We thank Mariko L. Bennett, Liana Nicole Bonanno, and Spyros Darmanis for their help during the development of this protocol. We also thank the Stanford Shared FACS Facility, particularly Meredith Weglarz and Lisa Nichols; Yen Tran, Michael Eckart from Stanford Protein and Nucleic Acid Facility (PAN) for their great support for the filming. This work is funded by the JPB Foundation and Vincent J. Coates Foundation.

All procedures involving rodents conformed to Stanford University guidelines, which comply with national and state laws and policies. All animal procedures were approved by Stanford University's Administrative Panel on Laboratory Animal Care.
NOTE: All solution and buffer compositions are provided in Table of Materials.
1. Preparation on the Day of Cell Isolation
<ol>
	<li>Prepare the following reagents and chill them on ice: medi...

<ol>
	<li>Li, Q., Barres, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microglia+and+macrophages+in+brain+homeostasis+and+disease.">Microglia and macrophages in brain homeostasis and disease.</a> Nature Reviews Immunology. 18 (4), 225-242 (2018).</li><li>Li, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Developmental+Heterogeneity+of+Microglia+and+Brain+Myeloid+Cells+Revealed+by+Deep+Single-Cell+RNA+Sequencing.">Developmental Heterogeneity of Microglia and Brain Myeloid Cells Revealed by Deep Single-Cell RNA Sequencing.</a> Neuron. 101 (2), 207-223 (2019).</li><li>Keren-Shaul, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Unique+Microglia+Type+Associated+with+Restricting+Development+of+Alzheimer's+Disease.">A Unique Microglia Type Associated with Restricting Development of Alzheimer's Disease.</a> Cell. 169 (7), 1276-1290 (2017).</li><li>Bohlen, C. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diverse+Requirements+for+Microglial+Survival,+Specification,+and+Function+Revealed+by+Defined-Medium+Cultures.">Diverse Requirements for Microglial Survival, Specification, and Function Revealed by Defined-Medium Cultures.</a> Neuron. 94 (4), 759-773 (2017).</li><li>Guerreiro, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TREM2+variants+in+Alzheimer's+disease.">TREM2 variants in Alzheimer's disease.</a> New England Journal of Medicine. 368 (2), 117-127 (2013).</li><li>Jonsson, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Variant+of+TREM2+associated+with+the+risk+of+Alzheimer's+disease.">Variant of TREM2 associated with the risk of Alzheimer's disease.</a> New England Journal of Medicine. 368 (2), 107-116 (2013).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+RNA-sequencing+transcriptome+and+splicing+database+of+glia,+neurons,+and+vascular+cells+of+the+cerebral+cortex.">An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex.</a> Journal of Neuroscience. 34 (36), 11929-11947 (2014).</li><li>Colonna, M., Butovsky, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microglia+Function+in+the+Central+Nervous+System+During+Health+and+Neurodegeneration.">Microglia Function in the Central Nervous System During Health and Neurodegeneration.</a> Annual Review of Immunology. 35, 441-468 (2017).</li><li>Bennett, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+tools+for+studying+microglia+in+the+mouse+and+human+CNS.">New tools for studying microglia in the mouse and human CNS.</a> Proceedings of the National Academy of Sciences of the United States of America. 113 (12), 1738-1746 (2016).</li><li>Hammond, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-Cell+RNA+Sequencing+of+Microglia+throughout+the+Mouse+Lifespan+and+in+the+Injured+Brain+Reveals+Complex+Cell-State+Changes.">Single-Cell RNA Sequencing of Microglia throughout the Mouse Lifespan and in the Injured Brain Reveals Complex Cell-State Changes.</a> Immunity. 50 (1), 253-271 (2019).</li><li>Van Hove, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single-cell+atlas+of+mouse+brain+macrophages+reveals+unique+transcriptional+identities+shaped+by+ontogeny+and+tissue+environment.">A single-cell atlas of mouse brain macrophages reveals unique transcriptional identities shaped by ontogeny and tissue environment.</a> Nature Neuroscience. 22 (6), 1021-1035 (2019).</li><li>Chen, G., Ning, B., Shi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-Cell+RNA-Seq+Technologies+and+Related+Computational+Data+Analysis.">Single-Cell RNA-Seq Technologies and Related Computational Data Analysis.</a> Frontiers in Genetics. 10, 317 (2019).</li><li>Svensson, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Power+analysis+of+single-cell+RNA-sequencing+experiments.">Power analysis of single-cell RNA-sequencing experiments.</a> Nature Methods. 14 (4), 381-387 (2017).</li><li>Picelli, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Full-length+RNA-seq+from+single+cells+using+Smart-seq2.">Full-length RNA-seq from single cells using Smart-seq2.</a> Nature Protocols. 9 (1), 171-181 (2014).</li><li>Macosko, E. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+Parallel+Genome-wide+Expression+Profiling+of+Individual+Cells+Using+Nanoliter+Droplets.">Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets.</a> Cell. 161 (5), 1202-1214 (2015).</li><li>Ziegenhain, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+Analysis+of+Single-Cell+RNA+Sequencing+Methods.">Comparative Analysis of Single-Cell RNA Sequencing Methods.</a> Molecular Cell. 65 (4), 631-643 (2017).</li><li>Tabula Muris, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+transcriptomics+of+20+mouse+organs+creates+a+Tabula+Muris.">Single-cell transcriptomics of 20 mouse organs creates a Tabula Muris.</a> Nature. 562 (7727), 367-372 (2018).</li><li>Bohlen, C. J., Bennett, F. C., Bennett, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+Culture+of+Microglia.">Isolation and Culture of Microglia.</a> Current Protocols in Immunology. 125 (1), 70 (2018).</li><li>Haimon, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Re-evaluating+microglia+expression+profiles+using+RiboTag+and+cell+isolation+strategies.">Re-evaluating microglia expression profiles using RiboTag and cell isolation strategies.</a> Nature Immunology. 19 (6), 636-644 (2018).</li><li>Collins, H. Y., Bohlen, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+Culture+of+Rodent+Microglia+to+Promote+a+Dynamic+Ramified+Morphology+in+Serum-free+Medium.">Isolation and Culture of Rodent Microglia to Promote a Dynamic Ramified Morphology in Serum-free Medium.</a> Journal of Visualized Experiments. (133), e57122 (2018).</li><li>Nikodemova, M., Watters, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+isolation+of+live+microglia+with+preserved+phenotypes+from+adult+mouse+brain.">Efficient isolation of live microglia with preserved phenotypes from adult mouse brain.</a> Journal of Neuroinflammation. 9, 147 (2012).</li><li>Swartzlander, D. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concurrent+cell+type-specific+isolation+and+profiling+of+mouse+brains+in+inflammation+and+Alzheimer's+disease.">Concurrent cell type-specific isolation and profiling of mouse brains in inflammation and Alzheimer's disease.</a> Journal of Clinical Investigation Insight. 3 (13), 121109 (2018).</li><li>Hennig, B. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-Scale+Low-Cost+NGS+Library+Preparation+Using+a+Robust+Tn5+Purification+and+Tagmentation+Protocol.">Large-Scale Low-Cost NGS Library Preparation Using a Robust Tn5 Purification and Tagmentation Protocol.</a> G3. 8 (1), 79-89 (2018).</li></ol>

The authors have nothing to disclose.

Microglia actively interact with other cell types in the CNS, and they are very sensitive to environmental stimuli. In order to minimize inflammatory responses and aberrant changes in their gene expression during the isolation process, this protocol has been streamlined from a previously published method9, and it is now suitable to isolate microglia from multiple regions of a single mouse brain hemisphere in parallel. The tissues and reagents are kept at cold temperature and experiments are perfor...

Microglia, representing 5%&#8722;10% of all neural cells, are resident macrophages scattered throughout the central nervous system (CNS)1. Protected behind blood-brain barrier, typical microglia in a healthy adult brain contain many fine processes that rapidly extend and retract to interact with neurons and other glial cells in the parenchyma. Microglia can also adopt the amoeboid morphology associated with increased phagocytic function during specific developmental stages or upon immune challenges in injury and disease1,2,3,4. Recent exciting discoveries have clearly demonstrated that microglia are by no means passive bystanders to brain-derived or pathological signals, but play pivotal roles in controlling brain development and homeostasis, for instance, by supporting neuronal survival, pruning immature synapses, promoting oligodendrocyte lineage cells differentiation as well as angiogenesis1. As more functions of microglia are elucidated, the excitement is further fueled by human genetics studies, which showed that many neurodegenerative disease risk genes, such as TREM2, are predominantly or exclusively expressed by microglia5,6,7. Given their significance in development and plausible disease-driving roles, tremendous effort has recently been put towards our understanding of microglial gene regulation and function in hope of finding new therapeutic targets for neurodegenerative diseases1,8.
RNA sequencing (RNA-seq) allows unbiased characterization of cell type-specific gene expression, which in turn guides scientists to investigate gene functions in dense cellular networks7. RNA-seq had been mostly done on bulk samples, leading to the discovery of a homeostatic microglial gene signature that distinguishes them from other neural and immune cells9. However, such an approach could overlook molecular and functional differences among microglia, especially those transiently present in development, or associated with aging and disease. Indeed, single-cell RNA-seq (scRNA-seq) offers the sensitivity and resolution that have revolutionized the field by revealing previously underappreciated heterogeneity of microglia in a variety of contexts2,3,10. In addition, due to the presence of other similar immune cells at the CNS-circulation interface, scRNA-seq provides information aiding the design of new tools to separate and functionally dissect these related cells with little prior knowledge2,11.
A diverse array of scRNA-seq platforms have been invented, each suitable for certain applications12. In general, droplet-based methods, such as 10x Genomics, are higher in throughput with (tens of) thousands of cells sequenced in each run, and they are less selective for the input which may contain mixed cell populations requiring broad categorization. Plate-based methods provide higher sensitivity and read depth13,14, usually targeting specific populations from cell sorting to reveal subtle differences or rare transcripts. Given the small percentage of microglial cells, particularly those development- or disease-associated subpopulations, among all CNS cell types, it is often desirable to isolate microglia from a specific region of interest and obtain deep and full-length transcriptomic information in order to understand their heterogeneity.
Here, we provide details on how to isolate microglia from different mouse brain regions dissected from a single hemisphere, which are used for single-cell (or bulk) RNA-seq following a semi-automated plate-based library preparation procedure. The other hemisphere can then be used for histological validation. Streamlined from a previously published method9, this isolation protocol aims to maximize the yield from small amount of starting materials, and meanwhile maintain endogenous microglial gene expression profiles. We use fluorescence-activated cell sorting (FACS) to enrich microglia (or other related immune cells of interest) into 96-well plates and miniaturize the volumes of reagents for library preparation in order to increase throughput. We highlight this sensitive scRNA-seq platform, although other plate-based strategies may be applied. This method can be easily adapted to isolate microglia from other dissected tissues, such as injury or disease foci, and the age of the mouse can vary across almost any postnatal stages. Efficient isolation of regional microglia for single-cell transcriptomics studies will facilitate better understanding of their functions in health and disease.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>5 M Betaine</td>
			<td>Sigma-Aldrich</td>
			<td>Cat# B0300-5VL</td>
			<td></td>
		</tr>
		<tr>
			<td>10 mM dNTP mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# R0192</td>
			<td></td>
		</tr>
		<tr>
			<td>0.5 M EDTA, pH 8.0</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 15575020</td>
			<td></td>
		</tr>
		<tr>
			<td>10X Hanks' Balanced Salt Solution</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 14185-052</td>
			<td></td>
		</tr>
		<tr>
			<td>1 M HEPES</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 15630080</td>
			<td></td>
		</tr>
		<tr>
			<td>1X KAPA HIFI Hotstart Master Mix</td>
			<td>Kapa Biosciences</td>
			<td>Cat# KK2602</td>
			<td></td>
		</tr>
		<tr>
			<td>5 mL Round Bottom Polystyrene Tube, with Cell Strainer Cap</td>
			<td>Corning</td>
			<td>Cat# 352235</td>
			<td></td>
		</tr>
		<tr>
			<td>AATI, High Sensitivity NGS Fragment Analysis Kit (1 bp &#8211; 6,000 bp)</td>
			<td>Advanced Analytical</td>
			<td>Cat# DNF-474-1000</td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine Serum Albumin</td>
			<td>Sigma Aldrich</td>
			<td>Cat# A8806</td>
			<td></td>
		</tr>
		<tr>
			<td>DNase I</td>
			<td>Worthington</td>
			<td>Cat# LS002007</td>
			<td>Working solution: 12500 units/ml</td>
		</tr>
		<tr>
			<td>DTT, Molecular Grade</td>
			<td>Promega</td>
			<td>Cat# P1171</td>
			<td></td>
		</tr>
		<tr>
			<td>ERCC RNA Spike-In Mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 4456740</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 10437-028</td>
			<td></td>
		</tr>
		<tr>
			<td>Illumina XT Index Kit v2 Set A (96 indexes)</td>
			<td>Illumina</td>
			<td>Cat# FC-131-2001</td>
			<td></td>
		</tr>
		<tr>
			<td>Illumina XT Index Kit v2 Set B (96 indexes)</td>
			<td>Illumina</td>
			<td>Cat# FC-131-2002</td>
			<td></td>
		</tr>
		<tr>
			<td>Illumina XT Index Kit v2 Set C (96 indexes)</td>
			<td>Illumina</td>
			<td>Cat# FC-131-2003</td>
			<td></td>
		</tr>
		<tr>
			<td>Illumina XT Index Kit v2 Set D (96 indexes)</td>
			<td>Illumina</td>
			<td>Cat# FC-131-2004</td>
			<td></td>
		</tr>
		<tr>
			<td>Lambda Exonuclease (5 U/&#956;l)</td>
			<td>New England BioLabs</td>
			<td>Cat# M0262S</td>
			<td></td>
		</tr>
		<tr>
			<td>Mouse Fc block</td>
			<td>BD Pharmingen</td>
			<td>Cat# 553142</td>
			<td></td>
		</tr>
		<tr>
			<td>Myelin removal beads</td>
			<td>Miltenyl Biotec</td>
			<td>Cat# 130-096-433</td>
			<td></td>
		</tr>
		<tr>
			<td>Nextera XT DNA Sample Prep Kit</td>
			<td>Illumina</td>
			<td>Cat# FC-131-1096</td>
			<td></td>
		</tr>
		<tr>
			<td>NextSeq 500/550 High Output Kit v2.5 (150 Cycles)</td>
			<td>Illumina</td>
			<td>Cat# 20024907</td>
			<td></td>
		</tr>
		<tr>
			<td>PBS (10X), pH 7.4</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 70011044</td>
			<td></td>
		</tr>
		<tr>
			<td>PCRClean DX beads</td>
			<td>Aline Biosciences</td>
			<td>Cat# C-1003-50</td>
			<td></td>
		</tr>
		<tr>
			<td>Propidium Iodide</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# P3566</td>
			<td>Staining: 1:1000</td>
		</tr>
		<tr>
			<td>Qubit dsDNA HS Assay Kit</td>
			<td>Thermal Fisher Scientific</td>
			<td>Cat# Q32851</td>
			<td></td>
		</tr>
		<tr>
			<td>Rat monoclonal anti mouse/human CD11b, Brilliant Violet 421 (clone M1/70)</td>
			<td>BioLegend</td>
			<td>Cat# 101236; RRID: AB_11203704</td>
			<td>Staining: 1:300</td>
		</tr>
		<tr>
			<td>Rat monoclonal anti mouse CD45, PE/Cy7 (clone 30-F11)</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 25-0451-82; RRID: AB_469625</td>
			<td>Staining: 1:300</td>
		</tr>
		<tr>
			<td>Recombinant RNase Inhibitor</td>
			<td>Takara Bio</td>
			<td>Cat# 2313B</td>
			<td></td>
		</tr>
		<tr>
			<td>SMARTScribe Reverse Transcriptase (100 U/&#956;l)</td>
			<td>Clontech</td>
			<td>Cat# 639538</td>
			<td>Containing 5x First strand buffer</td>
		</tr>
		<tr>
			<td colspan="4">Oligonucleotides</td>
		</tr>
		<tr>
			<td>0.1 &#956;M ISPCR Oligo: 5&#39; - AAGCAGTGGTATCAA CGCAGAGT-3&#39;</td>
			<td></td>
			<td></td>
			<td>(Picelli et al., 2014)</td>
		</tr>
		<tr>
			<td>Oligo-dT30VN primer: 5&#39; - AAGCAGTGGTATCAACGCA GAGTACT 30 VN-3&#39;</td>
			<td></td>
			<td></td>
			<td>(Picelli et al., 2014)</td>
		</tr>
		<tr>
			<td>TSO 5&#39; - AAGCAGTGGTATCAACGCAGA GTACATrGrG+G-3&#39; (&#34;r&#34; is forribobases and &#34;+&#34; is for an LNA base)</td>
			<td></td>
			<td></td>
			<td>(Picelli et al., 2014)</td>
		</tr>
		<tr>
			<td colspan="4">Solutions</td>
		</tr>
		<tr>
			<td>FACS buffer</td>
			<td></td>
			<td></td>
			<td>Recipe: sterile-filtered 1% FBS, 2 mM EDTA, 25 mM HEPES in 1X PBS</td>
		</tr>
		<tr>
			<td>MCS buffer</td>
			<td></td>
			<td></td>
			<td>Recipe: sterile-filtered 0.5% BSA, 2 mM EDTA in 1X PBS</td>
		</tr>
		<tr>
			<td>Medium A</td>
			<td></td>
			<td></td>
			<td>Recipe: 15 mM HEPES, 0.5% glucose in 1X HBSS without phenol red</td>
		</tr>
		<tr>
			<td colspan="4">Plates</td>
		</tr>
		<tr>
			<td>384-well Rigi-Plate PCR Microplates, Axygen Scientific</td>
			<td>VWR</td>
			<td>89005-556</td>
			<td></td>
		</tr>
		<tr>
			<td>Hard-shell 96-well PCR plates</td>
			<td>Bio-Rad</td>
			<td>HSP9631</td>
			<td></td>
		</tr>
		<tr>
			<td colspan="4">Others</td>
		</tr>
		<tr>
			<td>Dumont #55 forceps</td>
			<td>Fine Science Tools</td>
			<td>11295-51</td>
			<td></td>
		</tr>
		<tr>
			<td>Dounce homogenizer, 2 ml</td>
			<td>Wheaton</td>
			<td>357422</td>
			<td></td>
		</tr>
		<tr>
			<td>Large depletion column</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-901</td>
			<td></td>
		</tr>
		<tr>
			<td>Large selection column</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-401</td>
			<td></td>
		</tr>
		<tr>
			<td>MACS MultiStand</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-303</td>
			<td></td>
		</tr>
		<tr>
			<td>QuadroMACS Separator</td>
			<td>Miltenyi Biotec</td>
			<td>130-090-976</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAzap</td>
			<td>Thermo Fisher Scientific</td>
			<td>AM9780</td>
			<td></td>
		</tr>
		<tr>
			<td>Strainer (70 &#956;m)</td>
			<td>Falcon</td>
			<td>352350</td>
			<td></td>
		</tr>
		<tr>
			<td colspan="4">Equipment</td>
		</tr>
		<tr>
			<td>BD FACSAria II</td>
			<td>BD Biosciences</td>
			<td><a href="http://www.bdbiosciences.com/documents/BD_FACSAria_II_cell_sorter_brochure.pdf" target="_blank">http://www.bdbiosciences.com/</a></td>
			<td></td>
		</tr>
		<tr>
			<td>Bioanalyzer</td>
			<td>Agilent</td>
			<td>2100</td>
			<td></td>
		</tr>
		<tr>
			<td>Fragment Analyzer</td>
			<td>Agilent</td>
			<td>5300</td>
			<td></td>
		</tr>
		<tr>
			<td>Mosquito HTS nanoliter pipetting robot</td>
			<td>TTP Labtech</td>
			<td><a href="https://www.ttplabtech.com/products/liquid-handling/mosquito-hts/" target="_blank">https://www.ttplabtech.com/</a></td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit 4 Fluorometer</td>
			<td>Thermo Fisher Scientific</td>
			<td>Q33226</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolation of region-specific microglia from one adult mouse brain hemisphere for deep single-cell rna sequencing

As resident macrophages in the central nervous system, microglia actively control brain development and homeostasis, and their dysfunctions may drive human diseases. Considerable advances have been made to uncover the molecular signatures of homeostatic microglia as well as alterations of their gene expression in response to environmental stimuli. With the advent and maturation of single-cell genomic methodologies, it is increasingly recognized that heterogenous microglia may underlie the diverse roles they play in different developmental and pathological conditions. Further dissection of such heterogeneity can be achieved through efficient isolation of microglia from a given region of interest, followed by sensitive profiling of individual cells. Here, we provide a detailed protocol for the rapid isolation of microglia from different brain regions in a single adult mouse brain hemisphere. We also demonstrate how to use these sorted microglia for plate-based deep single-cell RNA sequencing. We discuss the adaptability of this method to other scenarios and provide guidelines for improving the system to accommodate large-scale studies.

This protocol describes a method to isolate and sort microglia from different brain regions in one adult perfused brain hemisphere, followed by scRNA-seq. We use douncing to create single cell suspension and also as a first step to enrich microglia. Insufficient or over-douncing reduces the yield. In addition, adult mouse brains contain high levels of myelin, which can also reduce sorting efficiency and yield if not removed properly. Therefore, we examine the cell suspension under microscope by using trypan blue and a he...

Watch this Scientific Journal Video about Isolation of Region-specific Microglia from One Adult Mouse Brain Hemisphere for Deep Single-cell RNA Sequencing at JoVE.com

Isolation of Region-specific Microglia from One Adult Mouse Brain Hemisphere for Deep Single-cell RNA Sequencing

We provide a protocol for isolation of microglia from different dissected regions of an adult mouse brain hemisphere, followed by semi-automated library preparation for deep single-cell RNA sequencing of full-length transcriptomes. This method will help to elucidate functional heterogeneity of microglia in health and disease.

As resident macrophages in the central nervous system, microglia actively control brain development and homeostasis, and their dysfunctions may drive ...

This method allows unbiased capturization of microglia gene expression at a single-cell level, which can help elucidate the molecular heterogeneity of microglia in a healthy and diseased brain. The main advantage of this technique is that it provides a detailed procedure for rapid isolation of microglia from different brain regions and shows how to efficiently generate play base the single-cell RA6 libraries for deep sequencing. To begin this procedure, prepare all needed buffers and solutions as outlined in the text protocol and chill them on ice.After euthanizing and decapitating the mouse, use small scissors to cut open the skin on the head to expose the skull underneath. Then, cut through the sagittal suture, lambdoidal suture, and coronal suture. Use forceps to pull off both sides of parietal bone and interparietal bone without damaging the tissue and carefully move the brain into a dissection Petri dish containing medium A.Using a pre-chilled blade, cut the brain through the midline into two hemispheres.Use number 55 forceps to separate the cerebellum from the cortical lobe and the brain stem. Then, use number 55 forceps to carefully dissect out the hippocampus and the striatum from the cortex and transfer each tissue into a separate collection Petri dish. First, use a razor blade to chop each brain region into fine pieces that are less than one cubic millimeter.Using a one milliliter pipette with the tip cut off, transfer the tissue pieces into pre-chilled Dounce homogenizers. Homogenize the tissue by slowly twisting the piston in and out of the Dounce homogenizer for six to 10 full strokes until no visible chunks are present. Then, transfer the dissociated tissues into 50 milliliter tubes through 70 micrometer strainers.Rinse each Dounce homogenizer and piston with the total of six milliliters of cold medium A then transfer the rinsing to a 15 milliliter tube for centrifugation. Centrifuge single-cell suspension at 400 times g and at four degrees Celsius for five minutes with a break at five. Rinse one large depletion column and three large selection columns in a magnetic separator with three milliliters of MCS.When the centrifugation for the tissue samples is complete, pipette out and discard supernatant without disturbing the pellet. Resuspend the cells in MCS buffer that contains RNase inhibitor. Add 100 microliters of myelin removal beads to each tube containing re-suspended cells from the cortex and cerebellum and add 50 microliters of myelin removal beads to each of the tubes containing re-suspended cells from the hippocampus and striatum.Incubate the tubes on ice for 10 minutes. After this, add MCS to the tube containing cortical cells to bring its volume up to two milliliters and to the remaining tubes to bring each of their volumes up to one milliliter. Once the columns are empty of rinsing buffer, load two milliliters of cortical cells onto the large depletion column and one milliliter of each other cell suspension onto separate large selection columns.Next, wash the large depletion column ones with one milliliter of MCS buffer and wash each large selection column twice using one milliliter of MCS buffer for each wash. Filter the cells through 35 microliter strainer caps into round-bottom FACS tubes. Centrifuge these tubes at 400 times g and at four degrees Celsius for five minutes to pellet the cells.Then, slowly pour out the supernatant and dab the edge of the tube on tissue paper. Resuspend the cells in each tube with 300 microliters of FACS buffer. First, add five microliters of mouse FC receptors block reagent to each tube.Incubate on ice for five minutes. Then, add one microliter of CD45 PE size seven and one microliter of CD11B BV421 to each tube. Incubate the tubes on a shaker at room temperature for 10 minutes.After this, add two milliliters of FACS buffer to wash. Centrifuge at 400 times g and at four degrees Celsius for five minutes to pellet the cells. Resuspend the cells in each tube with 400 microliters of FACS buffer containing one microliter of RNase inhibitor and 0.5 microliters of propidium iodide.Following the standard FACS procedure, sort single live microglia with a 100 micrometer nozzle into 96-well PCR plates that contain four microliters of lysis buffer in each well. Briefly vortex the plates and spin them down using a bench top centrifuge. Store the plates at minus 80 degrees Celsius until library preparation.When ready to proceed, thaw the plate on ice. Use a thermal cycler to perform a first transcription to generate cDNA and amplify the cDNA with an additional exonuclease digestion step as outlined in the text protocol. After this, purify the cDNA by adding 18 microliters of magnetic beads to each well.Incubate the plate on a magnetic stand for five minutes. Then, remove the supernatant and wash the samples twice with freshly made 80%ethanol using 80 microliters of ethanol per well for each wash. To perform tagmentation, use a nanoliter pipetting machine to mix 0.4 microliters of each cDNA sample with 1.2 microliters of Tn5 tagmentation reagents from the library preparation kit in a 384-well plate at 55 degrees Celsius for 10 minutes.To stop the tagmentation reaction, add 0.4 microliters of neutralization buffer at room temperature for five minutes. Next, at 384 indexes and 1.2 microliters of PCR mixed to the samples and amplify the libraries as outlined in the text protocol. Pool all of the individual libraries from the same 384-well plate together and use magnetic beads to purify the final pooled libraries.In this study, microglia are isolated from the cortex, cerebellum, hippocampus, and striatum of an adult mouse's brain hemisphere. The prepared cell suspension is examined under a microscope by using trypan blue and a hemocytometer to estimate the yield, cell viability, and efficacy of myelin removal before performing antibody staining. Total cell counts at this point should be over 30, 000 for the cortex and over 5, 000 for the other tissues.Over 90%of the cells should be viable with little myelin debris. A FACS machine is used to sort the microglia, which are typically CD45 low and CD11B positive. Successful isolation should generate over 80%microglia out of all live single-cells, at least for the cortical tissue.Once individual microglia are captured into the lysis buffer, RNA is released and subsequently reverse transcribed to cDNA, which is then amplified for 23 cycles. As a capillary electrophoresis platform, the fragment analyzer and high-sensitive NGS fragment kits provide quick and accurate information about size distribution, as well as quantity of cDNA molecules present in each well of a 96-well plate. Samples showing a smear between 500 and 5, 000 base pairs and are above a certain concentration threshold can be used to make libraries.The samples are sequenced to a depth of over one million raw reads per cell, which saturates the detection power of the single-cell RNA sequencing methodology. With a mapping rate of approximately 60%over 2, 000 genes can be detected per microglial cell. Previously published data generated from this isolation method is reproduced from independent experiments, demonstrating the sensitivity for detecting microglia specific genes across the sequenced population.With the information of single microglia transcriptions, researchers can discover the unique cell populations in the context of their interest, and further study the functional relevance of these newly identified populations.

isolation-region-specific-microglia-from-one-adult-mouse-brain

Research

JoVE Journal

Neuroscience

10.6K Views.  Stanford University School of Medicine. This method allows unbiased capturization of microglia gene expression at a single-cell level, which can help elucidate the molecular heterogeneity of microglia in a healthy and diseased brain. The main advantage of this technique is that it provides a detailed procedure for rapid isolation of microglia from different brain regions and shows how to efficiently generate play base the single-cell RA6 libraries for deep sequencing. To begin this procedure, prepare all needed buffers and solution...