We thank Mariko L. Bennett, Liana Nicole Bonanno, and Spyros Darmanis for their help during the development of this protocol. We also thank the Stanford Shared FACS Facility, particularly Meredith Weglarz and Lisa Nichols; Yen Tran, Michael Eckart from Stanford Protein and Nucleic Acid Facility (PAN) for their great support for the filming. This work is funded by the JPB Foundation and Vincent J. Coates Foundation.

All procedures involving rodents conformed to Stanford University guidelines, which comply with national and state laws and policies. All animal procedures were approved by Stanford University's Administrative Panel on Laboratory Animal Care.
NOTE: All solution and buffer compositions are provided in Table of Materials.
1. Preparation on the Day of Cell Isolation
<ol>
	<li>Prepare the following reagents and chill them on ice: medium A (50 mL), magnetic-activated cell sorting (MCS) buffer (30 mL), FACS buffer (25 mL), phosphate-buffered saline (PBS; 30 mL), DNase (320 &#181;L), and RNase inhibitor (30 &#181;L). 
	NOTE: The volumes provided here are sufficient to isolate microglia from 4 brain regions (e.g., cortex, cerebellum, hippocampus and striatum) of a single mouse brain hemisphere. Scale up if more tissues are used.</li>
	<li>Place four clean 2 mL Dounce homogenizers on ice and add 2 mL of medium A with 80 &#181;L of DNase (12,500 units/mL) and 5 &#181;L of RNase inhibitor into each Dounce homogenizer. Chill the pistons in 15 mL tubes.</li>
	<li>Label four 6 cm Petri dishes with brain regions for tissue collection and add 200 &#181;L of cold medium A into each dish on ice. Add about 5 mL of medium A into a 6 cm Petri dish for dissection. 
	NOTE: Prior to use, make sure all reagents are sterile and suitable for RNA applications. Bench and dissection tools need to be clean and sprayed with RNase decontamination solution (Table of Materials).</li>
</ol>
2. Brain Region Dissection
NOTE: This step should take ~30 min.
<ol>
	<li>Inject 400&#8722;500 &#181;L of ketamine/xylazine (24 mg/mL ketamine and 2.4 mg/mL xylazine) into the peritoneum of a juvenile to adult stage mouse (&#62;1 month old). 
	NOTE: A male mouse is used here for illustration, but either gender is suitable.</li>
	<li>Wait for 5 min and pinch a hind paw to ensure lack of retraction.</li>
	<li>Immediately use a 26 G x 3/8 needle to perform transcardial perfusion with 20&#8722;30 mL of ice-cold PBS until buffer runs out with no visible blood.</li>
	<li>Decapitate the mouse with a pair of surgical scissors. Use small scissors to cut open the skin to expose the underneath skull, and then cut through the sagittal suture, lambdoidal suture and coronal suture. Use forceps to pull off both sides of parietal bone and interparietal bone without damaging the tissue, and carefully move the brain into the dissection Petri dish with medium A.</li>
	<li>Use a pre-chilled blade to cut the brain through midline into two hemispheres. 
	NOTE: The four brain regions described here from a single hemisphere yield sufficient numbers of microglia for single-cell or bulk RNA-seq applications. The other hemisphere can be used for immunohistochemistry or RNA in situ validation.</li>
	<li>Separate the cerebellum from the cortical lobe and the brain stem with #55 forceps and transfer the tissue into a collection Petri dish.</li>
	<li>Use #55 forceps to carefully dissect out the hippocampus and the striatum from the cortex and transfer each tissue into a collection Petri dish.</li>
</ol>
3. Mechanical Tissue Dissociation
NOTE: Keep cells and reagents cool all the time except during staining steps. This step should take ~30 min.
<ol>
	<li>Chop each brain tissue with a razor blade into &#60;1 mm3 fine pieces.</li>
	<li>Use 1 mL pipette (with tips cut off) to transfer tissue pieces into the pre-chilled Dounce homogenizers, each containing 2 mL of medium A with DNase and RNase inhibitor.</li>
	<li>Homogenize the tissue by slowly twisting the piston in and out of the Dounce homogenizer for 6&#8722;10 full strokes, until no visible chunks are present. 
	NOTE: Douncing kills neurons and most other glial cells but leave microglial cells rather intact. Both insufficient and over-douncing can lead to low yield of cells.</li>
	<li>Transfer dissociated tissues into 50 mL tubes through 70 &#181;m strainers.</li>
	<li>Rinse each Dounce homogenizer and piston with a total of 6 mL of cold medium A and filter the rinsing solution through the same strainer into the corresponding tube.</li>
	<li>Transfer the single cell suspensions (about 8 mL each) into 15 mL conical tubes and centrifuge at 400 x g for 5 min at 4 &#176;C with brake = 5.</li>
</ol>
4. Myelin Removal
NOTE: This step should take ~60 min.
<ol>
	<li>Prepare 1 large depletion (LD) column (for cortex) and 3 large selection (LS) columns (for the other 3 regions) in a magnetic separator (Table of Materials). Rinse each column with 3 mL of MCS buffer.</li>
	<li>Once centrifugation is finished, pipette out and discard the supernatant without disturbing the pellet. For the cortex and cerebellum tissues, resuspend cells in 850 &#181;L of MCS buffer with 1.8 &#181;L of RNase inhibitor. For hippocampus and striatum tissues, resuspend cells in 400 &#181;L of MCS buffer with 0.9 &#181;L of RNase inhibitor. 
	NOTE: The columns (LD vs. LS) and the volume used for resuspension are optimized based on the amount of myelin present in the tissue. If other brain regions are assayed, these conditions may need to be adjusted depending on the size of the tissue and how much myelin may exist. Effectiveness of myelin removal can be estimated in step 4.9.</li>
	<li>Add 100 &#181;L of myelin removal beads each into cells from cortex and cerebellum and add 50 &#181;L of myelin removal beads each into cells from hippocampus and striatum.</li>
	<li>Gently mix the cells with beads and incubate the tubes on ice for 10 min.</li>
	<li>Bring the volume of the tube with cortical cells to 2 mL with MCS buffer, and all others to 1 mL (i.e., add 1 mL for cortical cells; 500 &#181;L for hippocampal and striatal cells; no need to add buffer to cerebellar cells).</li>
	<li>Once columns are empty of rinsing buffer, place a 15 mL tube below each column. Load cortical cells (2 mL) onto the LD column, and all others (1 mL each) onto the LS columns. Immediately use 1 mL of MCS buffer each to wash the original tubes and load the solution onto the corresponding columns.</li>
	<li>Wash the LD column once with 1 mL of MCS buffer and wash each LS column twice with 1 mL of MCS buffer each wash. Continue to collect the flow-through solution during washing.</li>
	<li>Filter cells into round bottom FACS tubes through 35 &#181;m strainer caps. 
	NOTE: Each tube should collect about 4 mL of single cell suspension depleted of myelin.</li>
	<li>Optionally, take 10 &#181;L of the cell suspension and mix it with 10 &#181;L of 0.4% trypan blue solution. Examine the cells under a 10x bright field microscope to estimate the yield, survival rate and the level of residual myelin. 
	NOTE: A successful preparation should generate over 90% live cells (round in shape and excluding the blue dye) with little to no myelin debris.</li>
	<li>Pellet cells in the FACS tubes at 400 x g for 5 min at 4 &#176;C, with brake = 5. Slowly pour out supernatant and dab the edge of the tube on tissue paper. Resuspend cells in each tube with 300 &#181;L of FACS buffer. 
	NOTE: If MCS sorting is preferred, CD11b beads can be used to select microglia and other myeloid cells following myelin removal. These cells can then be used for non-plate-based scRNA-seq as well as bulk RNA-seq. The caveat of this alternative approach is that CD11b beads do not separate microglia from other related immune cells which are also positive for this antigen.</li>
</ol>
5. Staining for Fluorescence-activated Cell Sorting
NOTE: This step should take ~40 min.
<ol>
	<li>Add 5 &#181;L of mouse Fc receptors block reagent (Table of Materials) into each tube. Incubate for 5 min on ice.</li>
	<li>Add 1 &#181;L of CD45-PE-Cy7 and 1 &#181;L of CD11b-BV421 into each tube. 
	NOTE: Antibodies with other conjugated fluorophores may be used. Antibodies against TMEM119, a specific marker for homeostatic microglia9, can also be included, but it is recommended to be used together with CD45 and CD11b, because certain microglia subpopulations may lose TMEM119 surface expression.</li>
	<li>Incubate the tubes on a shaker for 10 min at room temperature (RT).</li>
	<li>Add 2 mL of FACS buffer to wash.</li>
	<li>Pellet cells at 4 &#176;C, 400 x g for 5 min. Slowly pour out supernatant and dab the edge of the tube on tissue paper. Resuspend cells in each tube using 400 &#181;L of FACS buffer with 1 &#181;L of RNase inhibitor and 0.5 &#181;L of propidium iodide (PI, 1:1,000 dilution).</li>
</ol>
6. Index FACS Sorting
NOTE: This step should take ~1 h.
<ol>
	<li>Following standard FACS procedure, draw gates based on scatter (excluding debris), single cells, live cells (PI negative), microglia and myeloid cells (CD45+, CD11b+). 
	NOTE: Typical microglial cells express CD45 at lower levels compared with other border-associated macrophages, such as perivascular and meningeal macrophages, and therefore gating on CD45 low CD11b+ should be sufficient if the focus of the research is gene expression profiles in these classical microglia1,2. However, certain subsets of microglia may have higher CD45 expression and this is particularly true during development or in disease conditions. To ensure unbiased analysis of microglial gene expression, CD45 high and CD45 low immunophenotypes can be recorded through index sorting setting and both populations collected for sequencing and downstream analysis. In addition, TMEM119 surface expression may be used to target the homeostatic microglial population (see step 5.2) and analyzed together with CD45 levels and the sequencing results.</li>
	<li>Sort single microglia (with a 100 &#181;m nozzle) into 96-well polymerase chain reaction (PCR) plates, containing 4 &#181;L of lysis buffer each well (see the published protocol14 for details). 
	NOTE: The External RNA Control Consortium (ERCC) RNA spike-in mix (Table of Materials) can be added at 1:2.4 x 107 in the lysis buffer for quality control and normalization purposes2.</li>
	<li>Briefly vortex the plates and spin down using a bench-top centrifuge.</li>
	<li>Immediately freeze the samples on dry ice. Store the plates at -80 &#176;C until library preparation. 
	NOTE: Alternatively, more cells can be collected into 1.5 mL tubes with RNA extraction buffer for bulk RNA-seq. According to authors' experience, 3,000 cells are sufficient to generate good quality libraries following the published protocol2,14.</li>
</ol>
7. Single-cell RNA-sequencing Library Preparation
NOTE: Here, the published protocol14 is followed to generate scRNA-seq libraries with the aid of liquid handling robotics and a few modifications. In this article, the procedure is only briefly described, and the differences are highlighted. Processing 4 plates simultaneously takes about 2.5 days.
<ol>
	<li>Thaw plates on ice and perform reverse transcription with Oligo-dT30VN primer (in the lysis buffer) to generate cDNA with thermal cyclers (Table 1): 42 &#176;C 90 min; 70 &#176;C 5 min; 4 &#176;C hold. Then amplify cDNA with an additional exonuclease digestion step at the beginning (Table 2) using the PCR master mix and in situ PCR (ISPCR) primers (Table of Materials) and the following PCR condition: 37 &#176;C 30 min; 95 &#176;C 3 min; 23 cycles of 98 &#176;C 20 s, 67 &#176;C 15 s, 72 &#176;C 4 min; 72 &#176;C 5 min.</li>
	<li>Purify cDNA using 18 &#181;L of magnetic beads per well (0.7:1 ratio). Incubate the plate on a magnetic stand for 5 min and wash samples twice with freshly made 80% ethanol, 80 &#181;L per well each time. After drying the plate for 15-20 min, elute cDNA with 20 &#181;L of elution buffer per well. 
	NOTE: For quality control, use a fragment analyzer (high sensitivity next-generation sequencing [NGS] fragment analysis, 1&#8722;6,000 bp) to check size distributions and concentrations of cDNA, and only further process samples with a smear between 500&#8722;5,000 bp, and higher than 0.05 ng/&#181;L.</li>
	<li>To generate libraries, mix 0.4 &#181;L of each cDNA sample with 1.2 &#181;L of Tn5 tagmentation reagents from the library preparation kit (Table of Materials) in a 384-well plate with the aid of a nanoliter pipetting machine, at 55 &#176;C 10 min. 
	NOTE: Here, 1/12.5 of the suggested reaction volume (5 &#181;L sample and 15 &#181;L of tagmentation reagents) is added in order to reduce cost and meanwhile increase throughput. A nanoliter pipetting machine (Table of Materials) is used to transfer reagents (this and following steps) from and to 384-well plates.</li>
	<li>Add 0.4 &#181;L of neutralization buffer to stop the tagmentation reaction at RT for 5 min.</li>
	<li>Add 384 indexes (Table of Materials, 0.4 &#181;L forward and 0.4 &#181;L reverse), 1.2 &#181;L of PCR mix to samples (2 &#181;L each), and amplify the libraries using the following condition: 72 &#176;C 3 min; 95 &#176;C 30 s; 10 cycles of 95 &#176;C 10 s, 55 &#176;C 30 s, 72 &#176;C 1 min; 72 &#176;C 5 min.</li>
	<li>Pool all individual libraries (take 1 &#181;L each) from the same 384-well plate together, and use magnetic beads (Table of Materials, 0.7:1 ratio) to purify the final pooled libraries.</li>
	<li>Use a fluorometer (Table of Materials) to measure the concentrations and a bioanalyzer (Table of Materials) to examine the size distributions of pooled libraries before sequencing. Target the sequencing depth at 1 million raw reads per cell.</li>
	<li>Follow standard bioinformatic procedures to filter and trim sequencing reads and perform alignment2. Use the count table and meta data as inputs to do clustering analysis with the Seurat package15.</li>
</ol>

<ol>
	<li>Li, Q., Barres, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microglia+and+macrophages+in+brain+homeostasis+and+disease.">Microglia and macrophages in brain homeostasis and disease.</a> Nature Reviews Immunology. 18 (4), 225-242 (2018).</li><li>Li, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Developmental+Heterogeneity+of+Microglia+and+Brain+Myeloid+Cells+Revealed+by+Deep+Single-Cell+RNA+Sequencing.">Developmental Heterogeneity of Microglia and Brain Myeloid Cells Revealed by Deep Single-Cell RNA Sequencing.</a> Neuron. 101 (2), 207-223 (2019).</li><li>Keren-Shaul, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Unique+Microglia+Type+Associated+with+Restricting+Development+of+Alzheimer's+Disease.">A Unique Microglia Type Associated with Restricting Development of Alzheimer's Disease.</a> Cell. 169 (7), 1276-1290 (2017).</li><li>Bohlen, C. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diverse+Requirements+for+Microglial+Survival,+Specification,+and+Function+Revealed+by+Defined-Medium+Cultures.">Diverse Requirements for Microglial Survival, Specification, and Function Revealed by Defined-Medium Cultures.</a> Neuron. 94 (4), 759-773 (2017).</li><li>Guerreiro, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TREM2+variants+in+Alzheimer's+disease.">TREM2 variants in Alzheimer's disease.</a> New England Journal of Medicine. 368 (2), 117-127 (2013).</li><li>Jonsson, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Variant+of+TREM2+associated+with+the+risk+of+Alzheimer's+disease.">Variant of TREM2 associated with the risk of Alzheimer's disease.</a> New England Journal of Medicine. 368 (2), 107-116 (2013).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+RNA-sequencing+transcriptome+and+splicing+database+of+glia,+neurons,+and+vascular+cells+of+the+cerebral+cortex.">An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex.</a> Journal of Neuroscience. 34 (36), 11929-11947 (2014).</li><li>Colonna, M., Butovsky, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microglia+Function+in+the+Central+Nervous+System+During+Health+and+Neurodegeneration.">Microglia Function in the Central Nervous System During Health and Neurodegeneration.</a> Annual Review of Immunology. 35, 441-468 (2017).</li><li>Bennett, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+tools+for+studying+microglia+in+the+mouse+and+human+CNS.">New tools for studying microglia in the mouse and human CNS.</a> Proceedings of the National Academy of Sciences of the United States of America. 113 (12), 1738-1746 (2016).</li><li>Hammond, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-Cell+RNA+Sequencing+of+Microglia+throughout+the+Mouse+Lifespan+and+in+the+Injured+Brain+Reveals+Complex+Cell-State+Changes.">Single-Cell RNA Sequencing of Microglia throughout the Mouse Lifespan and in the Injured Brain Reveals Complex Cell-State Changes.</a> Immunity. 50 (1), 253-271 (2019).</li><li>Van Hove, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single-cell+atlas+of+mouse+brain+macrophages+reveals+unique+transcriptional+identities+shaped+by+ontogeny+and+tissue+environment.">A single-cell atlas of mouse brain macrophages reveals unique transcriptional identities shaped by ontogeny and tissue environment.</a> Nature Neuroscience. 22 (6), 1021-1035 (2019).</li><li>Chen, G., Ning, B., Shi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-Cell+RNA-Seq+Technologies+and+Related+Computational+Data+Analysis.">Single-Cell RNA-Seq Technologies and Related Computational Data Analysis.</a> Frontiers in Genetics. 10, 317 (2019).</li><li>Svensson, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Power+analysis+of+single-cell+RNA-sequencing+experiments.">Power analysis of single-cell RNA-sequencing experiments.</a> Nature Methods. 14 (4), 381-387 (2017).</li><li>Picelli, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Full-length+RNA-seq+from+single+cells+using+Smart-seq2.">Full-length RNA-seq from single cells using Smart-seq2.</a> Nature Protocols. 9 (1), 171-181 (2014).</li><li>Macosko, E. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+Parallel+Genome-wide+Expression+Profiling+of+Individual+Cells+Using+Nanoliter+Droplets.">Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets.</a> Cell. 161 (5), 1202-1214 (2015).</li><li>Ziegenhain, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+Analysis+of+Single-Cell+RNA+Sequencing+Methods.">Comparative Analysis of Single-Cell RNA Sequencing Methods.</a> Molecular Cell. 65 (4), 631-643 (2017).</li><li>Tabula Muris, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+transcriptomics+of+20+mouse+organs+creates+a+Tabula+Muris.">Single-cell transcriptomics of 20 mouse organs creates a Tabula Muris.</a> Nature. 562 (7727), 367-372 (2018).</li><li>Bohlen, C. J., Bennett, F. C., Bennett, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+Culture+of+Microglia.">Isolation and Culture of Microglia.</a> Current Protocols in Immunology. 125 (1), 70 (2018).</li><li>Haimon, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Re-evaluating+microglia+expression+profiles+using+RiboTag+and+cell+isolation+strategies.">Re-evaluating microglia expression profiles using RiboTag and cell isolation strategies.</a> Nature Immunology. 19 (6), 636-644 (2018).</li><li>Collins, H. Y., Bohlen, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+Culture+of+Rodent+Microglia+to+Promote+a+Dynamic+Ramified+Morphology+in+Serum-free+Medium.">Isolation and Culture of Rodent Microglia to Promote a Dynamic Ramified Morphology in Serum-free Medium.</a> Journal of Visualized Experiments. (133), e57122 (2018).</li><li>Nikodemova, M., Watters, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+isolation+of+live+microglia+with+preserved+phenotypes+from+adult+mouse+brain.">Efficient isolation of live microglia with preserved phenotypes from adult mouse brain.</a> Journal of Neuroinflammation. 9, 147 (2012).</li><li>Swartzlander, D. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concurrent+cell+type-specific+isolation+and+profiling+of+mouse+brains+in+inflammation+and+Alzheimer's+disease.">Concurrent cell type-specific isolation and profiling of mouse brains in inflammation and Alzheimer's disease.</a> Journal of Clinical Investigation Insight. 3 (13), 121109 (2018).</li><li>Hennig, B. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-Scale+Low-Cost+NGS+Library+Preparation+Using+a+Robust+Tn5+Purification+and+Tagmentation+Protocol.">Large-Scale Low-Cost NGS Library Preparation Using a Robust Tn5 Purification and Tagmentation Protocol.</a> G3. 8 (1), 79-89 (2018).</li></ol>

The authors have nothing to disclose.

Microglia actively interact with other cell types in the CNS, and they are very sensitive to environmental stimuli. In order to minimize inflammatory responses and aberrant changes in their gene expression during the isolation process, this protocol has been streamlined from a previously published method9, and it is now suitable to isolate microglia from multiple regions of a single mouse brain hemisphere in parallel. The tissues and reagents are kept at cold temperature and experiments are perfor...

Microglia, representing 5%&#8722;10% of all neural cells, are resident macrophages scattered throughout the central nervous system (CNS)1. Protected behind blood-brain barrier, typical microglia in a healthy adult brain contain many fine processes that rapidly extend and retract to interact with neurons and other glial cells in the parenchyma. Microglia can also adopt the amoeboid morphology associated with increased phagocytic function during specific developmental stages or upon immune challenges in injury and disease1,2,3,4. Recent exciting discoveries have clearly demonstrated that microglia are by no means passive bystanders to brain-derived or pathological signals, but play pivotal roles in controlling brain development and homeostasis, for instance, by supporting neuronal survival, pruning immature synapses, promoting oligodendrocyte lineage cells differentiation as well as angiogenesis1. As more functions of microglia are elucidated, the excitement is further fueled by human genetics studies, which showed that many neurodegenerative disease risk genes, such as TREM2, are predominantly or exclusively expressed by microglia5,6,7. Given their significance in development and plausible disease-driving roles, tremendous effort has recently been put towards our understanding of microglial gene regulation and function in hope of finding new therapeutic targets for neurodegenerative diseases1,8.
RNA sequencing (RNA-seq) allows unbiased characterization of cell type-specific gene expression, which in turn guides scientists to investigate gene functions in dense cellular networks7. RNA-seq had been mostly done on bulk samples, leading to the discovery of a homeostatic microglial gene signature that distinguishes them from other neural and immune cells9. However, such an approach could overlook molecular and functional differences among microglia, especially those transiently present in development, or associated with aging and disease. Indeed, single-cell RNA-seq (scRNA-seq) offers the sensitivity and resolution that have revolutionized the field by revealing previously underappreciated heterogeneity of microglia in a variety of contexts2,3,10. In addition, due to the presence of other similar immune cells at the CNS-circulation interface, scRNA-seq provides information aiding the design of new tools to separate and functionally dissect these related cells with little prior knowledge2,11.
A diverse array of scRNA-seq platforms have been invented, each suitable for certain applications12. In general, droplet-based methods, such as 10x Genomics, are higher in throughput with (tens of) thousands of cells sequenced in each run, and they are less selective for the input which may contain mixed cell populations requiring broad categorization. Plate-based methods provide higher sensitivity and read depth13,14, usually targeting specific populations from cell sorting to reveal subtle differences or rare transcripts. Given the small percentage of microglial cells, particularly those development- or disease-associated subpopulations, among all CNS cell types, it is often desirable to isolate microglia from a specific region of interest and obtain deep and full-length transcriptomic information in order to understand their heterogeneity.
Here, we provide details on how to isolate microglia from different mouse brain regions dissected from a single hemisphere, which are used for single-cell (or bulk) RNA-seq following a semi-automated plate-based library preparation procedure. The other hemisphere can then be used for histological validation. Streamlined from a previously published method9, this isolation protocol aims to maximize the yield from small amount of starting materials, and meanwhile maintain endogenous microglial gene expression profiles. We use fluorescence-activated cell sorting (FACS) to enrich microglia (or other related immune cells of interest) into 96-well plates and miniaturize the volumes of reagents for library preparation in order to increase throughput. We highlight this sensitive scRNA-seq platform, although other plate-based strategies may be applied. This method can be easily adapted to isolate microglia from other dissected tissues, such as injury or disease foci, and the age of the mouse can vary across almost any postnatal stages. Efficient isolation of regional microglia for single-cell transcriptomics studies will facilitate better understanding of their functions in health and disease.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>5 M Betaine</td>
			<td>Sigma-Aldrich</td>
			<td>Cat# B0300-5VL</td>
			<td></td>
		</tr>
		<tr>
			<td>10 mM dNTP mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# R0192</td>
			<td></td>
		</tr>
		<tr>
			<td>0.5 M EDTA, pH 8.0</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 15575020</td>
			<td></td>
		</tr>
		<tr>
			<td>10X Hanks' Balanced Salt Solution</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 14185-052</td>
			<td></td>
		</tr>
		<tr>
			<td>1 M HEPES</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 15630080</td>
			<td></td>
		</tr>
		<tr>
			<td>1X KAPA HIFI Hotstart Master Mix</td>
			<td>Kapa Biosciences</td>
			<td>Cat# KK2602</td>
			<td></td>
		</tr>
		<tr>
			<td>5 mL Round Bottom Polystyrene Tube, with Cell Strainer Cap</td>
			<td>Corning</td>
			<td>Cat# 352235</td>
			<td></td>
		</tr>
		<tr>
			<td>AATI, High Sensitivity NGS Fragment Analysis Kit (1 bp &#8211; 6,000 bp)</td>
			<td>Advanced Analytical</td>
			<td>Cat# DNF-474-1000</td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine Serum Albumin</td>
			<td>Sigma Aldrich</td>
			<td>Cat# A8806</td>
			<td></td>
		</tr>
		<tr>
			<td>DNase I</td>
			<td>Worthington</td>
			<td>Cat# LS002007</td>
			<td>Working solution: 12500 units/ml</td>
		</tr>
		<tr>
			<td>DTT, Molecular Grade</td>
			<td>Promega</td>
			<td>Cat# P1171</td>
			<td></td>
		</tr>
		<tr>
			<td>ERCC RNA Spike-In Mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 4456740</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 10437-028</td>
			<td></td>
		</tr>
		<tr>
			<td>Illumina XT Index Kit v2 Set A (96 indexes)</td>
			<td>Illumina</td>
			<td>Cat# FC-131-2001</td>
			<td></td>
		</tr>
		<tr>
			<td>Illumina XT Index Kit v2 Set B (96 indexes)</td>
			<td>Illumina</td>
			<td>Cat# FC-131-2002</td>
			<td></td>
		</tr>
		<tr>
			<td>Illumina XT Index Kit v2 Set C (96 indexes)</td>
			<td>Illumina</td>
			<td>Cat# FC-131-2003</td>
			<td></td>
		</tr>
		<tr>
			<td>Illumina XT Index Kit v2 Set D (96 indexes)</td>
			<td>Illumina</td>
			<td>Cat# FC-131-2004</td>
			<td></td>
		</tr>
		<tr>
			<td>Lambda Exonuclease (5 U/&#956;l)</td>
			<td>New England BioLabs</td>
			<td>Cat# M0262S</td>
			<td></td>
		</tr>
		<tr>
			<td>Mouse Fc block</td>
			<td>BD Pharmingen</td>
			<td>Cat# 553142</td>
			<td></td>
		</tr>
		<tr>
			<td>Myelin removal beads</td>
			<td>Miltenyl Biotec</td>
			<td>Cat# 130-096-433</td>
			<td></td>
		</tr>
		<tr>
			<td>Nextera XT DNA Sample Prep Kit</td>
			<td>Illumina</td>
			<td>Cat# FC-131-1096</td>
			<td></td>
		</tr>
		<tr>
			<td>NextSeq 500/550 High Output Kit v2.5 (150 Cycles)</td>
			<td>Illumina</td>
			<td>Cat# 20024907</td>
			<td></td>
		</tr>
		<tr>
			<td>PBS (10X), pH 7.4</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 70011044</td>
			<td></td>
		</tr>
		<tr>
			<td>PCRClean DX beads</td>
			<td>Aline Biosciences</td>
			<td>Cat# C-1003-50</td>
			<td></td>
		</tr>
		<tr>
			<td>Propidium Iodide</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# P3566</td>
			<td>Staining: 1:1000</td>
		</tr>
		<tr>
			<td>Qubit dsDNA HS Assay Kit</td>
			<td>Thermal Fisher Scientific</td>
			<td>Cat# Q32851</td>
			<td></td>
		</tr>
		<tr>
			<td>Rat monoclonal anti mouse/human CD11b, Brilliant Violet 421 (clone M1/70)</td>
			<td>BioLegend</td>
			<td>Cat# 101236; RRID: AB_11203704</td>
			<td>Staining: 1:300</td>
		</tr>
		<tr>
			<td>Rat monoclonal anti mouse CD45, PE/Cy7 (clone 30-F11)</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 25-0451-82; RRID: AB_469625</td>
			<td>Staining: 1:300</td>
		</tr>
		<tr>
			<td>Recombinant RNase Inhibitor</td>
			<td>Takara Bio</td>
			<td>Cat# 2313B</td>
			<td></td>
		</tr>
		<tr>
			<td>SMARTScribe Reverse Transcriptase (100 U/&#956;l)</td>
			<td>Clontech</td>
			<td>Cat# 639538</td>
			<td>Containing 5x First strand buffer</td>
		</tr>
		<tr>
			<td colspan="4">Oligonucleotides</td>
		</tr>
		<tr>
			<td>0.1 &#956;M ISPCR Oligo: 5&#39; - AAGCAGTGGTATCAA CGCAGAGT-3&#39;</td>
			<td></td>
			<td></td>
			<td>(Picelli et al., 2014)</td>
		</tr>
		<tr>
			<td>Oligo-dT30VN primer: 5&#39; - AAGCAGTGGTATCAACGCA GAGTACT 30 VN-3&#39;</td>
			<td></td>
			<td></td>
			<td>(Picelli et al., 2014)</td>
		</tr>
		<tr>
			<td>TSO 5&#39; - AAGCAGTGGTATCAACGCAGA GTACATrGrG+G-3&#39; (&#34;r&#34; is forribobases and &#34;+&#34; is for an LNA base)</td>
			<td></td>
			<td></td>
			<td>(Picelli et al., 2014)</td>
		</tr>
		<tr>
			<td colspan="4">Solutions</td>
		</tr>
		<tr>
			<td>FACS buffer</td>
			<td></td>
			<td></td>
			<td>Recipe: sterile-filtered 1% FBS, 2 mM EDTA, 25 mM HEPES in 1X PBS</td>
		</tr>
		<tr>
			<td>MCS buffer</td>
			<td></td>
			<td></td>
			<td>Recipe: sterile-filtered 0.5% BSA, 2 mM EDTA in 1X PBS</td>
		</tr>
		<tr>
			<td>Medium A</td>
			<td></td>
			<td></td>
			<td>Recipe: 15 mM HEPES, 0.5% glucose in 1X HBSS without phenol red</td>
		</tr>
		<tr>
			<td colspan="4">Plates</td>
		</tr>
		<tr>
			<td>384-well Rigi-Plate PCR Microplates, Axygen Scientific</td>
			<td>VWR</td>
			<td>89005-556</td>
			<td></td>
		</tr>
		<tr>
			<td>Hard-shell 96-well PCR plates</td>
			<td>Bio-Rad</td>
			<td>HSP9631</td>
			<td></td>
		</tr>
		<tr>
			<td colspan="4">Others</td>
		</tr>
		<tr>
			<td>Dumont #55 forceps</td>
			<td>Fine Science Tools</td>
			<td>11295-51</td>
			<td></td>
		</tr>
		<tr>
			<td>Dounce homogenizer, 2 ml</td>
			<td>Wheaton</td>
			<td>357422</td>
			<td></td>
		</tr>
		<tr>
			<td>Large depletion column</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-901</td>
			<td></td>
		</tr>
		<tr>
			<td>Large selection column</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-401</td>
			<td></td>
		</tr>
		<tr>
			<td>MACS MultiStand</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-303</td>
			<td></td>
		</tr>
		<tr>
			<td>QuadroMACS Separator</td>
			<td>Miltenyi Biotec</td>
			<td>130-090-976</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAzap</td>
			<td>Thermo Fisher Scientific</td>
			<td>AM9780</td>
			<td></td>
		</tr>
		<tr>
			<td>Strainer (70 &#956;m)</td>
			<td>Falcon</td>
			<td>352350</td>
			<td></td>
		</tr>
		<tr>
			<td colspan="4">Equipment</td>
		</tr>
		<tr>
			<td>BD FACSAria II</td>
			<td>BD Biosciences</td>
			<td><a href="http://www.bdbiosciences.com/documents/BD_FACSAria_II_cell_sorter_brochure.pdf" target="_blank">http://www.bdbiosciences.com/</a></td>
			<td></td>
		</tr>
		<tr>
			<td>Bioanalyzer</td>
			<td>Agilent</td>
			<td>2100</td>
			<td></td>
		</tr>
		<tr>
			<td>Fragment Analyzer</td>
			<td>Agilent</td>
			<td>5300</td>
			<td></td>
		</tr>
		<tr>
			<td>Mosquito HTS nanoliter pipetting robot</td>
			<td>TTP Labtech</td>
			<td><a href="https://www.ttplabtech.com/products/liquid-handling/mosquito-hts/" target="_blank">https://www.ttplabtech.com/</a></td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit 4 Fluorometer</td>
			<td>Thermo Fisher Scientific</td>
			<td>Q33226</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolation of region-specific microglia from one adult mouse brain hemisphere for deep single-cell rna sequencing

As resident macrophages in the central nervous system, microglia actively control brain development and homeostasis, and their dysfunctions may drive human diseases. Considerable advances have been made to uncover the molecular signatures of homeostatic microglia as well as alterations of their gene expression in response to environmental stimuli. With the advent and maturation of single-cell genomic methodologies, it is increasingly recognized that heterogenous microglia may underlie the diverse roles they play in different developmental and pathological conditions. Further dissection of such heterogeneity can be achieved through efficient isolation of microglia from a given region of interest, followed by sensitive profiling of individual cells. Here, we provide a detailed protocol for the rapid isolation of microglia from different brain regions in a single adult mouse brain hemisphere. We also demonstrate how to use these sorted microglia for plate-based deep single-cell RNA sequencing. We discuss the adaptability of this method to other scenarios and provide guidelines for improving the system to accommodate large-scale studies.

This protocol describes a method to isolate and sort microglia from different brain regions in one adult perfused brain hemisphere, followed by scRNA-seq. We use douncing to create single cell suspension and also as a first step to enrich microglia. Insufficient or over-douncing reduces the yield. In addition, adult mouse brains contain high levels of myelin, which can also reduce sorting efficiency and yield if not removed properly. Therefore, we examine the cell suspension under microscope by using trypan blue and a he...

Watch this Scientific Journal Video about Isolation of Region-specific Microglia from One Adult Mouse Brain Hemisphere for Deep Single-cell RNA Sequencing at JoVE.com

Isolation of Region-specific Microglia from One Adult Mouse Brain Hemisphere for Deep Single-cell RNA Sequencing

We provide a protocol for isolation of microglia from different dissected regions of an adult mouse brain hemisphere, followed by semi-automated library preparation for deep single-cell RNA sequencing of full-length transcriptomes. This method will help to elucidate functional heterogeneity of microglia in health and disease.

As resident macrophages in the central nervous system, microglia actively control brain development and homeostasis, and their dysfunctions may drive ...

isolation-region-specific-microglia-from-one-adult-mouse-brain

Research

JoVE Journal

Neuroscience

10.7K Views.  Stanford University School of Medicine. We provide a protocol for isolation of microglia from different dissected regions of an adult mouse brain hemisphere, followed by semi-automated library preparation for deep single-cell RNA sequencing of full-length transcriptomes. This method will help to elucidate functional heterogeneity of microglia in health and disease.

Video: Isolation of Region-specific Microglia from One Adult Mouse Brain Hemisphere for Deep Single-cell RNA Sequencing

Non-Laser Capture Microscopy Approach for the Microdissection of Discrete Mouse Brain Regions for Total RNA Isolation and Downstream Next-Generation Sequencing and Gene Expression Profiling

As technological platforms, approaches such as next-generation sequencing, microarray, and qRT-PCR have great promise for expanding our understanding of the breadth of molecular regulation. Newer approaches such as high-resolution RNA sequencing (RNA-Seq)1 provides new and expansive information about tissue- or state-specific expression such as relative transcript levels, alternative splicing, and micro RNAs2-4. Prospects for employing the RNA-Seq method in comparative whole transcriptome profiling5 within discrete tissues or between phenotypically distinct groups of individuals affords new avenues for elucidating molecular mechanisms involved in both normal and abnormal physiological states. Recently, whole transcriptome profiling has been performed on human brain tissue, identifying gene expression differences associated with disease progression6. However, the use of next-generation sequencing has yet to be more widely integrated into mammalian studies.
Gene expression studies in mouse models have reported distinct profiles within various brain nuclei using laser capture microscopy (LCM) for sample excision7,8. While LCM affords sample collection with single-cell and discrete brain region precision, the relatively low total RNA yields from the LCM approach can be prohibitive to RNA-Seq and other profiling approaches in mouse brain tissues and may require sub-optimal sample amplification steps. Here, a protocol is presented for microdissection and total RNA extraction from discrete mouse brain regions. Set-diameter tissue corers are used to isolate 13 tissues from 750-&mu;m serial coronal sections of an individual mouse brain. Tissue micropunch samples are immediately frozen and archived. Total RNA is obtained from the samples using magnetic bead-enabled total RNA isolation technology. Resulting RNA samples have adequate yield and quality for use in downstream expression profiling. This microdissection strategy provides a viable option to existing sample collection strategies for obtaining total RNA from discrete brain regions, opening possibilities for new gene expression discoveries.

Non-Laser Capture Microscopy Approach for the Microdissection of Discrete Mouse Brain Regions for Total RNA Isolation and Downstream Next-Generation Sequencing and Gene Expression Profiling  |

RNA expression profiling of discrete mouse brain regions requires a precise and repeatable tissue collection strategy. A protocol that uses both coronal brain sectioning and tissue corer-assisted microdissection is described here. The yield and quality of total RNA obtained from the resulting samples confirms the utility of the outlined method.

As technological platforms, approaches such as next-generation sequencing, microarray, and qRT-PCR have great promise for expanding our understanding of ...

One Mouse, Two Cultures: Isolation and Culture of Adult Neural Stem Cells from the Two Neurogenic Zones of Individual Mice

The neurosphere assay and the adherent monolayer culture system are valuable tools to determine the potential (proliferation or differentiation) of adult neural stem cells in vitro. These assays can be used to compare the precursor potential of cells isolated from genetically different or differentially treated animals&#160;to determine the effects of exogenous factors on neural precursor cell proliferation and differentiation and to generate neural precursor cell lines that can be assayed over continuous passages. The neurosphere assay is traditionally used for the post-hoc identification of stem cells, primarily due to the lack of definitive markers with which they can be isolated from primary tissue&#160;and has the major advantage of giving a quick estimate of precursor cell numbers in brain tissue derived from individual animals. Adherent monolayer cultures, in contrast, are not traditionally used to compare proliferation between individual animals, as each culture is generally initiated from the combined tissue of between 5-8 animals. However, they have the major advantage that, unlike neurospheres, they consist of a mostly homogeneous population of precursor cells and are useful for following the differentiation process in single cells. Here, we describe, in detail, the generation of neurosphere cultures and, for the first time, adherent cultures from individual animals. This has many important implications including paired analysis of proliferation and/or differentiation potential in both the subventricular zone (SVZ) and dentate gyrus (DG) of treated or genetically different mouse lines, as well as a significant reduction in animal usage.

Here we describe a detailed protocol for the simultaneous generation of neural precursor cell cultures, as either adherent monolayers or neurospheres, from the subventricular zone and dentate gyrus of individual adult mice.

The neurosphere assay and the adherent monolayer culture system are valuable tools to determine the potential (proliferation or differentiation) of adult ...

Brain Slice Biotinylation: An Ex Vivo Approach to Measure Region-specific Plasma Membrane Protein Trafficking in Adult Neurons

Regulated endocytic trafficking is the central mechanism facilitating a variety of neuromodulatory events, by dynamically controlling receptor, ion channel, and transporter cell surface presentation on a minutes time scale.&#160;There is a broad diversity of mechanisms that control endocytic trafficking of individual proteins. Studies investigating the molecular underpinnings of trafficking have primarily relied upon surface biotinylation to quantitatively measure changes in membrane protein surface expression in response to exogenous stimuli and gene manipulation.&#160;However, this approach has been mainly limited to cultured cells, which may not faithfully reflect the physiologically relevant mechanisms at play in adult neurons.&#160;Moreover, cultured cell approaches may underestimate region-specific differences in trafficking mechanisms.&#160;Here, we describe an approach that extends cell surface biotinylation to the acute brain slice preparation.&#160;We demonstrate that this method provides a high-fidelity approach to measure rapid changes in membrane protein surface levels in adult neurons.&#160;This approach is likely to have broad utility in the field of neuronal endocytic trafficking.

Brain Slice Biotinylation: An Ex Vivo Approach to Measure Region-specific Plasma Membrane Protein Trafficking in Adult Neurons

Neuronal membrane trafficking dynamically controls plasma membrane protein availability and significantly impacts neurotransmission.&#160;To date, it has been challenging to measure neuronal endocytic trafficking in adult neurons.&#160;Here, we describe a highly effective, quantitative method to measure rapid changes in surface protein expression ex vivo in acute brain slices.

Regulated endocytic trafficking is the central mechanism facilitating a variety of neuromodulatory events, by dynamically controlling receptor, ion ...

Isolation and RNA Extraction of Neurons, Macrophages and Microglia from Larval Zebrafish Brains

To gain a detailed understanding of the role of different CNS cells during development or the establishment and progression of brain pathologies, it is important to isolate these cells without changing their gene expression profile. The zebrafish model provides a large number of transgenic fish lines in which specific cell types are labelled; for example neurons in the NBT:DsRed line or macrophages/microglia in the mpeg1:eGFP line. Furthermore, antibodies have been developed to stain specific cells, such as microglia with the 4C4 antibody.
Here, we describe the isolation of neurons, macrophages and microglia from larval zebrafish brains. Central to this protocol is the avoidance of an enzymatic tissue digestion at 37 &#176;C, which could modify cellular profiles. Instead a mechanical system of tissue homogenization at 4 &#176;C is used. This protocol entails homogenization of brains into cell suspension, their immuno-staining and the isolation of neurons, macrophages and microglia by FACS. Afterwards, we extracted RNA from those cells and evaluated their quality/quantity. We managed to obtain RNA of high quality (RNA Integrity Number (RIN) &#62; 7) to perform qPCR on macrophages/microglia and neurons, and transcriptomic analysis on microglia. This approach enables a better characterization of these cells, as well as a clearer understanding about their role in development and pathologies.

We present a protocol to isolate neurons, macrophages and microglia from larval zebrafish brains under physiological and pathological conditions. Upon isolation, RNA is extracted from these cells to analyze their gene expression profile. This protocol allows for the collection of high-quality RNA for performing downstream analysis like qPCR and transcriptomics.

To gain a detailed understanding of the role of different CNS cells during development or the establishment and progression of brain pathologies, it is ...

Isolation of Adult Spinal Cord Nuclei for Massively Parallel Single-nucleus RNA Sequencing

Probing an individual cell&#39;s gene expression enables the identification of cell type and cell state. Single-cell RNA sequencing has emerged as a powerful tool for studying transcriptional profiles of cells, particularly in heterogeneous tissues such as the central nervous system. However, dissociation methods required for single cell sequencing can lead to experimental changes in the gene expression and cell death. Furthermore, these methods are generally restricted to fresh tissue, thus limiting studies on archival and bio-bank material. Single nucleus RNA sequencing (snRNA-Seq) is an appealing alternative for transcriptional studies, given that it accurately identifies cell types, permits the study of tissue that is frozen or difficult to dissociate, and reduces dissociation-induced transcription. Here, we present a high-throughput protocol for rapid isolation of nuclei for downstream snRNA-Seq. This method enables isolation of nuclei from fresh or frozen spinal cord samples and can be combined with two massively parallel droplet encapsulation platforms.

Here, we present a protocol to rapidly isolate high-quality nuclei from the fresh or frozen tissue for downstream massively parallel RNA sequencing. We include detergent-mechanical and hypotonic-mechanical tissue disruption and cell lysis options, both of which can be used for isolation of nuclei.

Probing an individual cell&#39;s gene expression enables the identification of cell type and cell state. Single-cell RNA sequencing has emerged as a ...

Single-cell RNA Sequencing of Fluorescently Labeled Mouse Neurons Using Manual Sorting and Double In Vitro Transcription with Absolute Counts Sequencing (DIVA-Seq)

Single-cell RNA sequencing (RNA-seq) is now a widely implemented tool for assaying gene expression. Commercially available single-cell RNA-sequencing platforms process all input cells indiscriminately. Sometimes, fluorescence-activated cell sorting (FACS) is used upstream to isolate a specifically labeled population of interest. A limitation of FACS is the need for high numbers of input cells with significantly labeled fractions, which is impractical for collecting and profiling rare or sparsely labeled neuron populations from the mouse brain. Here, we describe a method for manually collecting sparse fluorescently labeled single neurons from freshly dissociated mouse brain tissue. This process allows for capturing single-labeled neurons with high purity and subsequent integration with an in vitro transcription-based amplification protocol that preserves endogenous transcript ratios. We describe a double linear amplification method that uses unique molecule identifiers (UMIs) to generate individual mRNA counts. Two rounds of amplification results in a high degree of gene detection per single cell.

Single-cell RNA Sequencing of Fluorescently Labeled Mouse Neurons Using Manual Sorting and Double In Vitro Transcription with Absolute Counts Sequencing DIVA-Seq

This protocol describes the manual sorting procedure to isolate single fluorescently labeled neurons followed by in vitro transcription-based mRNA amplification for high-depth single-cell RNA sequencing.

Single-cell RNA sequencing (RNA-seq) is now a widely implemented tool for assaying gene expression. Commercially available single-cell RNA-sequencing ...

Obtaining Human Microglia from Adult Human Brain Tissue

Microglia are resident innate immune cells of the central nervous system (CNS). Microglia play a critical role during development, in maintaining homeostasis, and during infection or injury. Several independent research groups have highlighted the central role that microglia play in autoimmune diseases, autoinflammatory syndromes and cancers. The activation of microglia in some neurological diseases may directly participate in pathogenic processes. Primary microglia are a powerful tool to understand the immune responses in the brain, cell-cell interactions and dysregulated microglia phenotypes in disease. Primary microglia mimic in vivo microglial properties better than immortalized microglial cell lines. Human adult microglia exhibit distinct properties as compared to human fetal and rodent microglia. This protocol provides an efficient method for isolation of primary microglia from adult human brain. Studying these microglia can provide critical insights into cell-cell interactions between microglia and other resident cellular populations in the CNS including, oligodendrocytes, neurons and astrocytes. Additionally, microglia from different human brains may be cultured for characterization of unique immune responses for personalized medicine and a myriad of therapeutic applications.

This protocol is an efficient, cost effective and robust method of isolating primary microglia from live, adult, human brain tissue. Isolated primary human microglia can serve as a tool for studying cellular processes in homeostasis and disease.

Microglia are resident innate immune cells of the central nervous system (CNS). Microglia play a critical role during development, in maintaining ...

Mouse Brain Histone Modification Quantification Using Flow Cytometry

Quantification of Global Histone Post Translational Modifications Using Intranuclear Flow Cytometry in Isolated Mouse Brain Microglia

Gene expression control occurs partially by modifications in chromatin structure, including the addition and removal of posttranslational modifications to histone tails. Histone post-translational modifications (HPTMs) can either facilitate gene expression or repression. For example, acetylation of histone tail lysine residues neutralizes the positive charge and reduces interactions between the tail and negatively charged DNA. The decrease in histone tail-DNA interactions results in increased accessibility of the underlying DNA, allowing for increased transcription factor access. The acetylation mark also serves as a recognition site for bromodomain-containing transcriptional activators, together resulting in enhanced gene expression. Histone marks can be dynamically regulated during cell differentiation and in response to different cellular environments and stimuli. While next-generation sequencing approaches have begun to characterize genomic locations for individual histone modifications, only one modification can be examined concurrently. Given that there are hundreds of different HPTMs, we have developed a high throughput, quantitative measure of global HPTMs that can be used to screen histone modifications prior to conducting more extensive genome sequencing approaches. This protocol describes a flow cytometry-based method to detect global HPTMs and can be conducted using cells in culture or isolated cells from in vivo tissues. We present example data from isolated mouse brain microglia to demonstrate the sensitivity of the assay to detect global shifts in HPTMs in response to a bacteria-derived immune stimulus (lipopolysaccharide). This protocol allows for the rapid and quantitative assessment of HPTMs and can be applied to any transcriptional or epigenetic regulator that can be detected by an antibody.

Author Spotlight: Enhancements in Gene Expression Regulation Research

This work describes a protocol for the quantification of global histone modifications using intranuclear flow cytometry in isolated brain microglia. The work also contains the microglia isolation protocol that was used for data collection.

Gene expression control occurs partially by modifications in chromatin structure, including the addition and removal of posttranslational modifications to ...

Efficient Extraction of Astrocytes and Microglia from the Adult Mouse Spinal Cord

Isolation of Pure Astrocytes and Microglia from the Adult Mouse Spinal Cord For In Vitro Assays and Transcriptomic Studies

Astrocytes and microglia play pivotal roles in central nervous system development, injury responses, and neurodegenerative diseases. These highly dynamic cells exhibit rapid responses to environmental changes and display significant heterogeneity in terms of morphology, transcriptional profiles, and functions. While our understanding of the functions of glial cells in health and disease has advanced substantially, there remains a need for in vitro, cell-specific analyses conducted in the context of insults or injuries to comprehensively characterize distinct cell populations. Isolating cells from the adult mouse offers several advantages over cell lines or neonatal animals, as it allows for the analysis of cells under pathological conditions and at specific time points. Furthermore, focusing on spinal cord-specific isolation, excluding brain involvement, enables research into spinal cord pathologies, including experimental autoimmune encephalomyelitis, spinal cord injury, and amyotrophic lateral sclerosis. This protocol presents an efficient method for isolating astrocytes and microglia from the adult mouse spinal cord, facilitating immediate or future analysis with potential applications in functional, molecular, or proteomic downstream studies.

Author Spotlight: Isolation of Glial Cells from the Adult Mouse Spinal Cord 

This protocol outlines the isolation of purified astrocytes and microglia from the adult mouse spinal cord, facilitating subsequent applications such as RNA analysis and cell culture. It includes detailed cell dissociation methods and procedures designed to enhance both the quality and yield of isolated cells.

Astrocytes and microglia play pivotal roles in central nervous system development, injury responses, and neurodegenerative diseases. These highly dynamic ...