Name: organoid-derived epithelial monolayer: a clinically relevant in vitro model for intestinal barrier function
Uploaded: 2021-07-29T13:00:00
Description: Watch this Scientific Journal Video about Organoid-Derived Epithelial Monolayer: A Clinically Relevant In Vitro Model for Intestinal Barrier Function at JoVE.com

This work is supported by the Topsector Life Sciences &#38; Health - Topconsortium voor Kennis en Innovatie Health~Holland (LSH-TKI) public-private partnerships (PPP) allowance of the Dutch LSH sector with Project number LSHM16021 Organoids as novel tool for toxicology modelling to Hubrecht Organoid Technology (HUB) and HUB internal funding to Disease Modeling and Toxicology department. We thank the laboratories of Sabine Middendorp (Division of Pediatric Gastroenterology, Wilhelmina Children&#39;s Hospital, UMC, Utrecht) and Hugo R. de Jonge and Marcel J.C. Bijvelds (Department of Gastroenterology and Hepatology, Erasmus MC, Rotterdam) for providing initial technical support to set up monolayers on membrane inserts.

1. Preparing reagents for culture
NOTE: Perform all steps inside a biosafety cabinet and follow standard guidelines for working with cell cultures. Ultraviolet light is used for 10 min before starting up the biosafety cabinet. Before and after use, the surface of the biosafety cabinet is cleaned with a tissue paper drenched in 70% ethanol. To facilitate the formation of three-dimensional drops of extracellular matrix (ECM), keep a prewarmed stock of 96-, 24-, and 6-well plates ready in the incub...

<ol>
	<li>Haegebarth, A., Clevers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wnt+signaling,+lgr5,+and+stem+cells+in+the+intestine+and+skin.">Wnt signaling, lgr5, and stem cells in the intestine and skin.</a> The American Journal of Pathology. 174 (3), 715-721 (2009).</li><li>Schoultz, I., Keita, &. #. 1. 9. 7. ;. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+intestinal+barrier+and+current+techniques+for+the+assessment+of+gut+permeability.">The intestinal barrier and current techniques for the assessment of gut permeability.</a> Cells. 9 (8), 1909 (2020).</li><li>Mart&#237;nez-Maqueda, D., Miralles, B., Recio, I., Verhoeckx, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HT29+Cell+Line.">HT29 Cell Line.</a> The Impact of Food Bio-Actives on Gut Health: In Vitro and Ex Vivo Models. , 113-124 (2015).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+Lgr5+stem+cells+build+crypt-villus+structures+in+vitro+without+a+mesenchymal+niche.">Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche.</a> Nature. 459 (7244), 262-265 (2009).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+expansion+of+epithelial+organoids+from+human+colon,+adenoma,+adenocarcinoma,+and+Barrett's+epithelium.">Long-term expansion of epithelial organoids from human colon, adenoma, adenocarcinoma, and Barrett's epithelium.</a> Gastroenterology. 141 (5), 1762-1772 (2011).</li><li>Huch, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+expansion+of+single+Lgr5(+)+liver+stem+cells+induced+by+Wnt-driven+regeneration.">In vitro expansion of single Lgr5(+) liver stem cells induced by Wnt-driven regeneration.</a> Nature. 11 (2), 179-194 (2013).</li><li>Sachs, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+expanding+human+airway+organoids+for+disease+modeling.">Long-term expanding human airway organoids for disease modeling.</a> The EMBO Journal. 38 (4), 1-20 (2019).</li><li>Karthaus, W. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+multipotent+luminal+progenitor+cells+in+human+prostate+organoid+cultures.">Identification of multipotent luminal progenitor cells in human prostate organoid cultures.</a> Cell. 159 (1), 163-175 (2014).</li><li>Boj, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organoid+models+of+human+and+mouse+ductal+pancreatic+cancer.">Organoid models of human and mouse ductal pancreatic cancer.</a> Cell. 160 (1-2), 324-338 (2015).</li><li>Sachs, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+living+biobank+of+breast+cancer+organoids+captures+disease+heterogeneity.">A living biobank of breast cancer organoids captures disease heterogeneity.</a> Cell. 172 (1-2), 373-386 (2018).</li><li>Vlachogiannis, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Patient-derived+organoids+model+treatment+response+of+metastatic+gastrointestinal+cancers.">Patient-derived organoids model treatment response of metastatic gastrointestinal cancers.</a> Science. 359 (6378), 920-926 (2018).</li><li>Van De Wetering, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prospective+derivation+of+a+living+organoid+biobank+of+colorectal+cancer+patients.">Prospective derivation of a living organoid biobank of colorectal cancer patients.</a> Cell. 161 (4), 933-945 (2015).</li><li>Driehuis, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pancreatic+cancer+organoids+recapitulate+disease+and+allow+personalized+drug+screening.">Pancreatic cancer organoids recapitulate disease and allow personalized drug screening.</a> Proceedings of the National Academy of Sciences of the United States of America. 116 (52), 26580-26590 (2019).</li><li>Tiriac, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organoid+profiling+identifies+common+responders+to+chemotherapy+in+pancreatic+cancer.">Organoid profiling identifies common responders to chemotherapy in pancreatic cancer.</a> Cancer Discovery. 8 (9), 1112-1129 (2018).</li><li>d'Aldebert, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+human+colon+organoids+from+inflammatory+bowel+disease+patients.">Characterization of human colon organoids from inflammatory bowel disease patients.</a> Frontiers in Cell and Developmental Biology. 8, 363 (2020).</li><li>Dotti, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alterations+in+the+epithelial+stem+cell+compartment+could+contribute+to+permanent+changes+in+the+mucosa+of+patients+with+ulcerative+colitis.">Alterations in the epithelial stem cell compartment could contribute to permanent changes in the mucosa of patients with ulcerative colitis.</a> Gut. 66 (12), 2069-2079 (2017).</li><li>VanDussen, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+an+enhanced+human+gastrointestinal+epithelial+culture+system+to+facilitate+patient-based+assays.">Development of an enhanced human gastrointestinal epithelial culture system to facilitate patient-based assays.</a> Gut. 64 (6), 911-920 (2015).</li><li>Noel, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+primary+human+macrophage-enteroid+co-culture+model+to+investigate+mucosal+gut+physiology+and+host-pathogen+interactions.">A primary human macrophage-enteroid co-culture model to investigate mucosal gut physiology and host-pathogen interactions.</a> Scientific Reports. 7, 45270 (2017).</li><li>Bartfeld, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+expansion+of+human+gastric+epithelial+stem+cells+and+their+responses+to+bacterial+infection.">In vitro expansion of human gastric epithelial stem cells and their responses to bacterial infection.</a> Gastroenterology. 148 (1), 126-136 (2015).</li><li>van Es, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wnt+signalling+induces+maturation+of+Paneth+cells+in+intestinal+crypts.">Wnt signalling induces maturation of Paneth cells in intestinal crypts.</a> Nature Cell Biology. 7 (4), 381-386 (2005).</li><li>van Es, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dll1+marks+early+secretory+progenitors+in+gut+crypts+that+can+revert+to+stem+cells+upon+tissue+damage.">Dll1 marks early secretory progenitors in gut crypts that can revert to stem cells upon tissue damage.</a> Nature Cell Biology. 14 (10), 1099-1104 (2012).</li><li>de Lau, W. B. M., Snel, B., Clevers, H. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+R-spondin+protein+family.">The R-spondin protein family.</a> Genome Biology. 13 (3), 1-10 (2012).</li><li>Basak, O., Beumer, J., Wiebrands, K., Seno, H., van Oudenaarden, A., Clevers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induced+quiescence+of+Lgr5++stem+cells+in+intestinal+organoids+enables+differentiation+of+hormone-producing+enteroendocrine+cells.">Induced quiescence of Lgr5+ stem cells in intestinal organoids enables differentiation of hormone-producing enteroendocrine cells.</a> Cell Stem Cell. 20 (2), 177-190 (2017).</li><li>Beumer, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enteroendocrine+cells+switch+hormone+expression+along+the+crypt-to-villus+BMP+signalling+gradient.">Enteroendocrine cells switch hormone expression along the crypt-to-villus BMP signalling gradient.</a> Nature Cell Biology. 20 (8), 909-916 (2018).</li><li>Yin, X., Farin, H. F., van Es, J. H., Clevers, H., Langer, R., Karp, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Niche-independent+high-purity+cultures+of+Lgr5++intestinal+stem+cells+and+their+progeny.">Niche-independent high-purity cultures of Lgr5+ intestinal stem cells and their progeny.</a> Nature Methods. 11 (1), 106-112 (2014).</li><li>Boj, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Forskolin-induced+swelling+in+intestinal+organoids:+An+in+vitro+assay+for+assessing+drug+response+in+cystic+fibrosis+patients.">Forskolin-induced swelling in intestinal organoids: An in vitro assay for assessing drug response in cystic fibrosis patients.</a> Journal of Visualized Experiments. (120), (2017).</li><li>Miao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-generation+surrogate+Wnts+support+organoid+growth+and+deconvolute+Frizzled+pleiotropy+in+vivo.">Next-generation surrogate Wnts support organoid growth and deconvolute Frizzled pleiotropy in vivo.</a> Cell Stem Cell. 27 (5), 840-851 (2020).</li><li>Srinivasan, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TEER+measurement+techniques+for+in+vitro+barrier+model+systems.">TEER measurement techniques for in vitro barrier model systems.</a> Journal of Laboratory Automation. 20 (2), 107-126 (2015).</li><li>Blume, L. -. F., Denker, M., Gieseler, F., Kunze, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temperature+corrected+transepithelial+electrical+resistance+(TEER)+measurement+to+quantify+rapid+changes+in+paracellular+permeability.">Temperature corrected transepithelial electrical resistance (TEER) measurement to quantify rapid changes in paracellular permeability.</a> Die Pharmazie. 65 (1), 19-24 (2010).</li><li>Lea, T., Verhoeckx, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Caco-2+cell+line.">Caco-2 cell line.</a> The Impact of Food Bio-Actives on Gut Health: In Vitro and Ex Vivo Models. , 103-111 (2015).</li><li>Heo, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modelling+Cryptosporidium+infection+in+human+small+intestinal+and+lung+organoids.">Modelling Cryptosporidium infection in human small intestinal and lung organoids.</a> Nature Microbiology. 3 (7), 814-823 (2018).</li><li>Watanabe, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+ROCK+inhibitor+permits+survival+of+dissociated+human+embryonic+stem+cells.">A ROCK inhibitor permits survival of dissociated human embryonic stem cells.</a> Nature Biotechnology. 25 (6), 681-686 (2007).</li></ol>

This protocol describes the general manipulation and maintenance of intestinal organoids as well as the preparation and possible applications of epithelial monolayers derived from these organoids. To date, monolayers have been successfully prepared from the duodenum, ileum, and different regions of colon organoids derived from normal as well as previously and actively inflamed intestinal tissue (unpublished data). The application of patient-derived organoid monolayers facilitates the study of barrier function in a diseas...

The intestinal epithelium acts as a physical barrier between the luminal content of the intestines and the underlying tissue. This barrier comprises a single epithelial layer of mainly absorptive enterocytes that are connected by tight junctions, which establish strong intercellular connections between adjacent cells. These cells form a polarized epithelial lining that separates the apical (lumen) and basolateral sides of the intestine, while simultaneously regulating paracellular transport of digested nutrients and metabolites. In addition to enterocytes, other important epithelial cells such as goblet, Paneth, and enteroendocrine cells also contribute to intestinal homeostasis by producing mucus, antimicrobial peptides, and hormones, respectively. The intestinal epithelium is constantly replenished by dividing leucine-rich repeat-containing G-protein-coupled receptor 5-positive (LGR5+) stem cells in the bottom of intestinal crypts producing transit-amplifying (TA) cells that migrate upwards and differentiate into other cell types1. Disruption of intestinal epithelial homeostasis by genetic and environmental factors, such as exposure to food allergens, medicinal compounds, and microbial pathogens, leads to disruption of intestinal barrier function. These conditions cause several intestinal diseases including inflammatory bowel disease (IBD), celiac disease, and drug-induced GI toxicity2.
Studies on the intestinal epithelium are performed using several in vitro platform systems such as membrane inserts, organs-on-a-chip systems, Ussing chambers, and intestinal rings.These platforms are suitable for establishing polarized epithelial monolayers with access to both apical and basolateral sides of the membrane, using transformed cell lines or primary tissue as models. Although transformed cell lines, such as the colorectal (adeno)carcinoma cell lines Caco-2, T84, and HT-29, are able to differentiate into polarized intestinal enterocytes or mucus-producing cells to some extent, they are not representative of the in vivo&#160;epithelium as several cell types are missing, and various receptors and transporters are aberrantly expressed3. In addition, as cell lines are derived from a single donor, they do not represent interpatient heterogeneity and suffer from reduced complexity and physiological relevance. Although primary tissues used in Ussing chambers and as intestinal rings are more representative of the in vivo&#160;situation, their limited availability, short-term viability, and lack of expandability make them unsuitable as a medium for high-throughput (HT) studies.
Organoids are in vitro epithelial cultures established from different organs such as the intestine, kidney, liver, pancreas, and lung. They are proven to have long-term, stable expandability as well as genetic and phenotypic stability and therefore are representative biological miniatures of the epithelium of the original organ with faithful responses to external stimuli4,5,6,7,8,9. Organoids are efficiently established from either resected or biopsied normal, diseased, inflamed, or cancerous tissue, representing heterogeneous patient-specific responses10,11,12,13,14,15,16. This paper demonstrates how to establish intestinal epithelial monolayers derived from organoid cultures. Monolayers have been successfully established from small intestinal as well as colonic and rectal organoid cultures. This model creates an opportunity to study the transport and permeability of the epithelial cells to drugs as well as their toxicological effects on the epithelium. Moreover, the model allows co-culture with immune cells and bacteria to study their interactions with the intestinal epithelium17,18,19. Furthermore, this model can be used to study responses to therapies in a patient-specific manner and initiate screening efforts to look for the next wave of epithelial barrier-focused therapeutics. Such an approach could be extended to the clinic and pave the way toward personalized treatments.
Although the epithelial monolayers in this protocol are prepared from human normal intestinal organoids, the protocol can be applied and optimized for other organoid models. Epithelial organoid monolayers are cultured in intestinal organoid expansion medium containing Wnt to support stem cell proliferation and represent intestinal crypt cellular composition. Intestinal organoids can be enriched to have different intestinal epithelial fates, such as enterocytes, Paneth, goblet, and enteroendocrine cells, by modulating Wnt, Notch, and epidermal growth factor (EGF) pathways. Here, after the establishment of monolayers in expansion medium, they are driven toward more differentiated intestinal epithelial cells, as described previously20,21,22,23,24,25. For screening purposes, depending on the mode of action of the compound of interest, its target cells, and the experimental conditions, the monolayers can be driven toward the cellular composition of choice to measure the effects of the compound with relevant functional readouts.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>100% ethanol</td>
			<td>Fisher Emergo</td>
			<td>10644795</td>
			<td></td>
		</tr>
		<tr>
			<td>1250, 300, and 20 &#181;L low-retention filter-tips</td>
			<td>Greiner bio-one</td>
			<td>732-1432 / 732-1434 / 732-2383</td>
			<td></td>
		</tr>
		<tr>
			<td>15 mL conical tubes</td>
			<td>Greiner bio-one</td>
			<td>188271</td>
			<td></td>
		</tr>
		<tr>
			<td>24-well cell culture plates</td>
			<td>Greiner bio-one</td>
			<td>662160</td>
			<td></td>
		</tr>
		<tr>
			<td>24-well HTS Fluoroblok Transwell plate (light-tight)</td>
			<td>Corning</td>
			<td>351156</td>
			<td rowspan="2">Plates require REMS AutoSampler for TEER measurements</td>
		</tr>
		<tr>
			<td>24-well HTS Transwell plates (Table 1)</td>
			<td>Corning</td>
			<td>3378</td>
		</tr>
		<tr>
			<td>24-well plate with Transwell inserts</td>
			<td>Corning</td>
			<td>3470</td>
			<td>membrane inserts</td>
		</tr>
		<tr>
			<td>40 &#181;m cell strainer</td>
			<td>PluriSelect</td>
			<td>43-50040-01</td>
			<td></td>
		</tr>
		<tr>
			<td>50 mL conical tubes</td>
			<td>Greiner bio-one</td>
			<td>227261</td>
			<td></td>
		</tr>
		<tr>
			<td>6-well cell culture plates</td>
			<td>Greiner bio-one</td>
			<td>657160</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well black plate transparent bottom</td>
			<td>Greiner bio-one</td>
			<td>655090</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well fast thermal cycling plates</td>
			<td>Life Technologies Europe BV</td>
			<td>4346907</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well HTS Fluoroblok Transwell plate</td>
			<td>Corning</td>
			<td>351162</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well HTS Transwell plates (Table 1)</td>
			<td>Corning</td>
			<td>7369</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well transparent culture plate</td>
			<td>Greiner bio-one</td>
			<td>655180</td>
			<td></td>
		</tr>
		<tr>
			<td>A83-01</td>
			<td>Bio-Techne Ltd</td>
			<td>2939</td>
			<td></td>
		</tr>
		<tr>
			<td>Accutase Cell Dissociation Reagent</td>
			<td>Life Technologies Europe BV</td>
			<td>A11105-01</td>
			<td></td>
		</tr>
		<tr>
			<td>Advanced DMEM/F-12</td>
			<td>Life Technologies Europe BV</td>
			<td>12634028</td>
			<td></td>
		</tr>
		<tr>
			<td>B27 supplement</td>
			<td>Life Technologies Europe BV</td>
			<td>17504001</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell culture microscope (light / optical microscope)</td>
			<td>Leica</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>CellTiter-Glo</td>
			<td>Promega</td>
			<td>G9683</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Eppendorf</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>CO2 incubator</td>
			<td>PHCBI</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>DAPT</td>
			<td>Sigma-Aldrich</td>
			<td>D5942</td>
			<td></td>
		</tr>
		<tr>
			<td>DEPC treated H2O</td>
			<td>Life Technologies Europe BV</td>
			<td>750024</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s phosphate-buffered saline (DPBS) with Ca2+ and Mg2+</td>
			<td>Life Technologies Europe BV</td>
			<td>14040091</td>
			<td></td>
		</tr>
		<tr>
			<td>DPBS, powder, no calcium, no magnesium</td>
			<td>Life Technologies Europe BV</td>
			<td>21600069</td>
			<td></td>
		</tr>
		<tr>
			<td>EnzChek Lysozyme Assay Kit</td>
			<td>Life Technologies Europe BV</td>
			<td>E22013</td>
			<td></td>
		</tr>
		<tr>
			<td>EVOM2 meter with STX electrode</td>
			<td>WTI</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Gastrin</td>
			<td>Bio-Techne Ltd</td>
			<td>3006</td>
			<td></td>
		</tr>
		<tr>
			<td>Glass pipettes</td>
			<td>Volac</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>GlutaMAX</td>
			<td>Life Technologies Europe BV</td>
			<td>35050038</td>
			<td></td>
		</tr>
		<tr>
			<td>hEGF</td>
			<td>Peprotech</td>
			<td>AF-100-15</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Life Technologies Europe BV</td>
			<td>15630056</td>
			<td></td>
		</tr>
		<tr>
			<td>Human Noggin</td>
			<td>Peprotech</td>
			<td>120-10C</td>
			<td></td>
		</tr>
		<tr>
			<td>Human Rspo3</td>
			<td>Bio-Techne Ltd</td>
			<td>3500-RS/CF</td>
			<td></td>
		</tr>
		<tr>
			<td>IWP-2</td>
			<td>Miltenyi Biotec</td>
			<td>130-105-335</td>
			<td></td>
		</tr>
		<tr>
			<td>Ki67 primary antibody</td>
			<td>Sanbio</td>
			<td>BSH-7302-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Ki67 secondary antibody</td>
			<td>Agilent</td>
			<td>K400111-2</td>
			<td></td>
		</tr>
		<tr>
			<td>Kova International Glasstic Slide with Counting grids</td>
			<td>Fisher Emergo</td>
			<td>10298483</td>
			<td></td>
		</tr>
		<tr>
			<td>Laminar flow hood</td>
			<td>Thermo scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Lucifer Yellow CH dilithium salt</td>
			<td>Sigma-Aldrich</td>
			<td>L0259</td>
			<td></td>
		</tr>
		<tr>
			<td>Matrigel, Growth Factor Reduced (GFR)</td>
			<td>Corning</td>
			<td>356231</td>
			<td>extracellular matrix (ECM)</td>
		</tr>
		<tr>
			<td>MicroAmp Fast 8-Tube Strip, 0.1 mL</td>
			<td>Life Technologies Europe BV</td>
			<td>4358293</td>
			<td></td>
		</tr>
		<tr>
			<td>MicroAmp Optical 8-Cap Strips</td>
			<td>Life Technologies Europe BV</td>
			<td>4323032</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcentrifuge tubes</td>
			<td>Eppendorf</td>
			<td>0030 120 086</td>
			<td></td>
		</tr>
		<tr>
			<td>Micropipettes (1000, 200, and 20 &#181;L)</td>
			<td>Gilson</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Microtome</td>
			<td>Leica</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>MUC2 primary antibody</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-15334</td>
			<td></td>
		</tr>
		<tr>
			<td>MUC2 secondary antibody</td>
			<td>VWR</td>
			<td>VWRKS/DPVR-HRP</td>
			<td></td>
		</tr>
		<tr>
			<td>Multichannel pipette (200 &#181;L)</td>
			<td>Gilson</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>N-acetylcysteine</td>
			<td>Sigma-Aldrich</td>
			<td>A9165</td>
			<td></td>
		</tr>
		<tr>
			<td>NGS Wnt</td>
			<td>U-Protein Express</td>
			<td>N001-0.5mg</td>
			<td></td>
		</tr>
		<tr>
			<td>Nicotinamide</td>
			<td>Sigma-Aldrich</td>
			<td>N0636</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide ALPI1/Forward</td>
			<td>Custom-made</td>
			<td>GGAGTTATCCTGCTCCCCAC</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide ALPI1/Reverse</td>
			<td>Custom-made</td>
			<td>CTAGGAGGTGAAGGTCCAACG</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide LGR5/Forward</td>
			<td>Custom-made</td>
			<td>ACACGTACCCACAGAAGCTC</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide LGR5/Reverse</td>
			<td>Custom-made</td>
			<td>GGAATGCAGGCCACTGAAAC</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide MUC2/Forward</td>
			<td>Custom-made</td>
			<td>AGGATCTGAAGAAGTGTGTCACTG</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide MUC2/Reverse</td>
			<td>Custom-made</td>
			<td>TAATGGAACAGATGTTGAAGTGCT</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide TBP/Forward</td>
			<td>Custom-made</td>
			<td>ACGCCGAATATAATCCCAAGCG</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide TBP/Reverse</td>
			<td>Custom-made</td>
			<td>AAATCAGTGCCGTGGTTCGTG</td>
			<td></td>
		</tr>
		<tr>
			<td>Optical adhesive covers</td>
			<td>Life Technologies Europe BV</td>
			<td>4311971</td>
			<td></td>
		</tr>
		<tr>
			<td>PD0325901</td>
			<td>Stemcell Technologies</td>
			<td>72184</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin/streptomycin</td>
			<td>Life Technologies Europe BV</td>
			<td>15140122</td>
			<td></td>
		</tr>
		<tr>
			<td>Plate shaker</td>
			<td>Panasonic</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>PowerUp SYBR Green Master Mix</td>
			<td>Fisher Emergo</td>
			<td>A25776</td>
			<td></td>
		</tr>
		<tr>
			<td>Primocin</td>
			<td>InvivoGen</td>
			<td>ANT-PM-2</td>
			<td>antimicrobial formulation for primary cells</td>
		</tr>
		<tr>
			<td>Qubit RNA HS Assay Kit</td>
			<td>Life Technologies Europe BV</td>
			<td>Q32852</td>
			<td></td>
		</tr>
		<tr>
			<td>Reagent reservoir for multichannel pipet</td>
			<td>Sigma-Aldrich</td>
			<td>CLS4870</td>
			<td></td>
		</tr>
		<tr>
			<td>REMS AutoSampler with 24-probe or 96C-probe</td>
			<td>WTI</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Richard-Allan Scientific Alcian Blue/PAS Special Stain Kit</td>
			<td>Thermo scientific</td>
			<td>87023</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase-Free DNase Set</td>
			<td>Qiagen</td>
			<td>79254</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini Kit</td>
			<td>Qiagen</td>
			<td>74106</td>
			<td></td>
		</tr>
		<tr>
			<td>SB202190</td>
			<td>Sigma-Aldrich</td>
			<td>S7076</td>
			<td></td>
		</tr>
		<tr>
			<td>Serological pipettes</td>
			<td>Greiner bio-one</td>
			<td>606180 / 607180 / 760180</td>
			<td></td>
		</tr>
		<tr>
			<td>Serological pipettor (Pipet-Aid)</td>
			<td>Drummond</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Single edge razor blade</td>
			<td>GEM Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Superscript 1st strand system for RT-PCR</td>
			<td>Life Technologies Europe BV</td>
			<td>11904018</td>
			<td></td>
		</tr>
		<tr>
			<td>Tecan Spark 10M plate reader</td>
			<td>Tecan</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Trypan Blue Solution, 0.4%</td>
			<td>Life Technologies Europe BV</td>
			<td>15250-061</td>
			<td></td>
		</tr>
		<tr>
			<td>TrypLE Express Enzyme (1x)</td>
			<td>Life Technologies Europe BV</td>
			<td>12605-010</td>
			<td>Cell dissociation reagent</td>
		</tr>
		<tr>
			<td>Water bath</td>
			<td>Grant</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Y27632 (ROCK inhibitor)</td>
			<td>AbMole</td>
			<td>M1817</td>
			<td></td>
		</tr>
	</tbody>
</table>

organoid-derived epithelial monolayer: a clinically relevant in vitro model for intestinal barrier function

In the past, intestinal epithelial model systems were limited to transformed cell lines and primary tissue. These model systems have inherent limitations as the former do not faithfully represent original tissue physiology, and the availability of the latter is limited. Hence, their application hampers fundamental and drug development research. Adult stem-cell-based organoids (henceforth referred to as organoids) are miniatures of normal or diseased epithelial tissue from which they are derived. They can be established very efficiently from different gastrointestinal (GI) tract regions, have long-term expandability, and simulate tissue- and patient-specific responses to treatments in vitro. Here, the establishment of intestinal organoid-derived epithelial monolayers has been demonstrated along with methods to measure epithelial barrier integrity, permeability and transport,&#160;antimicrobial protein secretion, as well as histology. Moreover, intestinal organoid-derived monolayers can be enriched with proliferating stem and transit-amplifying cells as well as with key differentiated epithelial cells. Therefore, they represent a model system that can be tailored to study the effects of compounds on target cells and their mode of action. Although organoid cultures are technically more demanding than cell lines, once established, they can reduce failures in the later stages of drug development as they truly represent in vivo epithelium complexity and interpatient heterogeneity.

Figure 1A shows a representative brightfield image of intestinal organoids after thawing them from a cryovial. It is important to thaw organoids at a high density to ensure optimal recovery. Organoids are plated in 24- or 6-well plates in ECM domes of approximately 10 &#181;L (Figure 1B). Most normal intestinal organoids have a cystic morphology. After recovering from the thawing process, the organoids grow to a bigger size and are ready to be passaged after 3-7...

Watch this Scientific Journal Video about Organoid-Derived Epithelial Monolayer: A Clinically Relevant In Vitro Model for Intestinal Barrier Function at JoVE.com

Organoid-Derived Epithelial Monolayer: A Clinically Relevant In Vitro Model for Intestinal Barrier Function (Video) | JoVE

Here, we describe the preparation of human organoid-derived intestinal epithelial monolayers for studying intestinal barrier function, permeability, and transport. As organoids represent original epithelial tissue response to external stimuli, these models combine the advantages of expandability of cell lines and the relevance and complexity of primary tissue.

Organoid-Derived Epithelial Monolayer: A Clinically Relevant In Vitro Model for Intestinal Barrier Function

In the past, intestinal epithelial model systems were limited to transformed cell lines and primary tissue. These model systems have inherent limitations ...

Research

JoVE Journal

Biology

Chromatin Isolation by RNA Purification (ChIRP)

Chromatin Isolation by RNA Purification ChIRP (Video) | JoVE

Long noncoding RNAs are key regulators of chromatin states for important biological processes such as dosage compensation, imprinting, and developmental ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA (Video) | JoVE

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

Rapid Genetic Analysis of Epithelial-Mesenchymal Signaling During Hair Regeneration

Rapid Genetic Analysis of Epithelial-Mesenchymal Signaling During Hair Regeneration (Video) | JoVE

Hair follicle morphogenesis, a complex process requiring interaction between epithelia-derived keratinocytes and the underlying mesenchyme, is an ...

Functional Reconstitution and Channel Activity Measurements of Purified Wildtype and Mutant CFTR Protein

Functional Reconstitution and Channel Activity Measurements of Purified Wildtype and Mutant CFTR Protein (Video) | JoVE

The Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a unique channel-forming member of the ATP Binding Cassette (ABC) superfamily of ...

Methods to Study Epithelial Transport Protein Function and Expression in Native Intestine and Caco-2 Cells Grown in 3D

Methods to Study Epithelial Transport Protein Function and Expression in Native Intestine and Caco-2 Cells Grown in 3D (Video) | JoVE

The intestinal epithelium has important transport and barrier functions that play key roles in normal physiological functions of the body while providing ...

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability (Video) | JoVE

The intestinal barrier defends against pathogenic microorganism and microbial toxin. Its function is regulated by tight junction permeability and ...

A Mouse Model of Intestinal Partial Obstruction

A Mouse Model of Intestinal Partial Obstruction (Video) | JoVE

Intestinal obstructions, that impede or block peristaltic movement, can be caused by abdominal adhesions and most gastrointestinal (GI) diseases including ...

Mass Spectrometry Analysis to Identify Ubiquitylation of EYFP-tagged CENP-A (EYFP-CENP-A)

Mass Spectrometry Analysis to Identify Ubiquitylation of EYFP-tagged CENP-A EYFP-CENP-A (Video) | JoVE

Studying the structure and the dynamics of kinetochores and centromeres is important in understanding chromosomal instability (CIN) and cancer ...

A Bacterial Oral Feeding Assay with Antibiotic-Treated Mosquitoes

A Bacterial Oral Feeding Assay with Antibiotic-Treated Mosquitoes (Video) | JoVE

The mosquito midgut harbors a highly dynamic microbiome that affects the host metabolism, reproduction, fitness, and vector competence. Studies have been ...

In Vitro Analysis of E3 Ubiquitin Ligase Function

In Vitro Analysis of E3 Ubiquitin Ligase Function (Video) | JoVE

The covalent attachment of ubiquitin (Ub) to internal lysine residue(s) of a substrate protein, a process termed ubiquitylation, represents one of the ...