The data of the S1PRs-Gi complex were harvested at the West China Cryo-EM Center in Sichuan University and Cryo-EM Center at the Southern University of Science and Technology (SUSTech) and processed at Duyu High-Performance Computing Center in Sichuan University. This work was supported by the Natural Science Foundation of China (32100965 to L.C., 32100988 to W.Y., 31972916 to Z.S.) and the full-time Postdoctoral Research Fund of Sichuan University (2021SCU12003 to L.C.)

Authors have no conflicts of interest.

This protocol describes a primary pipeline for determining the structures of S1PRs by cryo-EM and measuring the activation potency of S1PRs by Gi-mediated cAMP inhibition assay. Some steps are crucial to the experiment's success.
To purify the S1PRs-Gi complex, the quality of the virus and the health of sf9 cells should be paid more attention to. The expression of the receptor is dramatically reduced in poor sf9 cells. The health of sf9 cells was assessed by measurin...

Sphingosine-1-phosphate (S1P), a metabolic product of sphingolipids in the cell membrane, is a ubiquitous lysophosphatidic signaling molecule that involves various biological activities, including lymphocyte trafficking, vascular development, endothelial integrity, and heart rate1,2,3. S1P exerts its diverse physiological effects through five S1P receptor subtypes (S1PRs 1-5); S1PRs are found in a variety of tissues and exhibit unique preferences for downstream G proteins4,5. S1PR1 is primarily coupled with the Gi protein, which subsequently inhibits cAMP production; S1PR2 and S1PR3 are coupled with Gi, Gq, and G12/13, and S1PR4 and S1PR5 transduce signal through Gi and G12/136.
S1P-S1PR signaling is a critical therapeutic target for multiple diseases, including autoimmune disorders7, inflammation8, cancer9, and even COVID-1910. In 2010, fingolimod (FTY720) was licensed as a first-in-class drug targeting S1PRs to treat relapse multiple sclerosis (MS)11. However, it is capable of binding to all S1PRs except S1PR2, while nonspecific binding to S1PR3 results in edema of the cerebral cortex, vascular and bronchial constriction, and lung epithelial leakage12. As an alternate strategy for increasing therapeutic selectivity, subtype-specific ligands for the receptor have been produced. Siponimod (BAF312) was approved in 2019 for the relapse MS treatment13; it effectively targets S1PR1 and S1PR5, whereas it has no affinity for S1PR3, exhibiting fewer side effects in clinical practice14. In 2020, the US Food and Drug Administration authorized ozanimod for MS therapy15. It has been reported that ozanimod holds a 25-fold greater selectivity for S1PR1 than for S1PR516. Notably, in the context of the current COVID-19 pandemic, it has been discovered that agonist drugs targeting S1PRs may be utilized to treat COVID-19 by using immunomodulatory therapy techniques17. In comparison with fingolimod, the ozanimod has shown superiority in lowering symptoms in COVID-19 patients and is now undergoing clinical trials10. Understanding the structural basis and function of S1PRs lays a significant foundation for developing a drug that selectively targets S1PRs18.
Many techniques are used to investigate the structural information of biomacromolecules, including X-ray crystallography, nuclear magnetic resonance (NMR), and electron microscopy (EM). As of March 2022, there are more than 180,000 structures deposited on the Protein Databank (PDB), and most of them have been resolved by X-ray crystallography. However, with the first near-atomic resolution structure of TPRV1 (3.4 &#197; resolution) reported by Yifan Cheng and David Julius in 201319, cryo-electron microscopy (cryo-EM) has become a mainstream technique for protein structures, and the total number of EM PDB structures was more than 10,000. The critical breakthrough areas are the development of new cameras for imaging known as direct electron detection cameras and new image processing algorithms. Cryo-EM has revolutionized structure biology and structure-based drug discovery in the past decade20. As understanding how macromolecular complexes fulfill their complicated roles in the living cell is a central theme in biological sciences, cryo-EM has the potential to reveal conformations of dynamic molecular complexes, particularly for transmembrane proteins21. G-protein coupled receptors (GPCRs) are the largest superfamily of transmembrane proteins and the targets of more than 30% of currently marketed pharmaceuticals22. The development of cryo-EM has contributed to a burst of high-resolution structures of GPCR-G protein complexes, enabling structural determination for &#39;intractable&#39; targets that are still not accessible to X-ray crystallographic analysis in drug design23. Hence, the cryo-EM application provides a chance to determine the three-dimensional structure of GPCRs in near-native conditions at close to atomic resolution24. Advancements in cryo-EM make it possible to visualize mechanistic underpinnings of GPCR stimulation or inhibition, and further benefit in uncovering the novel binding sites for GPCR-targeted drug creation25.
Relying on the tremendous strides of cryo-EM technology, we have identified structures of agonized S1PR1-, S1PR3-, and S1PR5-Gi signaling complexes recently26,27. In humans, S1PRs are found in various tissues and exhibit unique preferences for downstream G proteins4,5. S1PR1 is primarily coupled with the Gi protein, which subsequently inhibits 3&#8242;,5&#8242;-cyclic adenosine monophosphate (cAMP) production. S1PR3 and S1PR5 are also capable of coupling with Gi6,28. Since Gi-coupled receptor activation decreases the production of cAMP29, a Gi-inhibition cAMP assay was introduced to measure cAMP inhibition effects for capturing functional alterations26,27. Using a mutant version of Photinus pyralis luciferase wherein a cAMP-binding protein moiety has been inserted, this cAMP assay offers a simple and reliable method for monitoring GPCR activity through changes in intracellular cAMP concentration30. It is a sensitive and non-radioactive functional assay and can be applied to monitor the real-time downstream signaling of a wide range of GPCRs for drug discovery purposes31.
Here, a summary is provided of the critical methods in resolving the activation and drug recognition modes of S1PRs, primarily including cryo-EM manipulations and a Gi-inhibition cAMP assay. This article aims to provide comprehensive experimental guidance for further explorations into the structures and functions of GPCRs.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>0.05% trypsin-EDTA</td>
			<td>GIBCO</td>
			<td>Cat# 25300054</td>
			<td></td>
		</tr>
		<tr>
			<td>0.22 &#181;M filter</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 42213-PS</td>
			<td></td>
		</tr>
		<tr>
			<td>100 kDa cut-off concentrator</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 88533</td>
			<td></td>
		</tr>
		<tr>
			<td>6-well plate</td>
			<td>Corning</td>
			<td>Cat# 43016</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well plate</td>
			<td>Corning</td>
			<td>Cat# 3917</td>
			<td></td>
		</tr>
		<tr>
			<td>Aprotinin</td>
			<td>Sigma-Aldrich</td>
			<td>Cat# 9087-70-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Apyrase</td>
			<td>NEB</td>
			<td>Cat# M0398S</td>
			<td></td>
		</tr>
		<tr>
			<td>Baculovirus transfection reagent</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 10362100</td>
			<td>For the preparation of P0 baculovirus</td>
		</tr>
		<tr>
			<td>Benzamidine</td>
			<td>Sigma-Aldrich</td>
			<td>Cat# B6506</td>
			<td></td>
		</tr>
		<tr>
			<td>CHO-K1</td>
			<td>ATCC</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>CHS</td>
			<td>Sigma-Aldrich</td>
			<td>Cat# C6512</td>
			<td></td>
		</tr>
		<tr>
			<td>CryoSPARC</td>
			<td>Punjani, A., et al.,2017</td>
			<td>https://cryosparc.com/</td>
			<td></td>
		</tr>
		<tr>
			<td>DH5&#945; competent E.coli</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# EC0112</td>
			<td></td>
		</tr>
		<tr>
			<td>D-Luciferin-Potassium Salt</td>
			<td>Sigma- Aldrich</td>
			<td>Cat# 50227</td>
			<td></td>
		</tr>
		<tr>
			<td>DMSO</td>
			<td>Sigma- Aldrich</td>
			<td>Cat# D2438</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# S311-500</td>
			<td></td>
		</tr>
		<tr>
			<td>ESF921 cell culture medium</td>
			<td>Expression Systems</td>
			<td>Cat#&#160; 96-001</td>
			<td></td>
		</tr>
		<tr>
			<td>Excel</td>
			<td>microsoft</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>F12 medium</td>
			<td>Invitrogen</td>
			<td>Cat# 11765</td>
			<td></td>
		</tr>
		<tr>
			<td>FBS</td>
			<td>Cell Box</td>
			<td>Cat# SAG-01U-02</td>
			<td></td>
		</tr>
		<tr>
			<td>Flag resin</td>
			<td>Sigma- Aldrich</td>
			<td>Cat# A4596</td>
			<td></td>
		</tr>
		<tr>
			<td>Forskolin</td>
			<td>APExBIO</td>
			<td>Cat# B1421</td>
			<td></td>
		</tr>
		<tr>
			<td>Gctf</td>
			<td>Zhang, 2016</td>
			<td>&#160;https://www.mrc-lmb.cam.ac.uk/kzhang/Gctf/</td>
			<td></td>
		</tr>
		<tr>
			<td>GDN</td>
			<td>Anatrace</td>
			<td>Cat# GDN101</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel filtration column</td>
			<td>GE healthcare</td>
			<td>Cat# 28990944</td>
			<td></td>
		</tr>
		<tr>
			<td>Gen5 3.11</td>
			<td>BIO-TEK</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Gentamicin</td>
			<td>Solarbio</td>
			<td>Cat# L1312</td>
			<td></td>
		</tr>
		<tr>
			<td>GloSensor cAMP assay kit</td>
			<td>Promega</td>
			<td>Cat# E1291</td>
			<td>Gi-inhibition cAMP assay kit</td>
		</tr>
		<tr>
			<td>GloSensor plasmid</td>
			<td>Promega</td>
			<td>Cat# E2301</td>
			<td>Sensor plasmid</td>
		</tr>
		<tr>
			<td>Grace&#8217;s medium</td>
			<td>GIBCO</td>
			<td>Cat# 11595030</td>
			<td></td>
		</tr>
		<tr>
			<td>GraphPad Prism 8</td>
			<td>Graphpad</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>HBSS</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 88284</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Sigma- Aldrich</td>
			<td>Cat# H4034</td>
			<td></td>
		</tr>
		<tr>
			<td>jetPRIME Reagent</td>
			<td>Polyplus Transfection</td>
			<td>Cat# 114-15</td>
			<td>transfection reagent</td>
		</tr>
		<tr>
			<td>Janamycin</td>
			<td>Solarbio</td>
			<td>Cat# K1030</td>
			<td></td>
		</tr>
		<tr>
			<td>LB medium</td>
			<td>Invitrogen</td>
			<td>Cat# 12780052</td>
			<td></td>
		</tr>
		<tr>
			<td>Leupeptin</td>
			<td>Sigma-Aldrich</td>
			<td>Cat# L2884</td>
			<td></td>
		</tr>
		<tr>
			<td>LMNG</td>
			<td>Anatrace</td>
			<td>Cat# NG310</td>
			<td></td>
		</tr>
		<tr>
			<td>MotionCor2</td>
			<td>(Zheng et al., 2017)</td>
			<td>https://emcore.ucsf.edu/ucsf-software</td>
			<td></td>
		</tr>
		<tr>
			<td>NanoCab</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 1121822</td>
			<td></td>
		</tr>
		<tr>
			<td>PBS</td>
			<td>Invitrogen</td>
			<td>Cat# 14190-144</td>
			<td></td>
		</tr>
		<tr>
			<td>pcDNA3.1-HA-FLAG-S1PRs</td>
			<td>GenScript</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>pFastBac1-G&#945;i</td>
			<td>GenScript</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>pFastBac1-HA-FLAG-T4L-S1PRs-His10</td>
			<td>GenScript</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>pFastBacdual-G&#946;1&#947;2</td>
			<td>GenScript</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>PureLink HiPure Plasmid Miniprep Kit</td>
			<td>Invitrogen</td>
			<td>Cat# K210003</td>
			<td>For the preparation of plasmids and P0 baculovirus</td>
		</tr>
		<tr>
			<td>Q5 site-Directed Mutagenesis kit</td>
			<td>NEB</td>
			<td>Cat# E0554S</td>
			<td>For the preparation of plasmids</td>
		</tr>
		<tr>
			<td>Quantifoil</td>
			<td>Quantifoil</td>
			<td>Cat# 251448</td>
			<td></td>
		</tr>
		<tr>
			<td>RELION-3.1</td>
			<td>(Zivanov et al., 2018)</td>
			<td>https://www2.mrc-lmb.cam.ac.uk/relion</td>
			<td></td>
		</tr>
		<tr>
			<td>S1PRs cDNA</td>
			<td>addgene</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>scFv16</td>
			<td>Invitrogen</td>
			<td>Cat# 703976</td>
			<td></td>
		</tr>
		<tr>
			<td>Sf9</td>
			<td>Expression Systems</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Siponimod</td>
			<td>Selleck</td>
			<td>Cat# S7179</td>
			<td></td>
		</tr>
		<tr>
			<td>sodium cholate</td>
			<td>Sigma-Aldrich</td>
			<td>Cat# C1254</td>
			<td></td>
		</tr>
		<tr>
			<td>Synergy H1 microplate reader</td>
			<td>BIO-TEK</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Synthetic T4L DNA (sequence)</td>
			<td>N/A</td>
			<td>N/A</td>
			<td>Aacatcttcgagatgctgcgcatcgacgaagg 
			cctgcgtctcaagatttacaagaataccgaagg 
			ttattacacgattggcatcggccacctcctgaca 
			aagagcccatcactcaacgctgccaagtctga 
			actggacaaagccattggtcgcaacaccaac 
			ggtgtcattacaaaggacgaggcggagaaac 
			tcttcaaccaagatgtagatgcggctgtccgtgg 
			catcctgcgtaatgccaagttgaagcccgtgt 
			atgactcccttgatgctgttcgccgtgcagcctt 
			gatcaacatggttttccaaatgggtgagaccgg 
			agtggctggttttacgaactccctgcgcatgctcc 
			agcagaagcgctgggacgaggccgcagtga 
			atttggctaaatctcgctggtacaatcagacacc 
			taaccgtgccaagcgtgtcatcactaccttccg 
			tactggaacttgggacgcttac</td>
		</tr>
		<tr>
			<td>TCEP</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 77720</td>
			<td></td>
		</tr>
		<tr>
			<td>Tetracycline</td>
			<td>Solarbio</td>
			<td>Cat# T8180</td>
			<td></td>
		</tr>
		<tr>
			<td>Vitrobot Mark IV</td>
			<td>Thermo Fisher Scientific</td>
			<td>N/A</td>
			<td></td>
		</tr>
	</tbody>
</table>

a pipeline to investigate the structures and signaling pathways of sphingosine 1-phosphate receptors

Lysophospholipids (LPLs) are bioactive lipids that include sphingosine 1-phosphate (S1P), lysophosphatidic acid, etc. S1P, a metabolic product of sphingolipids in the cell membrane, is one of the best-characterized LPLs that regulates a variety of cellular physiological responses via signaling pathways mediated by sphingosine 1-phosphate receptors (S1PRs). This implicated that the S1P-S1PRs signaling system is a remarkable potential therapeutic target for disorders, including multiple sclerosis (MS), autoimmune disorders, cancer, inflammation, and even COVID-19. S1PRs, a small subset of the class A G-protein coupled receptor (GPCR) family, are composed of five subtypes: S1PR1, S1PR2, S1PR3, S1PR4, and S1PR5. The lack of detailed structural information, however, impedes the drug discovery targeting S1PRs. Here, we applied the cryo-electron microscopy method to solve the structure of the S1P-S1PRs complex, and elucidated the mechanism of activation, selective drug recognition, and G-protein coupling by using cell-based functional assays. Other lysophospholipid receptors (LPLRs) and GPCRs can also be studied using this strategy.

Before freezing the sample of S1PRs-Gi complex, the purified sample needs to be separated by size-exclusion chromatography (SEC) and analyzed with gel filtration chromatography. Figure 2 shows the S1PR3-Gi complex as an example. The peak fraction of the homogeneous GPCR-G protein complex was usually located at ~10.5 mL of the size-exclusion chromatography (Figure 2A). SDS-page analysis of the S1PR3-Gi complex (Figure 2B) reveals fou...

Watch this Scientific Journal Video about A Pipeline to Investigate the Structures and Signaling Pathways of Sphingosine 1-Phosphate Receptors at JoVE.com

A Pipeline to Investigate the Structures and Signaling Pathways of Sphingosine 1-Phosphate Receptors

S1P exerts its diverse physiological effects through the S1P receptors (S1PRs) subfamily. Here, a pipeline is described to expound on the structures and function of S1PRs.

Lysophospholipids (LPLs) are bioactive lipids that include sphingosine 1-phosphate (S1P), lysophosphatidic acid, etc. S1P, a metabolic product of ...

a-pipeline-to-investigate-structures-signaling-pathways-sphingosine-1

Research

JoVE Journal

Biochemistry

3.3K Views.  Sichuan University. S1P exerts its diverse physiological effects through the S1P receptors (S1PRs) subfamily. Here, a pipeline is described to expound on the structures and function of S1PRs.

Video: A Pipeline to Investigate the Structures and Signaling Pathways of Sphingosine 1-Phosphate Receptors

Mimicking the Function of Signaling Proteins: Toward Artificial Signal Transduction Therapy

Signal transduction pathways, which control the response of cells to various environmental signals, are mediated by the function of signaling proteins that interact with each other and activate one other with high specificity. Synthetic agents that mimic the function of these proteins might therefore be used to generate unnatural signal transduction steps and consequently, alter the cell's function. We present guidelines for designing 'chemical transducers' that can induce artificial communication between native proteins. In addition, we present detailed protocols for synthesizing and testing a specific 'transducer', which can induce communication between two unrelated proteins: platelet-derived growth-factor (PDGF) and glutathione-S-transferase (GST). The way by which this unnatural PDGF-GST communication could be used to control the cleavage of an anticancer prodrug is also presented, indicating the potential for using such systems in 'artificial signal transduction therapy'. This work is intended to facilitate developing additional 'transducers' of this class, which may be used to mediate intracellular protein-protein communication and consequently, to induce artificial cell signaling pathways.

We present guidelines for developing synthetic 'chemical transducers' that can induce communication between naturally unrelated proteins. In addition, detailed protocols are presented for synthesizing and testing a specific 'transducer' that enables a growth factor to activate a detoxifying enzyme and consequently, to regulate the cleavage of an anticancer prodrug.

Signal transduction pathways, which control the response of cells to various environmental signals, are mediated by the function of signaling proteins ...

Measuring G-protein-coupled Receptor Signaling via Radio-labeled GTP Binding

G-Protein-Coupled Receptors (GPCRs) are a large family of transmembrane receptors that play critical roles in normal cellular physiology and constitute a major pharmacological target for multiple indications, including analgesia, blood pressure regulation, and the treatment of psychiatric disease. Upon ligand binding, GPCRs catalyze the activation of intracellular G-proteins by stimulating the incorporation of guanosine triphosphate (GTP). Activated G-proteins then stimulate signaling pathways that elicit cellular responses. GPCR signaling can be monitored by measuring the incorporation of a radiolabeled and non-hydrolyzable form of GTP, [35S]guanosine-5&#39;-O-(3-thio)triphosphate ([35S]GTP&#947;S), into G-proteins. Unlike other methods that assess more downstream signaling processes, [35S]GTP&#947;S binding measures a proximal event in GPCR signaling and, importantly, can distinguish agonists, antagonists, and inverse agonists. The present protocol outlines a sensitive and specific method for studying GPCR signaling using crude membrane preparations of an archetypal GPCR, the &#181;-opioid receptor (MOR1). Although alternative approaches to fractionate cells and tissues exist, many are cost-prohibitive, tedious, and/or require non-standard laboratory equipment. The present method provides a simple procedure that enriches functional crude membranes. After isolating MOR1, various pharmacological properties of its agonist, [D-Ala, N-MePhe, Gly-ol]-enkephalin (DAMGO), and antagonist, naloxone, were determined.

Guanosine triphosphate (GTP) binding is one of the earliest events in G-Protein-Coupled Receptor (GPCR) activation. This protocol describes how to pharmacologically characterize specific GPCR-ligand interactions by monitoring the binding of the radio-labeled GTP analog, [35S]guanosine-5&#39;-O-(3-thio)triphosphate ([35S]GTP&#947;S), in response to a ligand of interest.

G-Protein-Coupled Receptors (GPCRs) are a large family of transmembrane receptors that play critical roles in normal cellular physiology and constitute a ...

Lighting Up the Pathways to Caspase Activation Using Bimolecular Fluorescence Complementation

The caspase family of proteases play essential roles in apoptosis and innate immunity. Among these, a subgroup known as initiator caspases are the first to be activated in these pathways. This group includes caspase-2, -8, and -9, as well as the inflammatory caspases, caspase-1, -4, and -5. The initiator caspases are all activated by dimerization following recruitment to specific multiprotein complexes called activation platforms. Caspase Bimolecular Fluorescence Complementation (BiFC) is an imaging-based approach where split fluorescent proteins fused to initiator caspases are used to visualize the recruitment of initiator caspases to their activation platforms and the resulting induced proximity. This fluorescence provides a readout of one of the earliest steps required for initiator caspase activation. Using a number of different microscopy-based approaches, this technique can provide quantitative data on the efficiency of caspase activation on a population level as well as the kinetics of caspase activation and the size and number of caspase activating complexes on a per cell basis.

This protocol describes caspase Bimolecular Fluorescence Complementation (BiFC); an imaging-based method that can be used to visualize induced proximity of initiator caspases, which is the first step in their activation.

The caspase family of proteases play essential roles in apoptosis and innate immunity. Among these, a subgroup known as initiator caspases are the first ...

Using the Open-Source MALDI TOF-MS IDBac Pipeline for Analysis of Microbial Protein and Specialized Metabolite Data

In order to visualize the relationship between bacterial phylogeny and specialized metabolite production of bacterial colonies growing on nutrient agar, we developed IDBac&#8212;a low-cost and high-throughput matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) bioinformatics pipeline. IDBac software is designed for non-experts, is freely available, and capable of analyzing a few to thousands of bacterial colonies. Here, we present procedures for the preparation of bacterial colonies for MALDI-TOF MS analysis, MS instrument operation, and data processing and visualization in IDBac. In particular, we instruct users how to cluster bacteria into dendrograms based on protein MS fingerprints and interactively create Metabolite Association Networks (MANs) from specialized metabolite data.

IDBac is an open-source mass spectrometry-based bioinformatics pipeline that integrates data from both intact protein and specialized metabolite spectra, collected on cell material scraped from bacterial colonies. The pipeline allows researchers to rapidly organize hundreds to thousands of bacterial colonies into putative taxonomic groups, and further differentiate them based on specialized metabolite production.

In order to visualize the relationship between bacterial phylogeny and specialized metabolite production of bacterial colonies growing on nutrient agar, ...

Fluorescent Leakage Assay to Investigate Membrane Destabilization by Cell-Penetrating Peptide

Cell-penetrating peptides (CPPs) are defined as carriers that are able to cross the plasma membrane and to transfer a cargo into cells. One of the main common features required for this activity resulted from the interactions of CPPs with the plasma membrane (lipids) and more particularly with components of the extracellular matrix of the membrane itself (heparan sulphate). Indeed, independent of the direct translocation or the endocytosis-dependent internalization, lipid bilayers are involved in the internalization process both at the level of the plasma membrane and at the level of intracellular traffic (endosomal vesicles). In this article, we present a detailed protocol describing the different steps of a large unilamellar vesicles (LUVs) formulation, purification, characterization, and application in fluorescence leakage assay in order to detect possible CPP-membrane destabilization/interaction and to address their role in the internalization mechanism. LUVs with a lipid composition reflecting the plasma membrane content are generated in order to encapsulate both a fluorescent dye and a quencher. The addition of peptides in the extravesicular medium and the induction of peptide-membrane interactions on the LUVs might thus induce in a dose-dependent manner a significant increase in fluorescence revealing a leakage. Examples are provided here with the recently developed tryptophan (W)- and arginine (R)-rich Amphipathic Peptides (WRAPs), which showed a rapid and efficient siRNA delivery in various cell lines. Finally, the nature of these interactions and the affinity for lipids are discussed to understand and to improve the membrane translocation and/or the endosomal escape.

The fluorescence leakage assay is a simple method that enables the investigation of peptide/membrane interactions in order to understand their involvement in several biological processes and especially the ability of cell-penetrating peptides to disturb phospholipids bilayers during a direct cellular translocation process.

Cell-penetrating peptides (CPPs) are defined as carriers that are able to cross the plasma membrane and to transfer a cargo into cells. One of the main ...

A Sample Preparation Pipeline for Microcrystals at the VMXm Beamline

The mounting of microcrystals (&#60;10 &#181;m) for single crystal cryo-crystallography presents a non-trivial challenge. Improvements in data quality have been seen for microcrystals with the development of beamline optics, beam stability and variable beam size focusing from submicron to microns, such as at the VMXm beamline at Diamond Light Source1. Further improvements in data quality will be gained through improvements in sample environment and sample preparation. Microcrystals inherently generate weaker diffraction, therefore improving the signal-to-noise is key to collecting quality X-ray diffraction data and will predominantly come from reductions in background noise. Major sources of X-ray background noise in a diffraction experiment are from their interaction with the air path before and after the sample, excess crystallization solution surrounding the sample, the presence of crystalline ice and scatter from any other beamline instrumentation or X-ray windows. The VMXm beamline comprises instrumentation and a sample preparation protocol to reduce all these sources of noise.
Firstly, an in-vacuum sample environment at VMXm removes the air path between X-ray source and sample. Next, sample preparation protocols for macromolecular crystallography at VMXm utilize a number of processes and tools adapted from cryoTEM. These include copper grids with holey carbon support films, automated blotting and plunge cooling robotics making use of liquid ethane. These tools enable the preparation of hundreds of microcrystals on a single cryoTEM grid with minimal surrounding liquid on a low-noise support. They also minimize the formation of crystalline ice from any remaining liquid surrounding the crystals. 
We present the process for preparing and assessing the quality of soluble protein microcrystals using visible light and scanning electron microscopy before mounting the samples on the VMXm beamline for X-ray diffraction experiments. We will also provide examples of good quality samples as well as those which require further optimization and strategies to do so.

The signal-to-noise ratio of data is one of the most important considerations in performing X-ray diffraction measurements from microcrystals. The VMXm beamline provides a low-noise environment and microbeam for such experiments. Here, we describe sample preparation methods for mounting and cooling microcrystals for VMXm and other microfocus macromolecular crystallography beamlines.

The mounting of microcrystals (&#60;10 &#181;m) for single crystal cryo-crystallography presents a non-trivial challenge. Improvements in data quality ...

Utilizing Time-Resolved Protein-Induced Fluorescence Enhancement to Identify Stable Local Conformations One &#945;-Synuclein Monomer at a Time

Using spectroscopic rulers to track multiple conformations of single biomolecules and their dynamics have revolutionized the understanding of structural dynamics and its contributions to biology. While the FRET-based ruler reports on inter-dye distances in the 3-10 nm range, other spectroscopic techniques, such as protein-induced fluorescence enhancement (PIFE), report on the proximity between a dye and a protein surface in the shorter 0-3 nm range. Regardless of the method of choice, its use in measuring freely-diffusing biomolecules one at a time retrieves histograms of the experimental parameter yielding separate centrally-distributed sub-populations of biomolecules, where each sub-population represents either a single conformation that stayed unchanged within milliseconds, or multiple conformations that interconvert much faster than milliseconds, and hence an averaged-out sub-population. In single-molecule FRET, where the reported parameter in histograms is the inter-dye FRET efficiency, an intrinsically disordered protein, such as the &#945;-Synuclein monomer in buffer, was previously reported as exhibiting a single averaged-out sub-population of multiple conformations interconverting rapidly. While these past findings depend on the 3-10 nm range of the FRET-based ruler, we sought to put this protein to the test using single-molecule PIFE, where we track the fluorescence lifetime of site-specific sCy3-labeled &#945;-Synuclein proteins one at a time. Interestingly, using this shorter range spectroscopic proximity sensor, sCy3-labeled &#945;-Synuclein exhibits several lifetime sub-populations with distinctly different mean lifetimes that interconvert in 10-100 ms. These results show that while &#945;-Synuclein might be disordered globally, it nonetheless attains stable local structures. In summary, in this work we highlight the advantage of using different spectroscopic proximity sensors that track local or global structural changes one biomolecule at a time.

Time-resolved single-molecule protein-induced fluorescence enhancement is a useful fluorescence spectroscopic proximity sensor sensitive to local structural changes in proteins. Here we show it can be used to uncover stable local conformations in &#945;-Synuclein, which is otherwise known as globularly unstructured and unstable when measured using the longer range FRET ruler.

Using spectroscopic rulers to track multiple conformations of single biomolecules and their dynamics have revolutionized the understanding of structural ...

Visualizing the Conformational Dynamics of Membrane Receptors Using Single-Molecule FRET

The ability of cells to respond to external signals is essential for cellular development, growth, and survival. To respond to a signal from the environment, a cell must be able to recognize and process it. This task mainly relies on the function of membrane receptors, whose role is to convert signals into the biochemical language of the cell. G protein-coupled receptors (GPCRs) constitute the largest family of membrane receptor proteins in humans. Among GPCRs, metabotropic glutamate receptors (mGluRs) are a unique subclass that function as obligate dimers and possess a large extracellular domain that contains the ligand-binding site. Recent advances in structural studies of mGluRs have improved the understanding of their activation process. However, the propagation of large-scale conformational changes through mGluRs during activation and modulation is poorly understood. Single-molecule fluorescence resonance energy transfer (smFRET) is a powerful technique to visualize and quantify the structural dynamics of biomolecules at the single-protein level. To visualize the dynamic process of mGluR2 activation, fluorescent conformational sensors based on unnatural amino acid (UAA) incorporation were developed that allowed site-specific protein labeling without perturbation of the native structure of receptors. The protocol described here explains how to perform these experiments, including the novel UAA labeling approach, sample preparation, and smFRET data acquisition and analysis. These strategies are generalizable and can be extended to investigate the conformational dynamics of a variety of membrane proteins.

This study presents a detailed procedure to perform single-molecule fluorescence resonance energy transfer (smFRET) experiments on G protein-coupled receptors (GPCRs) using site-specific labeling via unnatural amino acid (UAA) incorporation. The protocol provides a step-by-step guide for smFRET sample preparation, experiments, and data analysis.

The ability of cells to respond to external signals is essential for cellular development, growth, and survival. To respond to a signal from the ...

A "Dual-Addition" Calcium Fluorescence Assay for the High-Throughput Screening of Recombinant G Protein-Coupled Receptors

G protein-coupled receptors (GPCRs) represent the largest superfamily of receptors and are the targets of numerous human drugs. High-throughput screening (HTS) of random small molecule libraries against GPCRs is used by the pharmaceutical industry for target-specific drug discovery. In this study, an HTS was employed to identify novel small-molecule ligands of invertebrate-specific neuropeptide GPCRs as probes for physiological studies of vectors of deadly human and veterinary pathogens.
The invertebrate-specific kinin receptor was chosen as a target because it regulates many important physiological processes in invertebrates, including diuresis, feeding, and digestion. Furthermore, the pharmacology of many invertebrate GPCRs is poorly characterized or not characterized at all; therefore, the differential pharmacology of these groups of receptors with respect to the related GPCRs in other metazoans, especially humans, adds knowledge to the structure-activity relationships of GPCRs as a superfamily. An HTS assay was developed for cells in 384-well plates for the discovery of ligands of the kinin receptor from the cattle fever tick, or southern cattle tick, Rhipicephalus microplus. The tick kinin receptor was stably expressed in CHO-K1 cells.
The kinin receptor, when activated by endogenous kinin neuropeptides or other small molecule agonists, triggers Ca2+ release from calcium stores into the cytoplasm. This calcium fluorescence assay combined with a &#34;dual-addition&#34; approach can detect functional agonist and antagonist &#34;hit&#34; molecules in the same assay plate. Each assay was conducted using drug plates carrying an array of 320 random small molecules. A reliable Z&#39; factor of 0.7 was obtained, and three agonist and two antagonist hit molecules were identified when the HTS was at a 2 &#181;M final concentration. The calcium fluorescence assay reported here can be adapted to screen other GPCRs that activate the Ca2+ signaling cascade.

In this work, a high-throughput, intracellular calcium fluorescence assay for 384-well plates to screen small molecule libraries on recombinant G protein-coupled receptors (GPCRs) is described. The target, the kinin receptor from the cattle fever tick, Rhipicephalus microplus, is expressed in CHO-K1 cells. This assay identifies agonists and antagonists using the same cells in one "dual-addition" assay.

G protein-coupled receptors (GPCRs) represent the largest superfamily of receptors and are the targets of numerous human drugs. High-throughput screening ...

A Fibrinolytic Enzyme-Based Method to Study Cerebral Thrombus Cell Components

A Comprehensive Approach to Analyze the Cell Components of Cerebral Blood Clots

Cerebral thrombosis, a blood clot in a cerebral artery or vein, is the most common type of cerebral infarction. The study of the cell components of cerebral blood clots is important for diagnosis, treatment, and prognosis. However, the current approaches to studying the cell components of the clots are mainly based on in situ staining, which is unsuitable for the comprehensive study of the cell components because cells are tightly wrapped in the clots. Previous studies have successfully isolated a fibrinolytic enzyme (sFE) from Sipunculus nudus, which can degrade the cross-linked fibrin directly, releasing the cell components. This study established a comprehensive method based on the sFE to study the cell components of cerebral thrombus. This protocol includes clot dissolving, cell releasing, cell staining, and routine blood examination. According to this method, the cell components could be studied quantitatively and qualitatively. The representative results of experiments using this method are shown.

Author Spotlight: A Novel Method for Comprehensive Cell Component Analysis of Cerebral Blood Clots 

This study describes a fast and effective method for the cell component analysis of cerebral blood clots through clot dissolving, cell staining, and routine blood examination.

Cerebral thrombosis, a blood clot in a cerebral artery or vein, is the most common type of cerebral infarction. The study of the cell components of ...