD4+ T cells in vitro. Different protocols for FOXP3 induction allow for the study of specific iTreg phenotypes obtained with respective protocols.

Regulatory T cells (Tregs) are an integral part of peripheral tolerance, suppressing immune reactions against self-structures and thus preventing ...

In Vitro Differentiation Model of Human Normal Memory B Cells to Long-lived Plasma Cells

Plasma cells (PCs) secrete large amounts of antibodies and develop from B cells that have been activated. PCs are rare cells located in the bone marrow or mucosa and ensure humoral immunity. Due to their low frequency and location, the study of PCs is difficult in human. We reported a B to PC in vitro differentiation model using selected combinations of cytokines and activation molecules that allow to reproduce the sequential cell differentiation occurring in vivo. In this in vitro model, memory B cells (MBCs) will differentiate into pre-plasmablasts (prePBs), plasmablasts (PBs), early PCs and finally, into long-lived PCs, with a phenotype close to their counterparts in healthy individuals.&#160;We also built an open access bioinformatics tools to analyze the most prominent information from GEP data related to PC differentiation. These resources can be used to study human B to PC differentiation and in the current study, we investigated the gene expression regulation of epigenetic factors during human B to PC differentiation.

Using multi-step culture systems, we report an in vitro B cell to plasma cell differentiation model.

Plasma cells (PCs) secrete large amounts of antibodies and develop from B cells that have been activated. PCs are rare cells located in the bone marrow or ...

A Novel Human Epithelial Enteroid Model of Necrotizing Enterocolitis

Necrotizing enterocolitis (NEC) is a devastating disease of newborn infants. It is characterized by multiple pathophysiologic alterations in the human intestinal epithelium, leading to increased intestinal permeability, impaired restitution, and increased cell death. Although there are numerous animal models of NEC, response to injury and therapeutic interventions may be highly variable between species. Furthermore, it is ethically challenging to study disease pathophysiology or novel therapeutic agents directly in human subjects, especially children. Therefore, it is highly desirable to develop a novel model of NEC using human tissue. Enteroids are 3-dimensional organoids derived from intestinal epithelial cells. They are ideal for the study of complex physiologic interactions, cell signaling, and host-pathogen defense. In this manuscript we describe a protocol that cultures human enteroids after isolating intestinal stem cells from patients undergoing bowel resection. The crypt cells are cultured in media containing growth factors that encourage differentiation into the various cell types native of the human intestinal epithelium. These cells are grown in a synthetic, collagenous mix of proteins that serve as a scaffold, mimicking the extra-cellular basement membrane. As a result, enteroids develop apical-basolateral polarity. Co-administration of lipopolysaccharide (LPS) in media causes an inflammatory response in the enteroids, leading to histologic, genetic, and protein expression alterations similar to those seen in human NEC. An experimental model of NEC using human tissue may provide a more accurate platform for drug and treatment testing prior to human trials, as we strive to identify a cure for this disease.

Enteroids are emerging as a novel model in the study of human disease. The protocol describes how to simulate an enteroid model of human necrotizing enterocolitis using lipopolysaccharide (LPS) treatment of enteroids generated from neonatal tissue. Collected enteroids demonstrate inflammatory changes akin to those seen in human necrotizing enterocolitis.

Necrotizing enterocolitis (NEC) is a devastating disease of newborn infants. It is characterized by multiple pathophysiologic alterations in the human ...

Human Colonoid Monolayers to Study Interactions Between Pathogens, Commensals, and Host Intestinal Epithelium

Human 3-dimensional (3D) enteroid or colonoid cultures derived from crypt base stem cells are currently the most advanced ex vivo model of the intestinal epithelium. Due to their closed structures and significant supporting extracellular matrix, 3D cultures are not ideal for host-pathogen studies. Enteroids or colonoids can be grown as epithelial monolayers on permeable tissue culture membranes to allow manipulation of both luminal and basolateral cell surfaces and accompanying fluids. This enhanced luminal surface accessibility facilitates modeling bacterial-host epithelial interactions such as the mucus-degrading ability of enterohemorrhagic E. coli (EHEC) on colonic epithelium. A method for 3D culture fragmentation, monolayer seeding, and transepithelial electrical resistance (TER) measurements to monitor the progress towards confluency and differentiation are described. Colonoid monolayer differentiation yields secreted mucus that can be studied by the immunofluorescence or immunoblotting techniques. More generally, enteroid or colonoid monolayers enable a physiologically-relevant platform to evaluate specific cell populations that may be targeted by pathogenic or commensal microbiota.

Here, we present a protocol to culture human enteroid or colonoid monolayers that have intact barrier function to study host epithelial-microbiota interactions at the cellular and biochemical level.

Human 3-dimensional (3D) enteroid or colonoid cultures derived from crypt base stem cells are currently the most advanced ex vivo model of the intestinal ...

Using Human Induced Pluripotent Stem Cell-derived Intestinal Organoids to Study and Modify Epithelial Cell Protection Against Salmonella and Other Pathogens

The intestinal &#8216;organoid&#8217; (iHO) system, wherein 3-D structures representative of the epithelial lining of the human gut can be produced from human induced pluripotent stem cells (hiPSCs) and maintained in culture, provides an exciting opportunity to facilitate the modeling of the epithelial response to enteric infections. In vivo, intestinal epithelial cells (IECs) play a key role in regulating intestinal homeostasis and may directly inhibit pathogens, although the mechanisms by which this occurs are not fully elucidated. The cytokine interleukin-22 (IL-22) has been shown to play a role in the maintenance and defense of the gut epithelial barrier, including inducing a release of antimicrobial peptides and chemokines in response to infection.
We describe the differentiation of healthy control hiPSCs into iHOs via the addition of specific cytokine combinations to their culture medium before embedding them into a basement membrane matrix-based prointestinal culture system. Once embedded, the iHOs are grown in media supplemented with Noggin, R-spondin-1, epidermal growth factor (EGF), CHIR99021, prostaglandin E2, and Y-27632 dihydrochloride monohydrate. Weekly passages by manual disruption of the iHO ultrastructure lead to the formation of budded iHOs, with some exhibiting a crypt/villus structure. All iHOs demonstrate a differentiated epithelium consisting of goblet cells, enteroendocrine cells, Paneth cells, and polarized enterocytes, which can be confirmed via immunostaining for specific markers of each cell subset, transmission electron microscopy (TEM), and quantitative PCR (qPCR). To model infection, Salmonella enterica serovar Typhimurium SL1344 are microinjected into the lumen of the iHOs and incubated for 90 min at 37 &#176;C, and a modified gentamicin protection assay is performed to identify the levels of intracellular bacterial invasion. Some iHOs are also pretreated with recombinant human IL-22 (rhIL-22) prior to infection to establish whether this cytokine is protective against Salmonella infection.

Using Human Induced Pluripotent Stem Cell-derived Intestinal Organoids to Study and Modify Epithelial Cell Protection Against Salmonella and Other Pathogens

Human induced pluripotent stem cell (hiPSC)-derived intestinal organoids offer exciting opportunities to model enteric diseases in vitro. We demonstrate the differentiation of hiPSCs into intestinal organoids (iHOs), the stimulation of these iHOs with cytokines, and the microinjection of Salmonella Typhimurium into the iHO lumen, enabling the study of an epithelial invasion by this pathogen.

The intestinal &#8216;organoid&#8217; (iHO) system, wherein 3-D structures representative of the epithelial lining of the human gut can be produced from ...

Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice

Hepatitis B virus (HBV) infection is a global health issue. With over 350 million people affected worldwide, HBV infection remains the leading cause of liver cancer. This is a major concern, especially in developing countries. Failure of the immune system to mount an effective response against HBV leads to chronic infection. Although HBV vaccine is present and novel antiviral medicines are being created, eradication of virus-reservoir cells remains a major health topic. Described here is a method for the generation of viral antigen (Ag) -specific CD8+ cytotoxic T lymphocytes (CTLs) derived from induced pluripotent stem cells (iPSCs) (i.e., iPSC-CTLs), which have the ability to suppress HBV replication. HBV replication is efficiently induced in mice through hydrodynamic injection of an HBV expression plasmid, pAAV/HBV1.2, into the liver. Then, HBV surface Ag-specific mouse iPSC-CTLs are adoptively transferred, which greatly suppresses HBV replication in the liver and blood as well as prevents HBV surface Ag expression in hepatocytes. This method demonstrates HBV replication in mice after hydrodynamic injection and that stem cell-derived viral Ag-specific CTLs can suppress HBV replication. This protocol provides a useful method for HBV immunotherapy.

Presented here is a protocol for the effective suppression of hepatitis B virus (HBV) replication in mice by utilizing adoptive cell transfer (ACT) of stem cell-derived viral antigen (Ag)-specific T lymphocytes. This procedure may be adapted for potential ACT-based immunotherapy of HBV infection.

Hepatitis B virus (HBV) infection is a global health issue. With over 350 million people affected worldwide, HBV infection remains the leading cause of ...

Production and Characterization of Human Macrophages from Pluripotent Stem Cells

Macrophages are present in most vertebrate tissues and comprise widely dispersed and heterogeneous cell populations with different functions. They are key players in health and disease, acting as phagocytes during immune defense and mediating trophic, maintenance, and repair functions. Although it has been possible to study some of the molecular processes involved in human macrophage function, it has proved difficult to apply genetic engineering techniques to primary human macrophages. This has significantly hampered our ability to interrogate the complex genetic pathways involved in macrophage biology and to generate models for specific disease states. An off-the-shelf source of human macrophages that is amenable to the vast arsenal of genetic manipulation techniques would, therefore, provide a valuable tool in this field. We present an optimized protocol that allows for the generation of macrophages from human induced pluripotent stem cells (iPSCs) in vitro. These iPSC-derived macrophages (iPSC-DMs) express human macrophage cell surface markers, including CD45, 25F9, CD163, and CD169, and our live-cell imaging functional assay demonstrates that they exhibit robust phagocytic activity. Cultured iPSC-DMs can be activated to different&#160;macrophage states that display altered gene expression and phagocytic activity by the addition of LPS and IFNg, IL4, or IL10. Thus, this system provides a platform to generate human macrophages carrying genetic alterations that model specific human disease and a source of cells for drug screening or cell therapy to treat these diseases.

This protocol describes the robust generation of macrophages from human induced pluripotent stem cells, and methods for their subsequent characterization. Cell surface marker expression, gene expression, and functional assays are used to assess the phenotype and function of these iPSC-derived macrophages.

Macrophages are present in most vertebrate tissues and comprise widely dispersed and heterogeneous cell populations with different functions. They are key ...

Neisseria meningitidis Infection of Induced Pluripotent Stem-Cell Derived Brain Endothelial Cells

Meningococcal meningitis is a life-threatening infection that occurs when Neisseria meningitidis (meningococcus, Nm) can gain access to the central nervous system (CNS) by penetrating highly specialized brain endothelial cells (BECs). As Nm is a human-specific pathogen, the lack of robust in vivo model systems makes study of the host-pathogen interactions between Nm and BECs challenging and establishes a need for a human based model that mimics native BECs. BECs possess tighter barrier properties when compared to peripheral endothelial cells characterized by complex tight junctions and elevated trans-endothelial electrical resistance (TEER). However, many in vitro models, such as primary BECs and immortalized BECs, either lack or rapidly lose their barrier properties after removal from the native neural microenvironment. Recent advances in human stem-cell technologies have developed methods for deriving brain-like endothelial cells from induced pluripotent stem-cells (iPSCs) that better phenocopy BECs when compared to other in vitro human models. The use of iPSC-derived BECs (iPSC-BECs) to model Nm-BEC interaction has the benefit of using human cells that possess BEC barrier properties, and can be used to examine barrier destruction, innate immune activation, and bacterial interaction. Here we demonstrate how to derive iPSC-BECs from iPSCs in addition to bacterial preparation, infection, and sample collection for analysis.

Neisseria meningitidis Infection of Induced Pluripotent Stem-Cell Derived Brain Endothelial Cells

The protocol described here highlights the major steps in the differentiating induced pluripotent stem-cell derived brain-like endothelial cells, the preparation of Neisseria meningitidis for infection, and sample collection for other molecular analyses.

Meningococcal meningitis is a life-threatening infection that occurs when Neisseria meningitidis (meningococcus, Nm) can gain access to the central ...