This protocol was developed by S.K. during her postdoctoral research in Dr. Christine Jacobs-Wagner&#39;s laboratory at the Howard Hughes Medical Institute and the Microbial Sciences Institute at Yale University. We thank Dr. Jacobs-Wagner and her lab members for various inputs during the method development and Laura Troyer for critical reading of the manuscript. S.K. acknowledges support from the Searle Scholars Program; K.V. acknowledges the support of James Scholar Preble Research Award from the University of Illinois.

<ol><li>Bervoets, I., Charlier, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Diversity%2C+versatility+and+complexity+of+bacterial+gene+regulation+mechanisms%3A+opportunities+and+drawbacks+for+applications+in+synthetic+biology%5BTitle%5D)+AND+%22FEMS+Microbiology+Reviews%22%5BJournal%5D)">Diversity, versatility and complexity of bacterial gene regulation mechanisms: opportunities and drawbacks for applications in synthetic biology.</a> FEMS Microbiology Reviews. 43 (3), 304-339 (2019).</li>
<li>Epshtein, V., Nudler, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cooperation+between+RNA+polymerase+molecules+in+transcription+elongation%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Cooperation between RNA polymerase molecules in transcription elongation.</a> Science. 300 (5620), 801-805 (2003).</li>
<li>Vogel, U., Jensen, K. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+RNA+chain+elongation+rate+in+Escherichia+coli+depends+on+the+growth+rate%5BTitle%5D)+AND+%22Journal+of+Bacteriology%22%5BJournal%5D)">The RNA chain elongation rate in Escherichia coli depends on the growth rate.</a> Journal of Bacteriology. 176 (10), 2807-2813 (1994).</li>
<li>Tennyson, C. N., Klamut, H. J., Worton, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+human+dystrophin+gene+requires+16+hours+to+be+transcribed+and+is+cotranscriptionally+spliced%5BTitle%5D)+AND+%22Nature+Genetics%22%5BJournal%5D)">The human dystrophin gene requires 16 hours to be transcribed and is cotranscriptionally spliced.</a> Nature Genetics. 9, 184(1995).</li>
<li>Singh, J., Padgett, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Rates+of+in+situ+transcription+and+splicing+in+large+human+genes%5BTitle%5D)+AND+%22Nature+Structural+%26+Molecular+Biology%22%5BJournal%5D)">Rates of in situ transcription and splicing in large human genes.</a> Nature Structural & Molecular Biology. 16, 1128(2009).</li>
<li>Selinger, D. W., Saxena, R. M., Cheung, K. J., Church, G. M., Rosenow, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Global+RNA+Half-Life+Analysis+in+Escherichia+coli+Reveals+Positional+Patterns+of+Transcript+Degradation%5BTitle%5D)+AND+%22Genome+Research%22%5BJournal%5D)">Global RNA Half-Life Analysis in Escherichia coli Reveals Positional Patterns of Transcript Degradation.</a> Genome Research. 13 (2), 216-223 (2003).</li>
<li>Bernstein, J. A., Khodursky, A. B., Lin, P. -H., Lin-Chao, S., Cohen, S. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Global+analysis+of+mRNA+decay+and+abundance+in+Escherichia+coli+at+single-gene+resolution+using+two-color+fluorescent+DNA+microarrays%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences%22%5BJournal%5D)">Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays.</a> Proceedings of the National Academy of Sciences. 99 (15), 9697-9702 (2002).</li>
<li>Pérez-Ortín, J. E., Medina, D. A., Chávez, S., Moreno, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((What+do+you+mean+by+transcription+rate%5BTitle%5D)+AND+%22BioEssays%22%5BJournal%5D)">What do you mean by transcription rate.</a> BioEssays. 35 (12), 1056-1062 (2013).</li>
<li>Tang, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((mRNA-Seq+whole-transcriptome+analysis+of+a+single+cell%5BTitle%5D)+AND+%22Nature+Methods%22%5BJournal%5D)">mRNA-Seq whole-transcriptome analysis of a single cell.</a> Nature Methods. 6 (5), 377-382 (2009).</li>
<li>Kuchina, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Microbial+single-cell+RNA+sequencing+by+split-pool+barcoding%5BTitle%5D)+AND+%22BioRxiv%22%5BJournal%5D)">Microbial single-cell RNA sequencing by split-pool barcoding.</a> BioRxiv. , 869248(2019).</li>
<li>Blattman, S. B., Jiang, W., Oikonomou, P., Tavazoie, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Prokaryotic+single-cell+RNA+sequencing+by+in+situ+combinatorial+indexing%5BTitle%5D)+AND+%22Nature+Microbiology%22%5BJournal%5D)">Prokaryotic single-cell RNA sequencing by in situ combinatorial indexing.</a> Nature Microbiology. , (2020).</li>
<li>Femino, A., Fay, F., Fogarty, K., Singer, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Visualization+of+single+RNA+transcripts+in+situ%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Visualization of single RNA transcripts in situ.</a> Science. 280 (5363), 585-590 (1998).</li>
<li>Raj, A., vanden Bogaard, P., Rifkin, S. A., van Oudenaarden, A., Tyagi, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Imaging+individual+mRNA+molecules+using+multiple+singly+labeled+probes%5BTitle%5D)+AND+%22Nature+Methods%22%5BJournal%5D)">Imaging individual mRNA molecules using multiple singly labeled probes.</a> Nature Methods. 5 (10), 877-879 (2008).</li>
<li>Montero Llopis, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Spatial+organization+of+the+flow+of+genetic+information+in+bacteria%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Spatial organization of the flow of genetic information in bacteria.</a> Nature. 466 (7302), 77-81 (2010).</li>
<li>So, L. -h, et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((General+properties+of+transcriptional+time+series+in+Escherichia+coli%5BTitle%5D)+AND+%22Nature+Genetics%22%5BJournal%5D)">General properties of transcriptional time series in Escherichia coli.</a> Nature Genetics. 43 (6), 554-560 (2011).</li>
<li>Taniguchi, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Quantifying+E.+coli+proteome+and+transcriptome+with+single-molecule+sensitivity+in+single+cells%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Quantifying E. coli proteome and transcriptome with single-molecule sensitivity in single cells.</a> Science. 329 (5991), 533-538 (2010).</li>
<li>Jones, D. L., Brewster, R. C., Phillips, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Promoter+architecture+dictates+cell-to-cell+variability+in+gene+expression%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Promoter architecture dictates cell-to-cell variability in gene expression.</a> Science. 346 (6216), 1533-1536 (2014).</li>
<li>Iyer, S., Park, B. R., Kim, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Absolute+quantitative+measurement+of+transcriptional+kinetic+parameters+in+vivo%5BTitle%5D)+AND+%22Nucleic+Acids+Research%22%5BJournal%5D)">Absolute quantitative measurement of transcriptional kinetic parameters in vivo.</a> Nucleic Acids Research. 44 (18), 142(2016).</li>
<li>Kim, S., Beltran, B., Irnov, I., Jacobs-Wagner, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Long-Distance+Cooperative+and+Antagonistic+RNA+Polymerase+Dynamics+via+DNA+Supercoiling%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Long-Distance Cooperative and Antagonistic RNA Polymerase Dynamics via DNA Supercoiling.</a> Cell. 179 (1), 106-119 (2019).</li>
<li>Wang, M., Zhang, J., Xu, H., Golding, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Measuring+transcription+at+a+single+gene+copy+reveals+hidden+drivers+of+bacterial+individuality%5BTitle%5D)+AND+%22Nature+Microbiology%22%5BJournal%5D)">Measuring transcription at a single gene copy reveals hidden drivers of bacterial individuality.</a> Nature Microbiology. 4 (12), 2118-2127 (2019).</li>
<li>Joo, C., Ha, T. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aJoo%2C+C+%22Labeling+DNA+%28or+RNA%29+for+single-molecule+FRET%22">Labeling DNA (or RNA) for single-molecule FRET</a>. 2012 (9), Cold Spring Harbor. 1005-1008 (2012).</li>
<li>Sambrook, J., Russell, D. W. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aSambrook%2C+J+%22Standard+Ethanol+Precipitation+of+DNA+in+Microcentrifuge+Tubes%22">Standard Ethanol Precipitation of DNA in Microcentrifuge Tubes</a>. 2006 (1), Cold Spring Harbor Protocols. 4456(2006).</li>
<li>Skinner, S. O., Sepúlveda, L. A., Xu, H., Golding, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Measuring+mRNA+copy+number+in+individual+Escherichia+coli+cells+using+single-molecule+fluorescent+in+situ+hybridization%5BTitle%5D)+AND+%22Nature+Protocols%22%5BJournal%5D)">Measuring mRNA copy number in individual Escherichia coli cells using single-molecule fluorescent in situ hybridization.</a> Nature Protocols. 8 (6), 1100-1113 (2013).</li>
<li>Adesnik, M., Levinthal, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+synthesis+and+degradation+of+lactose+operon+messenger+RNA+in+E.+coli%5BTitle%5D)+AND+%22Cold+Spring+Harbor+Symposia+on+Quantitative+Biology%22%5BJournal%5D)">The synthesis and degradation of lactose operon messenger RNA in E. coli.</a> Cold Spring Harbor Symposia on Quantitative Biology. 35, 451-459 (1970).</li>
<li>Campbell, E. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Structural+mechanism+for+rifampicin+inhibition+of+bacterial+RNA+polymerase%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Structural mechanism for rifampicin inhibition of bacterial RNA polymerase.</a> Cell. 104 (6), 901-912 (2001).</li>
<li>Raj, A., Tyagi, S. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aRaj%2C+A+%22Methods+in+Enzymology%22">Methods in Enzymology</a>. Walter, N. G. 472, Academic Press. 365-386 (2010).</li>
<li>Sliusarenko, O., Heinritz, J., Emonet, T., Jacobs-Wagner, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((High-throughput%2C+subpixel+precision+analysis+of+bacterial+morphogenesis+and+intracellular+spatio-temporal+dynamics%5BTitle%5D)+AND+%22Molecular+Microbiology%22%5BJournal%5D)">High-throughput, subpixel precision analysis of bacterial morphogenesis and intracellular spatio-temporal dynamics.</a> Molecular Microbiology. 80 (3), 612-627 (2011).</li>
<li>Paintdakhi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Oufti%3A+an+integrated+software+package+for+high-accuracy%2C+high-throughput+quantitative+microscopy+analysis%5BTitle%5D)+AND+%22Molecular+Microbiology%22%5BJournal%5D)">Oufti: an integrated software package for high-accuracy, high-throughput quantitative microscopy analysis.</a> Molecular Microbiology. 99 (4), 767-777 (2016).</li>
<li>Moffitt, J. R., Zhuang, X. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aMoffitt%2C+JR+%22Methods+in+Enzymology%22">Methods in Enzymology</a>. Filonov, G. S., Jaffrey, S. R. 572, Academic Press. 1-49 (2016).</li>
<li>Yu, J., Xiao, J., Ren, X., Lao, K., Xie, X. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Probing+gene+expression+in+live+cells%2C+one+protein+molecule+at+a+time%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Probing gene expression in live cells, one protein molecule at a time.</a> Science. 311 (5767), 1600-1603 (2006).</li>
<li>Chen, H., Shiroguchi, K., Ge, H., Xie, X. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-wide+study+of+mRNA+degradation+and+transcript+elongation+in+Escherichia+coli%5BTitle%5D)+AND+%22Molecular+Systems+Biology%22%5BJournal%5D)">Genome-wide study of mRNA degradation and transcript elongation in Escherichia coli.</a> Molecular Systems Biology. 11 (1), 781(2015).</li>
<li>Vogel, U., Sørensen, M., Pedersen, S., Jensen, K. F., Kilstrup, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Decreasing+transcription+elongation+rate+in+Escherichia+Coli+exposed+to+amino+acid+starvation%5BTitle%5D)+AND+%22Molecular+Microbiology%22%5BJournal%5D)">Decreasing transcription elongation rate in Escherichia Coli exposed to amino acid starvation.</a> Molecular Microbiology. 6 (15), 2191-2200 (1992).</li>
<li>Yang, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Transcription+and+translation+contribute+to+gene+locus+relocation+to+the+nucleoid+periphery+in+E.+coli%5BTitle%5D)+AND+%22Nature+Communications%22%5BJournal%5D)">Transcription and translation contribute to gene locus relocation to the nucleoid periphery in E. coli.</a> Nature Communications. 10 (1), 5131(2019).</li>
<li>Zenklusen, D., Larson, D. R., Singer, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Single-RNA+counting+reveals+alternative+modes+of+gene+expression+in+yeast%5BTitle%5D)+AND+%22Nature+Structural+%26+Molecular+Biology%22%5BJournal%5D)">Single-RNA counting reveals alternative modes of gene expression in yeast.</a> Nature Structural & Molecular Biology. 15 (12), 1263-1271 (2008).</li>
<li>Fontenete, S., Guimarães, N., Wengel, J., Azevedo, N. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Prediction+of+melting+temperatures+in+fluorescence+in+situ+hybridization+%28FISH%29+procedures+using+thermodynamic+models%5BTitle%5D)+AND+%22Critical+Reviews+in+Biotechnology%22%5BJournal%5D)">Prediction of melting temperatures in fluorescence in situ hybridization (FISH) procedures using thermodynamic models.</a> Critical Reviews in Biotechnology. 36 (3), 566-577 (2016).</li>
<li>Sepúlveda, L. A., Xu, H., Zhang, J., Wang, M., Golding, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Measurement+of+gene+regulation+in+individual+cells+reveals+rapid+switching+between+promoter+states%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Measurement of gene regulation in individual cells reveals rapid switching between promoter states.</a> Science. 351 (6278), 1218-1222 (2016).</li>
<li>Huang, B., Wang, W., Bates, M., Zhuang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Three-Dimensional+Super-Resolution+Imaging+by+Stochastic+Optical+Reconstruction+Microscopy%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Three-Dimensional Super-Resolution Imaging by Stochastic Optical Reconstruction Microscopy.</a> Science. 319 (5864), 810-813 (2008).</li>
<li>Moffitt, J. R., Pandey, S., Boettiger, A. N., Wang, S., Zhuang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Spatial+organization+shapes+the+turnover+of+a+bacterial+transcriptome%5BTitle%5D)+AND+%22eLife%22%5BJournal%5D)">Spatial organization shapes the turnover of a bacterial transcriptome.</a> eLife. 5, 13065(2016).</li>
<li>Fei, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Determination+of+in+vivo+target+search+kinetics+of+regulatory+noncoding+RNA%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Determination of in vivo target search kinetics of regulatory noncoding RNA.</a> Science. 347 (6228), 1371-1374 (2015).</li>
</ol>

The authors declare they have no competing financial interests.

Here, we presented a smFISH protocol for measuring mRNA kinetics in E. coli. In the previously published smFISH protocols for bacteria23, cells were kept in the tubes until the very end of the protocol, that is until they are ready for imaging. While it has many benefits, such as minimal nonspecific binding of fluorescent probes on the coverslip surface23, it is difficult to follow these protocols when there are&#160;many samples&#160;from a time-course experiment. First, a relatively large volume of cells (&#62;1 mL) needs to be sampled and even harvested before fixation. Second, the cell samples need to be centrifuged multiple times to exchange solutions and to wash after the hybridization step. In our protocol, a small volume (&#60;1 mL) of culture is directly mixed with a fixing solution in a 1.5-mL tube, helping to quickly &#8220;freeze&#8221; the cell state at the moment of sampling. Also, cells stay attached to the surface throughout the procedure, and different solutions can be exchanged quickly by aspirating liquids with a vacuum filtration system and applying solution drops at once with a multi-channel pipette. This difference makes our protocol highly advantageous when a large number of samples need to be processed at once. Using our protocol, 12-48 samples can be handled simultaneously and the entire FISH procedure can be completed within ~8 hours, about a similar amount of time needed for a few samples (Figure 2). Although we used the expression of lacZ in E. coli as an example, the protocol is widely applicable to different genes and bacterial species with considerations discussed below.
For different genes, the first thing to consider is smFISH probes. One may design oligonucleotide probes that tile the mRNA of interest (Figure 1A)13. In this &#8220;tiling&#8221; probe approach, each probe is ~20 base long and labeled with a fluorophore at the 5&#8217; or 3&#8217; terminus. This strategy is convenient as no genetic manipulation is needed. Alternatively, a tandem repeat&#160;of ~20 bp sequence, foreign to the genomic sequence (e.g., an array of lacO sequence in Caulobacter crescentus14), may be inserted in the untranslated region of a gene of interest and a single probe complementary to the repeat unit is used to label the mRNA (&#8220;array&#8221; approach; Figure 1B). In both cases, multiple fluorophores decorate an mRNA, giving amplified fluorescence signal that can be easily differentiated from a single probe nonspecifically bound inside a cell.
Whether to choose &#8220;tiling&#8221; or &#8220;array&#8221; approaches depends on the negative control, a sample where nonspecific binding of probes is tested because it lacks the target mRNA. For tiling probes (Figure 1A), a mutant strain without the gene of interest or a condition, in which the gene is not transcribed (e.g., repression of lacZ) can serve as a negative control for testing nonspecific binding of probes. For the array-based smFISH (Figure 1B), a wild-type strain lacking the array can serve as a negative control because it does not contain binding sites for the probes.
Optimal hybridization conditions may depend on the probe sequences and even the choice of fluorophore dyes. We optimized the hybridization condition for lacZ probe sets by keeping the hybridization temperature at 37 &#176;C and testing different concentrations of probe sets and formamide in the hybridization solution. Higher concentrations of formamide tend to reduce both nonspecific and specific binding26,35. We recommend systematically changing the hybridization and its wash conditions while keeping hybridization time and temperature the same. As the condition becomes more stringent, both nonspecific and specific binding decrease (Figure 6). It is important to find a point where the nonspecific binding starts to hit below an acceptable threshold without further compromising specific binding. For example, we used the signal level obtained without any probes (&#8220;no probes&#8221;) as a threshold (Figure 6).
The two-color smFISH method labeling two separate regions of an mRNA is limited to long genes. To&#160;measure&#160;the rate of transcription elongation, we took advantage of the fact that lacZ is long (3075 bp) and its expression can be induced by IPTG. When a gene is short, it is difficult to design two tiling probe sets (near 5&#8217; and 3&#8217; ends) and resolve the time delay between appearances of 5&#8217; vs. 3&#8217; mRNA regions. In this case, one may count nascent mRNAs at steady state by smFISH and analyze their distribution with an analytical model that has the rate of transcription elongation as a fitting parameter20. Also, when a gene of interest is not inducible, one may treat cells with rifampicin at time zero and measure the temporal change in 5&#8217; and 3&#8217; mRNA sub-regions. The delay from the decrease of 5&#8217; mRNA signal to that of 3&#8217; mRNA signal can then be used to calculate the rate of transcription elongation as done previously31.
Finally, the smFISH protocol is versatile and can be combined with other labeling schemes. Previously, DNA locus was visualized together with mRNAs by combining mRNA FISH with either DNA FISH14 or fluorescent reporter-operator system20. Protein products may&#160;be visualized by performing immunofluorescence together with mRNA FISH14,36. Also, it can be combined with three-dimensional super-resolution microscopy37 to visualize mRNAs in all three dimensions38,39.&#160;

The flow of genetic information from DNA to mRNA and protein is one of the most fundamental cellular processes, whose regulation is important for cellular fitness1. The number of mRNAs in a cell is determined by two dynamic processes, transcription, and mRNA degradation. However, how transcription and mRNA degradation are regulated in time and space of a single cell remains not completely understood, largely due to the shortage of experimental methods to quantitatively measure their kinetics in vivo.
Methods based on total mRNAs extracted from a population of cells, such as Northern blot, RT-PCR, RNA sequencing, and gene expression microarrays, can measure the relative difference in mRNA levels and have been widely used to analyze the rate of transcription elongation2,3,4,5 or the rate of mRNA degradation6,7. However, they do not provide the absolute number of mRNAs per cell, and hence, they are not suitable for probing the rate of transcription initiation8. Also, because mRNAs are extracted from a population of cells, the spatial distribution of mRNAs within a single cell and the variability of mRNA copy numbers among cells cannot be measured.
Next-generation RNA sequencing on individual cells (scRNAseq) can quantify the number of mRNAs per cell in a genomic scale9. However, it remains difficult to use this technique to measure transcription kinetics, due to challenges with sample preparation and high cost. In particular, the application of scRNAseq to bacteria has been technically difficult due to low mRNA abundance10,11.
Single-molecule fluorescence in situ hybridization (smFISH) is based on the hybridization of fluorescently-labeled single-stranded probes whose sequences are complementary to the target mRNA of interest12,13. The concept of sequence-specific hybridization is similar to that used in Northern blot or RT-PCR, but the hybridization is done in situ within fixed cells, to preserve the native localization of mRNAs. The signal of a single mRNA is amplified using many probes, ~20 nucleotides (nt) in length, hybridizing to different parts of an mRNA (Figure 1A)13. In this &#8220;tiling&#8221; probe approach, the number of probes needed to detect a single mRNA sets a lower limit on the length of mRNA that can be assayed. Alternatively, the mRNA of interest may be transcriptionally fused to a non-coding array of tandem Lac operator sequences, such that multiple copies of a fluorescently labeled lacO probe hybridize to&#160;a single mRNA (Figure 1B)14.
smFISH has been used to quantify the number of mRNAs per cell at steady state (i.e., when synthesis and decay are in balance) and to analyze the mean and variability of mRNAs among bacterial cells15,16,17. Recently, smFISH has been applied to quantify mRNA numbers at non-steady state, right after induction or repression of gene expression in E. coli18,19,20. The temporal changes in the absolute mRNA copy numbers were then used to calculate the rate of transcription initiation, elongation, and termination, as well as the rate of mRNA degradation. For this application, conventional smFISH procedures can be cumbersome because there are many samples, each representing one time point, that need to go through multiple buffer exchange steps (i.e., centrifugation and washing). Here, we describe an smFISH protocol, in which the sample handling steps are dramatically simplified by having cells adhered to the surface of a coverslip and by aspirating liquids with a vacuum filtration system14,19. Using the expression of lacZ in E. coli as an example, the full workflow (Figure 2) is demonstrated, including image analysis (Figure 3) yielding the in vivo kinetics of transcription (initiation, elongation, and termination) and mRNA degradation, cell-to-cell variability in mRNA expression, and mRNA localization. We anticipate that the protocol is widely applicable to probe in vivo kinetics and localization of other mRNAs in various bacteria species.

<table><tbody><tr><td>&lt;strong&gt;Bacterial strain&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Escherichia coli MG1655</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Chemicals, peptides, and others&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Acetonitrile</td><td>Sigma-Aldrich</td><td>34851</td><td>UPLC buffer B</td></tr><tr><td>Ammonium chloride</td><td>Fisher Chemical</td><td>A661-500</td><td>To make M9 medium</td></tr><tr><td>Bovine serum albumin (BSA)</td><td>Sigma-Aldrich</td><td>B2518</td><td>Probe hybridization</td></tr><tr><td>Calcium chloride</td><td>Acros Organics</td><td>349610250</td><td>To make M9 medium</td></tr><tr><td>Casamino acid</td><td>BD Difco</td><td>223050</td><td>To make M9 medium</td></tr><tr><td>Cy3B NHS ester</td><td>GE Healthcare Life Sciences</td><td>PA63101</td><td>Fluorophore for FISH probes</td></tr><tr><td>Cy5 NHS ester</td><td>GE Healthcare Life Sciences</td><td>PA15101</td><td>Fluorophore for FISH probes</td></tr><tr><td>DEPC</td><td>Sigma-Aldrich</td><td>D5758</td><td></td></tr><tr><td>Dextran sulfate</td><td>Millipore</td><td>S4030</td><td>Probe hybridization</td></tr><tr><td>Dextrose</td><td>Fisher Chemical</td><td>D16</td><td>To repress the expression of lacZ</td></tr><tr><td>Dimethyl sulfoxide (DMSO)</td><td>Sigma-Aldrich</td><td>D8418</td><td>To dissolve fluorophores</td></tr><tr><td>E. coli tRNA</td><td>Sigma-Aldrich</td><td>R1753</td><td>Probe hybridization</td></tr><tr><td>Ethanol</td><td>Decon Laboratories</td><td>2701</td><td>Used in DNA purification, lysis, and cleaning coverslips</td></tr><tr><td>FISH probes</td><td>Biosearch Technologies</td><td></td><td>Sequences are published in ref#16</td></tr><tr><td>Formaldehyde</td><td>Ladd Research Industries</td><td>20295</td><td>Fixation</td></tr><tr><td>Formamide</td><td>American Bio</td><td>AB00600</td><td>Probe hybridization, pre-hybridization, and wash</td></tr><tr><td>Glycerol</td><td>Americanbio</td><td>AB00751-01000</td><td>To make M9 medium</td></tr><tr><td>Isopropylthio-&amp;beta;-galactoside (IPTG)</td><td>Invitrogen</td><td>15529019</td><td>lacZ induction</td></tr><tr><td>Magnesium sulfate</td><td>Fisher Chemical</td><td>M65-500</td><td>To make M9 medium</td></tr><tr><td>2-Nitrophenyl &amp;beta;-D-fucopyranoside (ONPF)</td><td>Santa Cruz Biotechnology</td><td>sc-216258</td><td>lacZ repression</td></tr><tr><td>Picodent twinsil 22</td><td>Picodent</td><td>1300 1000</td><td>Sealant</td></tr><tr><td>Poly-L-lysine</td><td>Sigma-Aldrich</td><td>P8920</td><td>To treat the coverslip surface</td></tr><tr><td>Potassium chloride</td><td>Fisher BioReagents</td><td>BP366-500</td><td>To make PBS</td></tr><tr><td>Potassium phosphate monobasic</td><td>Fisher BioReagents</td><td>BP362-500</td><td>To make PBS and M9 medium</td></tr><tr><td>Rifampicin</td><td>Sigma-Aldrich</td><td>R3501</td><td>To stop transcription initiation</td></tr><tr><td>Saline-sodium citrate buffer (SSC)</td><td>Invitrogen</td><td>AM9763</td><td>Probe hybridization, pre-hybridization, and wash</td></tr><tr><td>sodium bicarbonate</td><td>Fisher BioReagents</td><td>BP328-500</td><td>Fluorophore-probe conjugation</td></tr><tr><td>Sodium chloride</td><td>Fisher BioReagents</td><td>BP358-1</td><td>For DNA purification, PBS and M9 medium</td></tr><tr><td>Sodium phosphate dibasic</td><td>Fisher BioReagents</td><td>BP332-500</td><td>To make PBS and M9 medium</td></tr><tr><td>Sodium phosphate monobasic</td><td>Fisher BioReagents</td><td>BP329-500</td><td>To make a sodium phosphate buffer</td></tr><tr><td>Super PAP Pen</td><td>Invitrogen</td><td>8899</td><td>Hydrophobic marker for coverslips</td></tr><tr><td>TetraSpek microspheres</td><td>Invitrogen</td><td>T7280</td><td>Controls for multi-channel registration</td></tr><tr><td>Thiamine</td><td>Sigma-Aldrich</td><td>T1270</td><td>To make M9 medium</td></tr><tr><td>Triethylammonium acetate</td><td>Sigma-Aldrich</td><td>90358</td><td>UPLC buffer A</td></tr><tr><td>Vanadyl ribonucleoside complex (VRC)</td><td>Sigma-Aldrich</td><td>94742</td><td>Probe hybridization and pre-hybridization</td></tr><tr><td>&lt;strong&gt;Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>C18 column</td><td>Waters</td><td>Acquity BEH C18 column</td><td></td></tr><tr><td>Countertop centrifuge</td><td>Eppendorf</td><td>5425</td><td></td></tr><tr><td>Countertop incubator</td><td>Eppendorf</td><td>Thermomixer F1.5</td><td></td></tr><tr><td>Incubator (Oven)</td><td>Thermo Scientific</td><td>51030514</td><td>Gravity convection</td></tr><tr><td>Water purification system</td><td>Millipore</td><td>Milli-Q Reference</td><td></td></tr><tr><td>Nanodrop</td><td>Thermo Scientific</td><td>2000C</td><td></td></tr><tr><td>Nitrogen gas</td><td>Building</td><td></td><td>For blow-drying coverslips and glass slides</td></tr><tr><td>UPLC</td><td>Waters</td><td>Acquity UPLC system</td><td></td></tr><tr><td>Vacuum and aspirator</td><td>Building</td><td></td><td>Aspirator is made of a filtration flask with a side arm.</td></tr><tr><td>Vacuum concentrator</td><td>Labconco</td><td>7810010</td><td>Centrivap; to dry samples collected from UPLC.</td></tr><tr><td>Vortexer</td><td>Scientific Industries</td><td>Genie-2 SI-0236</td><td></td></tr><tr><td>Water bath shaker</td><td>New Brunswick</td><td>Innova 3100</td><td>Critical for time-course experiments</td></tr><tr><td>Water bath sonicator</td><td>VWR</td><td>97043-960</td><td>To clean coverslips and glass slides</td></tr><tr><td>&lt;strong&gt;Tools&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>1.5-mL tubes</td><td>Eppendorf</td><td>22431021</td><td>DNA lobind tubes</td></tr><tr><td>1000-uL pipette tip box</td><td>Denville Scientific</td><td>P1126</td><td>An empty box after using all the tips</td></tr><tr><td>Coplin jar</td><td>SPI</td><td>01240-AB</td><td>To clean coverslips and glass slides</td></tr><tr><td>Coverslip</td><td>Fisher Scientific</td><td>22-050-230</td><td>24x60 No1</td></tr><tr><td>Filtered pipette tips</td><td>Denville Scientific</td><td>P1121,P1122,P1126</td><td>SHARP&amp;reg; Precision Barrier Tips</td></tr><tr><td>Forceps</td><td>SPI</td><td>K35a</td><td>To handle clean coverslips and glass slides</td></tr><tr><td>Glass slide</td><td>Fisher Scientific</td><td>12-544-1</td><td></td></tr><tr><td>Gloves</td><td>Microflex</td><td>MK-296-M</td><td></td></tr><tr><td>Multichannel pipetter</td><td>Eppendorf</td><td>2231300045</td><td>To use in the washing step (#7)</td></tr><tr><td>Pipette</td><td>Gilson</td><td>P1000, P200, P20</td><td></td></tr><tr><td>Reagent reservoir</td><td>MTC Bio</td><td>P8025-1S</td><td>To use in the washing step (#7)</td></tr><tr><td>Syringe filter (0.22 um)</td><td>Millipore</td><td>SLGS033SS</td><td></td></tr><tr><td>Timer</td><td>VWR</td><td>62344-641</td><td></td></tr><tr><td>&lt;strong&gt;Software and algorithms&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>MATLAB</td><td>Mathworks</td><td>R2013 and up</td><td>https://www.mathworks.com</td></tr><tr><td>MicrobeTracker or Oufti</td><td></td><td></td><td>https://www.github.com/JacobsWagnerLab/MicrobeTracker</td></tr><tr><td colspan="4">https://oufti.org/</td></tr><tr><td>Stellaris Probe Designer</td><td>Biosearch Technologies</td><td></td><td>https://www.biosearchtech.com/support/tools/design-software/stellaris-probe-designer</td></tr><tr><td>&lt;strong&gt;Microscope&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>CCD camera</td><td>Hamamatsu Photonics</td><td>Orca-II-ER</td><td></td></tr><tr><td>Cy3 filter set</td><td>Chroma</td><td>49004</td><td></td></tr><tr><td>Cy5 filter set</td><td>Chroma</td><td>49006</td><td></td></tr><tr><td>Epi-fluorescence microscope</td><td>Nikon</td><td>Eclipse Ti</td><td>For phase-contrast and epi fluorescence</td></tr><tr><td>Fluorescence excitation source</td><td>Lumencor</td><td>SOLA-E</td><td></td></tr><tr><td>Nikon Elements software</td><td>Nikon</td><td></td><td>software that controls the microscope setup</td></tr><tr><td>Phase-contrast 100x objective</td><td>Nikon</td><td>Plan Apochromat (NA 1.45)</td><td></td></tr><tr><td>&lt;strong&gt;Probe sequence&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>DNA oligos with C6 amino modification at the 5&#039; end</td><td>Biosearch Technologies Inc</td><td></td><td></td></tr><tr><td>lacZ1</td><td></td><td>GTGAATCCGTAATCATGGTC</td><td>5&#039; mRNA</td></tr><tr><td>lacZ2</td><td></td><td>TCACGACGTTGTAAAACGAC</td><td>5&#039; mRNA</td></tr><tr><td>lacZ3</td><td></td><td>ATTAAGTTGGGTAACGCCAG</td><td>5&#039; mRNA</td></tr><tr><td>lacZ4</td><td></td><td>TATTACGCCAGCTGGCGAAA</td><td>5&#039; mRNA</td></tr><tr><td>lacZ5</td><td></td><td>ATTCAGGCTGCGCAACTGTT</td><td>5&#039; mRNA</td></tr><tr><td>lacZ6</td><td></td><td>AAACCAGGCAAAGCGCCATT</td><td>5&#039; mRNA</td></tr><tr><td>lacZ7</td><td></td><td>AGTATCGGCCTCAGGAAGAT</td><td>5&#039; mRNA</td></tr><tr><td>lacZ8</td><td></td><td>AACCGTGCATCTGCCAGTTT</td><td>5&#039; mRNA</td></tr><tr><td>lacZ9</td><td></td><td>TAGGTCACGTTGGTGTAGAT</td><td>5&#039; mRNA</td></tr><tr><td>lacZ10</td><td></td><td>AATGTGAGCGAGTAACAACC</td><td>5&#039; mRNA</td></tr><tr><td>lacZ11</td><td></td><td>GTAGCCAGCTTTCATCAACA</td><td>5&#039; mRNA</td></tr><tr><td>lacZ12</td><td></td><td>AATAATTCGCGTCTGGCCTT</td><td>5&#039; mRNA</td></tr><tr><td>lacZ13</td><td></td><td>AGATGAAACGCCGAGTTAAC</td><td>5&#039; mRNA</td></tr><tr><td>lacZ14</td><td></td><td>AATTCAGACGGCAAACGACT</td><td>5&#039; mRNA</td></tr><tr><td>lacZ15</td><td></td><td>TTTCTCCGGCGCGTAAAAAT</td><td>5&#039; mRNA</td></tr><tr><td>lacZ16</td><td></td><td>ATCTTCCAGATAACTGCCGT</td><td>5&#039; mRNA</td></tr><tr><td>lacZ17</td><td></td><td>AACGAGACGTCACGGAAAAT</td><td>5&#039; mRNA</td></tr><tr><td>lacZ18</td><td></td><td>GCTGATTTGTGTAGTCGGTT</td><td>5&#039; mRNA</td></tr><tr><td>lacZ19</td><td></td><td>TTAAAGCGAGTGGCAACATG</td><td>5&#039; mRNA</td></tr><tr><td>lacZ20</td><td></td><td>AACTGTTACCCGTAGGTAGT</td><td>5&#039; mRNA</td></tr><tr><td>lacZ21</td><td></td><td>ATAATTTCACCGCCGAAAGG</td><td>5&#039; mRNA</td></tr><tr><td>lacZ22</td><td></td><td>TTTCGACGTTCAGACGTAGT</td><td>5&#039; mRNA</td></tr><tr><td>lacZ23</td><td></td><td>ATAGAGATTCGGGATTTCGG</td><td>5&#039; mRNA</td></tr><tr><td>lacZ24</td><td></td><td>TTCTGCTTCAATCAGCGTGC</td><td>5&#039; mRNA</td></tr><tr><td>lacZ25</td><td></td><td>ACCATTTTCAATCCGCACCT</td><td></td></tr><tr><td>lacZ26</td><td></td><td>TTAACGCCTCGAATCAGCAA</td><td></td></tr><tr><td>lacZ27</td><td></td><td>ATGCAGAGGATGATGCTCGT</td><td></td></tr><tr><td>lacZ28</td><td></td><td>TCTGCTCATCCATGACCTGA</td><td></td></tr><tr><td>lacZ29</td><td></td><td>TTCATCAGCAGGATATCCTG</td><td></td></tr><tr><td>lacZ30</td><td></td><td>CACGGCGTTAAAGTTGTTCT</td><td></td></tr><tr><td>lacZ31</td><td></td><td>TGGTTCGGATAATGCGAACA</td><td></td></tr><tr><td>lacZ32</td><td></td><td>TTCATCCACCACATACAGGC</td><td></td></tr><tr><td>lacZ33</td><td></td><td>TGCCGTGGGTTTCAATATTG</td><td></td></tr><tr><td>lacZ34</td><td></td><td>ATCGGTCAGACGATTCATTG</td><td></td></tr><tr><td>lacZ35</td><td></td><td>TGATCACACTCGGGTGATTA</td><td></td></tr><tr><td>lacZ36</td><td></td><td>ATACAGCGCGTCGTGATTAG</td><td></td></tr><tr><td>lacZ37</td><td></td><td>GATCGACAGATTTGATCCAG</td><td></td></tr><tr><td>lacZ38</td><td></td><td>AAATAATATCGGTGGCCGTG</td><td></td></tr><tr><td>lacZ39</td><td></td><td>TTTGATGGACCATTTCGGCA</td><td></td></tr><tr><td>lacZ40</td><td></td><td>TATTCGCAAAGGATCAGCGG</td><td></td></tr><tr><td>lacZ41</td><td></td><td>AAGACTGTTACCCATCGCGT</td><td></td></tr><tr><td>lacZ42</td><td></td><td>TGCCAGTATTTAGCGAAACC</td><td></td></tr><tr><td>lacZ43</td><td></td><td>AAACGGGGATACTGACGAAA</td><td></td></tr><tr><td>lacZ44</td><td></td><td>TAATCAGCGACTGATCCACC</td><td></td></tr><tr><td>lacZ45</td><td></td><td>GGGTTGCCGTTTTCATCATA</td><td></td></tr><tr><td>lacZ46</td><td></td><td>TCGGCGTATCGCCAAAATCA</td><td></td></tr><tr><td>lacZ47</td><td></td><td>TTCATACAGAACTGGCGATC</td><td></td></tr><tr><td>lacZ48</td><td></td><td>TGGTGTTTTGCTTCCGTCAG</td><td></td></tr><tr><td>lacZ49</td><td></td><td>ACGGAACTGGAAAAACTGCT</td><td>3&#039; mRNA</td></tr><tr><td>lacZ50</td><td></td><td>TATTCGCTGGTCACTTCGAT</td><td>3&#039; mRNA</td></tr><tr><td>lacZ51</td><td></td><td>GTTATCGCTATGACGGAACA</td><td>3&#039; mRNA</td></tr><tr><td>lacZ52</td><td></td><td>TTTACCTTGTGGAGCGACAT</td><td>3&#039; mRNA</td></tr><tr><td>lacZ53</td><td></td><td>GTTCAGGCAGTTCAATCAAC</td><td>3&#039; mRNA</td></tr><tr><td>lacZ54</td><td></td><td>TTGCACTACGCGTACTGTGA</td><td>3&#039; mRNA</td></tr><tr><td>lacZ55</td><td></td><td>AGCGTCACACTGAGGTTTTC</td><td>3&#039; mRNA</td></tr><tr><td>lacZ56</td><td></td><td>ATTTCGCTGGTGGTCAGATG</td><td>3&#039; mRNA</td></tr><tr><td>lacZ57</td><td></td><td>ACCCAGCTCGATGCAAAAAT</td><td>3&#039; mRNA</td></tr><tr><td>lacZ58</td><td></td><td>CGGTTAAATTGCCAACGCTT</td><td>3&#039; mRNA</td></tr><tr><td>lacZ59</td><td></td><td>CTGTGAAAGAAAGCCTGACT</td><td>3&#039; mRNA</td></tr><tr><td>lacZ60</td><td></td><td>GGCGTCAGCAGTTGTTTTTT</td><td>3&#039; mRNA</td></tr><tr><td>lacZ61</td><td></td><td>TACGCCAATGTCGTTATCCA</td><td>3&#039; mRNA</td></tr><tr><td>lacZ62</td><td></td><td>TAAGGTTTTCCCCTGATGCT</td><td>3&#039; mRNA</td></tr><tr><td>lacZ63</td><td></td><td>ATCAATCCGGTAGGTTTTCC</td><td>3&#039; mRNA</td></tr><tr><td>lacZ64</td><td></td><td>GTAATCGCCATTTGACCACT</td><td>3&#039; mRNA</td></tr><tr><td>lacZ65</td><td></td><td>AGTTTTCTTGCGGCCCTAAT</td><td>3&#039; mRNA</td></tr><tr><td>lacZ66</td><td></td><td>ATGTCTGACAATGGCAGATC</td><td>3&#039; mRNA</td></tr><tr><td>lacZ67</td><td></td><td>ATAATTCAATTCGCGCGTCC</td><td>3&#039; mRNA</td></tr><tr><td>lacZ68</td><td></td><td>TGATGTTGAACTGGAAGTCG</td><td>3&#039; mRNA</td></tr><tr><td>lacZ69</td><td></td><td>TCAGTTGCTGTTGACTGTAG</td><td>3&#039; mRNA</td></tr><tr><td>lacZ70</td><td></td><td>ATTCAGCCATGTGCCTTCTT</td><td>3&#039; mRNA</td></tr><tr><td>lacZ71</td><td></td><td>AATCCCCATATGGAAACCGT</td><td>3&#039; mRNA</td></tr><tr><td>lacZ72</td><td></td><td>AGACCAACTGGTAATGGTAG</td><td>3&#039; mRNA</td></tr></tbody></table>

probing mrna kinetics in space and time in escherichia coli using two-color single-molecule fluorescence in situ hybridization

Single-molecule fluorescence in situ hybridization (smFISH) allows for counting the absolute number of mRNAs in individual cells. Here, we describe an application of smFISH to measure the rates of transcription and mRNA degradation in Escherichia coli. As smFISH is based on fixed cells, we perform smFISH at multiple time points during a time-course experiment, i.e., when cells are undergoing synchronized changes upon induction or repression of gene expression. At each time point, sub-regions of an mRNA are spectrally distinguished to probe transcription elongation and premature termination. The outcome of this protocol also allows for analyzing intracellular localization of mRNAs and heterogeneity in mRNA copy numbers among cells. Using this protocol many samples (~50) can be processed within 8 h, like the amount of time needed for just a few samples. We discuss how to apply this protocol to study the transcription and degradation kinetics of different mRNAs in bacterial cells.

Watch this Scientific Journal Video about Probing mRNA Kinetics in Space and Time in Escherichia coli using Two-Color Single-Molecule Fluorescence In Situ Hybridization at JoVE.com

Probing mRNA Kinetics in Space and Time in Escherichia coli using Two-Color Single-Molecule Fluorescence In Situ Hybridization

This protocol describes an application of single-molecule fluorescence in situ hybridization (smFISH) to measure the in vivo kinetics of mRNA synthesis and degradation.

Probing mRNA Kinetics in Space and Time in Escherichia coli using Two-Color Single-Molecule Fluorescence In Situ Hybridization

Single-molecule fluorescence in situ hybridization (smFISH) allows for counting the absolute number of mRNAs in individual cells. Here, we describe an ...

probing-mrna-kinetics-space-time-escherichia-coli-using-two-color

Research

Education

JoVE Core

JoVE Journal

Microbiology

Biology

Unit

Bacterial Genetics and Gene Regulation

SCIENTISTS IN ACTION

7.1K Views.  University of Illinois at Urbana-Champaign. This protocol describes an application of single-molecule fluorescence in situ hybridization (smFISH) to measure the in vivo kinetics of mRNA synthesis and degradation.

Video: Probing mRNA Kinetics in Space and Time in Escherichia coli using Two-Color Single-Molecule Fluorescence In Situ Hybridization

Quantification of the Abundance and Charging Levels of Transfer RNAs in Escherichia coli

Transfer RNA (tRNA) is an essential part of the translational machinery in any organism. tRNAs bind and transfer amino acids to the translating ribosome. The relative levels of different tRNAs, and the ratio of aminoacylated tRNA to total tRNA, known as the charging level, are important factors in determining the accuracy and speed of translation. Therefore, the abundance and charging levels of tRNAs are important variables to measure when studying protein synthesis, for example under various stress conditions. Here, we describe a method for harvesting tRNA and directly measuring both the relative abundance and the absolute charging level of specific tRNA species in Escherichia coli. The tRNA is harvested in such a way that the labile bond between the tRNA and its amino acid is preserved. The RNA is then subjected to gel electrophoresis and Northern blotting, which results in separation of the charged and uncharged tRNAs. The levels of specific tRNAs in different samples can be compared due to the addition of spike-in cells for normalization. Prior to RNA purification, we add 5% of E. coli cells that overproduce the rare tRNAselC to each sample. The amount of the tRNA species of interest in a sample is then normalized to the amount of tRNAselC in the same sample. Addition of spike-in cells prior to RNA purification has the advantage over addition of purified spike-in RNAs that it also accounts for any differences in cell lysis efficiency between samples.

Quantification of the Abundance and Charging Levels of Transfer RNAs in Escherichia coli

Here we present a method for directly measuring transfer RNA charging levels from purified Escherichia coli RNA as well as a way to compare relative levels of transfer RNA, or any other short RNA, across different samples based on the addition of spike-in cells expressing a reference gene.

Transfer RNA (tRNA) is an essential part of the translational machinery in any organism. tRNAs bind and transfer amino acids to the translating ribosome. ...

Biochemistry

Single Molecule Fluorescence In Situ Hybridization (smFISH) Analysis in Budding Yeast Vegetative Growth and Meiosis

Single molecule fluorescence in situ hybridization (smFISH) is a powerful technique to study gene expression in single cells due to its ability to detect and count individual RNA molecules. Complementary to deep sequencing-based methods, smFISH provides information about the cell-to-cell variation in transcript abundance and the subcellular localization of a given RNA. Recently, we have used smFISH to study the expression of the gene&#160;NDC80&#160;during meiosis in budding yeast, in which two transcript isoforms exist and the short transcript isoform has its entire sequence shared with the long isoform. To confidently identify each transcript isoform, we optimized known smFISH protocols and obtained high consistency and quality of smFISH data for the samples acquired during budding yeast meiosis. Here, we describe this optimized protocol, the criteria that we use to determine whether high quality of smFISH data is obtained, and some tips for implementing this protocol in&#160;other yeast strains and growth conditions.

Single Molecule Fluorescence In Situ Hybridization smFISH Analysis in Budding Yeast Vegetative Growth and Meiosis

This single molecule fluorescence in situ hybridization protocol is optimized to quantify the number of RNA molecules in budding yeast during vegetative growth and meiosis.

Single molecule fluorescence in situ hybridization (smFISH) is a powerful technique to study gene expression in single cells due to its ability to detect ...

Genetics

Site-Directed Mutagenesis for In Vitro and In Vivo Experiments Exemplified with RNA Interactions in Escherichia Coli

Site-directed mutagenesis is a technique used to introduce specific mutations in DNA to investigate the interaction between small non-coding ribonucleic acid (sRNA) molecules and target messenger RNAs (mRNAs). In addition, site-directed mutagenesis is used to map specific protein binding sites to RNA. A 2-step and 3-step PCR based introduction of mutations is described. The approach is relevant to all protein-RNA and RNA-RNA interaction studies. In short, the technique relies on designing primers with the desired mutation(s), and through 2 or 3 steps of PCR synthesizing a PCR product with the mutation. The PCR product is then used for cloning. Here, we describe how to perform site-directed mutagenesis with both the 2- and 3-step approach to introduce mutations to the sRNA, McaS, and the mRNA, csgD, to investigate RNA-RNA and RNA-protein interactions. We apply this technique to investigate RNA interactions; however, the technique is applicable to all mutagenesis studies (e.g., DNA-protein interactions, amino-acid substitution/deletion/addition). It is possible to introduce any kind of mutation except for non-natural bases but the technique is only applicable if a PCR product can be used for downstream application (e.g., cloning and template for further PCR).

Site-Directed Mutagenesis for In Vitro and In Vivo Experiments Exemplified with RNA Interactions in Escherichia Coli

Site-directed mutagenesis is a technique used to introduce specific mutations in deoxyribonucleic acid (DNA). This protocol describes how to do site-directed mutagenesis with a 2-step and 3-step polymerase chain reaction (PCR) based approach, which is applicable to any DNA fragment of interest.

Site-directed mutagenesis is a technique used to introduce specific mutations in DNA to investigate the interaction between small non-coding ribonucleic ...

An In Vitro Single-Molecule Imaging Assay for the Analysis of Cap-Dependent Translation Kinetics

Cap-dependent protein synthesis is the predominant translation pathway in eukaryotic cells. While various biochemical and genetic approaches have allowed extensive studies of cap-dependent translation and its regulation, high resolution kinetic characterization of this translation pathway is still lacking. Recently, we developed an in vitro assay to measure cap-dependent translation kinetics with single-molecule resolution. The assay is based on fluorescently labeled antibody binding to nascent epitope-tagged polypeptide. By imaging the binding and dissociation of antibodies to and from nascent peptide&#8211;ribosome&#8211;mRNA complexes, the translation progression on individual mRNAs can be tracked. Here, we present a protocol for establishing this assay, including mRNA and PEGylated slide preparations, real-time imaging of translation, and analysis of single molecule trajectories. This assay enables tracking of individual cap-dependent translation events and resolves key translation kinetics, such as initiation and elongation rates. The assay can be widely applied to distinct translation systems and should broadly benefit in vitro studies of cap-dependent translation kinetics and translational control mechanisms.

An In Vitro Single-Molecule Imaging Assay for the Analysis of Cap-Dependent Translation Kinetics

Tracking individual translation events allows for high-resolution kinetic studies of cap-dependent translation mechanisms. Here we demonstrate an in vitro single-molecule assay based on imaging interactions between fluorescently labeled antibodies and epitope-tagged nascent peptides. This method enables single-molecule characterization of initiation and peptide elongation kinetics during active in vitro cap-dependent translation.

Cap-dependent protein synthesis is the predominant translation pathway in eukaryotic cells. While various biochemical and genetic approaches have allowed ...

Determination of In Vitro and Cellular Turn-on Kinetics for Fluorogenic RNA Aptamers

Fluorogenic RNA aptamers have been applied in live cells to tag and visualize RNAs, report on gene expression, and activate fluorescent biosensors that detect levels of metabolites and signaling molecules. In order to study dynamic changes in each of these systems, it is desirable to obtain real-time measurements, but the accuracy of the measurements depends on the kinetics of the fluorogenic reaction being faster than the sampling frequency. Here, we describe methods to determine the in vitro and cellular turn-on kinetics for fluorogenic RNA aptamers using a plate reader equipped with a sample injector and a flow cytometer, respectively. We show that the in vitro kinetics for the fluorescence activation of the Spinach2 and Broccoli aptamers can be modeled as two-phase association reactions and have differing fast phase rate constants of 0.56 s&#8722;1 and 0.35 s&#8722;1, respectively. In addition, we show that the cellular kinetics for the fluorescence activation of Spinach2 in Escherichia coli, which is further limited by dye diffusion into the Gram-negative bacteria, is still sufficiently rapid to enable accurate sampling frequency on the minute timescale. These methods to analyze fluorescence activation kinetics are applicable to other fluorogenic RNA aptamers that have been developed.

Determination of In Vitro and Cellular Turn-on Kinetics for Fluorogenic RNA Aptamers

The protocol presents two methods to determine the kinetics of the fluorogenic RNA aptamers Spinach2 and Broccoli. The first method describes how to measure fluorogenic aptamer kinetics in vitro with a plate reader, while the second method details the measurement of fluorogenic aptamer kinetics in cells by flow cytometry.

Fluorogenic RNA aptamers have been applied in live cells to tag and visualize RNAs, report on gene expression, and activate fluorescent biosensors that ...

Measuring the Kinetics of mRNA Transcription in Single Living Cells

The transcriptional activity of RNA polymerase II (Pol II) is a dynamic process and therefore measuring the kinetics of the transcriptional process in vivo is of importance. Pol II kinetics have been measured using biochemical or molecular methods.1-3 In recent years, with the development of new visualization methods, it has become possible to follow transcription as it occurs in real time in single living cells.4 Herein we describe how to perform analysis of Pol II elongation kinetics on a specific gene in living cells.5, 6 Using a cell line in which a specific gene locus (DNA), its mRNA product, and the final protein product can be fluorescently labeled and visualized in vivo, it is possible to detect the actual transcription of mRNAs on the gene of interest.7, 8 The mRNA is fluorescently tagged using the MS2 system for tagging mRNAs in vivo, where the 3'UTR of the mRNA transcripts contain 24 MS2 stem-loop repeats, which provide highly specific binding sites for the YFP-MS2 coat protein that labels the mRNA as it is transcribed.9 To monitor the kinetics of transcription we use the Fluorescence Recovery After Photobleaching (FRAP) method. By photobleaching the YFP-MS2-tagged nascent transcripts at the site of transcription and then following the recovery of this signal over time, we obtain the synthesis rate of the newly made mRNAs.5 In other words, YFP-MS2 fluorescence recovery reflects the generation of new MS2 stem-loops in the nascent transcripts and their binding by fluorescent free YFP-MS2 molecules entering from the surrounding nucleoplasm. The FRAP recovery curves are then analyzed using mathematical mechanistic models formalized by a series of differential equations, in order to retrieve the kinetic time parameters of transcription.

RNA polymerase II transcriptional kinetics are measured on specific genes in living cells. mRNAs transcribed from the gene of interest are fluorescently tagged and using Fluorescence Recovery After Photobleaching (FRAP) the in vivo kinetics of transcriptional elongation are obtained.

The transcriptional activity of RNA polymerase II (Pol II) is a dynamic process and therefore measuring the kinetics of the transcriptional process in ...

Single-molecule Imaging of Gene Regulation In vivo Using Cotranslational Activation by Cleavage (CoTrAC)

We describe a fluorescence microscopy method, Co-Translational Activation by Cleavage (CoTrAC) to image the production of protein molecules in live cells with single-molecule precision without perturbing the protein's functionality. This method makes it possible to count the numbers of protein molecules produced in one cell during sequential, five-minute time windows. It requires a fluorescence microscope with laser excitation power density of ~0.5 to 1 kW/cm2, which is sufficiently sensitive to detect single fluorescent protein molecules in live cells. The fluorescent reporter used in this method consists of three parts: a membrane targeting sequence, a fast-maturing, yellow fluorescent protein and a protease recognition sequence. The reporter is translationally fused to the N-terminus of a protein of interest. Cells are grown on a temperature-controlled microscope stage. Every five minutes, fluorescent molecules within cells are imaged (and later counted by analyzing fluorescence images) and subsequently photobleached so that only newly translated proteins are counted in the next measurement.
Fluorescence images resulting from this method can be analyzed by detecting fluorescent spots in each image, assigning them to individual cells and then assigning cells to cell lineages. The number of proteins produced within a time window in a given cell is calculated by dividing the integrated fluorescence intensity of spots by the average intensity of single fluorescent molecules. We used this method to measure expression levels in the range of 0-45 molecules in single 5 min time windows. This method enabled us to measure noise in the expression of the &lambda; repressor CI, and has many other potential applications in systems biology.

Single-molecule Imaging of Gene Regulation In vivo Using Cotranslational Activation by Cleavage CoTrAC

We describe a fluorescence microscopy method, Co-Translational Activation by Cleavage (CoTrAC), to image the production of protein molecules in live cells with single-molecule precision without perturbing the protein's functionality. This method has been used to follow the stochastic expression dynamics of a transcription factor, the &lambda; repressor CI 1.

We describe a fluorescence microscopy method, Co-Translational Activation by Cleavage (CoTrAC) to image the production of protein molecules in live cells ...

Visualization and Analysis of mRNA Molecules Using Fluorescence In Situ Hybridization in Saccharomyces cerevisiae

The Fluorescence in situ Hybridization (FISH) method allows one to detect nucleic acids in the native cellular environment. Here we provide a protocol for using FISH to quantify the number of mRNAs in single yeast cells. Cells can be grown in any condition of interest and then fixed and made permeable. Subsequently, multiple single-stranded deoxyoligonucleotides conjugated to fluorescent dyes are used to label and visualize mRNAs. Diffraction-limited fluorescence from single mRNA molecules is quantified using a spot-detection algorithm to identify and count the number of mRNAs per cell. While the more standard quantification methods of northern blots, RT-PCR and gene expression microarrays provide information on average mRNAs in the bulk population, FISH facilitates both the counting and localization of these mRNAs in single cells at single-molecule resolution.

Visualization and Analysis of mRNA Molecules Using Fluorescence In Situ Hybridization in Saccharomyces cerevisiae

This protocol describes an experimental procedure for performing Fluorescence in situ Hybridization (FISH) for counting mRNAs in single cells at single-molecule resolution.

The Fluorescence in situ Hybridization (FISH) method allows one to detect nucleic acids in the native cellular environment. Here we provide a protocol for ...

Temporal Quantification of MAPK Induced Expression in Single Yeast Cells

The quantification of gene expression at the single cell level uncovers novel regulatory mechanisms obscured in measurements performed at the population level. Two methods based on microscopy and flow cytometry are presented to demonstrate how such data can be acquired. The expression of a fluorescent reporter induced upon activation of the high osmolarity glycerol MAPK pathway in yeast is used as an example. The specific advantages of each method are highlighted. Flow cytometry measures a large number of cells (10,000) and provides a direct measure of the dynamics of protein expression independent of the slow maturation kinetics of the fluorescent protein. Imaging of living cells by microscopy is by contrast limited to the measurement of the matured form of the reporter in fewer cells. However, the data sets generated by this technique can be extremely rich thanks to the combinations of multiple reporters and to the spatial and temporal information obtained from individual cells. The combination of these two measurement methods can deliver new insights on the regulation of protein expression by signaling pathways.

Two complementary methods based on flow cytometry and microscopy are presented which enable the quantification, at the single cell level, of the dynamics of gene expression induced by the activation of a MAPK pathway in yeast.

The quantification of gene expression at the  single cell level uncovers novel regulatory mechanisms obscured in measurements  performed at the population ...

Inducing a Site Specific Replication Blockage in E. coli Using a Fluorescent Repressor Operator System

Obstacles present on DNA, including tightly-bound proteins and various lesions, can severely inhibit the progression of the cell&#39;s replication machinery. The stalling of a replisome can lead to its dissociation from the chromosome, either in part or its entirety, leading to the collapse of the replication fork. The recovery from this collapse is a necessity for the cell to accurately complete chromosomal duplication and subsequently divide. Therefore, when the collapse occurs, the cell has evolved diverse mechanisms that take place to restore the DNA fork and allow replication to be completed with high fidelity. Previously, these replication repair pathways in bacteria have been studied using UV damage, which has the disadvantage of not being localized to a known site. This manuscript describes a system utilizing a Fluorescence Repressor Operator System (FROS) to create a site-specific protein block that can induce the stalling and collapse of replication forks in Escherichia coli. Protocols detail how the status of replication can be visualized in single living cells using fluorescence microscopy and DNA replication intermediates can be analyzed by 2-dimensional agarose gel electrophoresis. Temperature sensitive mutants of replisome components (e.g. DnaBts) can be incorporated into the system to induce a synchronous collapse of the replication forks. Furthermore, the roles of the recombination proteins and helicases that are involved in these processes can be studied using genetic knockouts within this system.

Inducing a Site Specific Replication Blockage in E. coli Using a Fluorescent Repressor Operator System

We describe here a system utilizing a site-specific, reversible in vivo protein block to stall and collapse replication forks in Escherichia coli. The establishment of the replication block is evaluated by fluorescence microscopy and neutral-neutral 2-dimensional agarose gel electrophoresis is used to visualize replication intermediates.

Probing mRNA Kinetics in Space and Time in Escherichia coli using Two-Color Single-Molecule Fluorescence In Situ Hybridization

Summary

Explore More Videos

Quantification of the Abundance and Charging Levels of Transfer RNAs in Escherichia coli

Single Molecule Fluorescence In Situ Hybridization (smFISH) Analysis in Budding Yeast Vegetative Growth and Meiosis

Site-Directed Mutagenesis for In Vitro and In Vivo Experiments Exemplified with RNA Interactions in Escherichia Coli

An In Vitro Single-Molecule Imaging Assay for the Analysis of Cap-Dependent Translation Kinetics

Determination of In Vitro and Cellular Turn-on Kinetics for Fluorogenic RNA Aptamers

Measuring the Kinetics of mRNA Transcription in Single Living Cells

Single-molecule Imaging of Gene Regulation In vivo Using Cotranslational Activation by Cleavage (CoTrAC)

Visualization and Analysis of mRNA Molecules Using Fluorescence In Situ Hybridization in Saccharomyces cerevisiae

Temporal Quantification of MAPK Induced Expression in Single Yeast Cells

Inducing a Site Specific Replication Blockage in E. coli Using a Fluorescent Repressor Operator System