Name: a pipeline to investigate the structures and signaling pathways of sphingosine 1-phosphate receptors
Uploaded: 2022-06-08T15:00:00
Description: Watch this Scientific Journal Video about A Pipeline to Investigate the Structures and Signaling Pathways of Sphingosine 1-Phosphate Receptors at JoVE.com

The data of the S1PRs-Gi complex were harvested at the West China Cryo-EM Center in Sichuan University and Cryo-EM Center at the Southern University of Science and Technology (SUSTech) and processed at Duyu High-Performance Computing Center in Sichuan University. This work was supported by the Natural Science Foundation of China (32100965 to L.C., 32100988 to W.Y., 31972916 to Z.S.) and the full-time Postdoctoral Research Fund of Sichuan University (2021SCU12003 to L.C.)

1. Purification of S1PRs-G protein complex
<ol>
	<li>To purify the human S1PRs-G protein complex, clone the cDNAs of S1PR1&#160;lacking C-terminal residues 338-382, the wild-type S1PR3, S1PR5 truncated with 345-398 at C-terminus, and the wild-type Gi1 into the pFastBac1 vector and the cDNAs of the wild-type G&#946;1 and G&#947;2 into the pFastBacdual vector (Table of Materials). 
	NOTE: All constructs for S1PRs also contain the haemagglutinin (HA) signal sequence followed by a Fla...

This protocol describes a primary pipeline for determining the structures of S1PRs by cryo-EM and measuring the activation potency of S1PRs by Gi-mediated cAMP inhibition assay. Some steps are crucial to the experiment's success.
To purify the S1PRs-Gi complex, the quality of the virus and the health of sf9 cells should be paid more attention to. The expression of the receptor is dramatically reduced in poor sf9 cells. The health of sf9 cells was assessed by measurin...

Sphingosine-1-phosphate (S1P), a metabolic product of sphingolipids in the cell membrane, is a ubiquitous lysophosphatidic signaling molecule that involves various biological activities, including lymphocyte trafficking, vascular development, endothelial integrity, and heart rate1,2,3. S1P exerts its diverse physiological effects through five S1P receptor subtypes (S1PRs 1-5); S1PRs are found in a variety of tissues and exhibit unique preferences for downstream G proteins4,5. S1PR1 is primarily coupled with the Gi protein, which subsequently inhibits cAMP production; S1PR2 and S1PR3 are coupled with Gi, Gq, and G12/13, and S1PR4 and S1PR5 transduce signal through Gi and G12/136.
S1P-S1PR signaling is a critical therapeutic target for multiple diseases, including autoimmune disorders7, inflammation8, cancer9, and even COVID-1910. In 2010, fingolimod (FTY720) was licensed as a first-in-class drug targeting S1PRs to treat relapse multiple sclerosis (MS)11. However, it is capable of binding to all S1PRs except S1PR2, while nonspecific binding to S1PR3 results in edema of the cerebral cortex, vascular and bronchial constriction, and lung epithelial leakage12. As an alternate strategy for increasing therapeutic selectivity, subtype-specific ligands for the receptor have been produced. Siponimod (BAF312) was approved in 2019 for the relapse MS treatment13; it effectively targets S1PR1 and S1PR5, whereas it has no affinity for S1PR3, exhibiting fewer side effects in clinical practice14. In 2020, the US Food and Drug Administration authorized ozanimod for MS therapy15. It has been reported that ozanimod holds a 25-fold greater selectivity for S1PR1 than for S1PR516. Notably, in the context of the current COVID-19 pandemic, it has been discovered that agonist drugs targeting S1PRs may be utilized to treat COVID-19 by using immunomodulatory therapy techniques17. In comparison with fingolimod, the ozanimod has shown superiority in lowering symptoms in COVID-19 patients and is now undergoing clinical trials10. Understanding the structural basis and function of S1PRs lays a significant foundation for developing a drug that selectively targets S1PRs18.
Many techniques are used to investigate the structural information of biomacromolecules, including X-ray crystallography, nuclear magnetic resonance (NMR), and electron microscopy (EM). As of March 2022, there are more than 180,000 structures deposited on the Protein Databank (PDB), and most of them have been resolved by X-ray crystallography. However, with the first near-atomic resolution structure of TPRV1 (3.4 &#197; resolution) reported by Yifan Cheng and David Julius in 201319, cryo-electron microscopy (cryo-EM) has become a mainstream technique for protein structures, and the total number of EM PDB structures was more than 10,000. The critical breakthrough areas are the development of new cameras for imaging known as direct electron detection cameras and new image processing algorithms. Cryo-EM has revolutionized structure biology and structure-based drug discovery in the past decade20. As understanding how macromolecular complexes fulfill their complicated roles in the living cell is a central theme in biological sciences, cryo-EM has the potential to reveal conformations of dynamic molecular complexes, particularly for transmembrane proteins21. G-protein coupled receptors (GPCRs) are the largest superfamily of transmembrane proteins and the targets of more than 30% of currently marketed pharmaceuticals22. The development of cryo-EM has contributed to a burst of high-resolution structures of GPCR-G protein complexes, enabling structural determination for &#39;intractable&#39; targets that are still not accessible to X-ray crystallographic analysis in drug design23. Hence, the cryo-EM application provides a chance to determine the three-dimensional structure of GPCRs in near-native conditions at close to atomic resolution24. Advancements in cryo-EM make it possible to visualize mechanistic underpinnings of GPCR stimulation or inhibition, and further benefit in uncovering the novel binding sites for GPCR-targeted drug creation25.
Relying on the tremendous strides of cryo-EM technology, we have identified structures of agonized S1PR1-, S1PR3-, and S1PR5-Gi signaling complexes recently26,27. In humans, S1PRs are found in various tissues and exhibit unique preferences for downstream G proteins4,5. S1PR1 is primarily coupled with the Gi protein, which subsequently inhibits 3&#8242;,5&#8242;-cyclic adenosine monophosphate (cAMP) production. S1PR3 and S1PR5 are also capable of coupling with Gi6,28. Since Gi-coupled receptor activation decreases the production of cAMP29, a Gi-inhibition cAMP assay was introduced to measure cAMP inhibition effects for capturing functional alterations26,27. Using a mutant version of Photinus pyralis luciferase wherein a cAMP-binding protein moiety has been inserted, this cAMP assay offers a simple and reliable method for monitoring GPCR activity through changes in intracellular cAMP concentration30. It is a sensitive and non-radioactive functional assay and can be applied to monitor the real-time downstream signaling of a wide range of GPCRs for drug discovery purposes31.
Here, a summary is provided of the critical methods in resolving the activation and drug recognition modes of S1PRs, primarily including cryo-EM manipulations and a Gi-inhibition cAMP assay. This article aims to provide comprehensive experimental guidance for further explorations into the structures and functions of GPCRs.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>0.05% trypsin-EDTA</td>
			<td>GIBCO</td>
			<td>Cat# 25300054</td>
			<td></td>
		</tr>
		<tr>
			<td>0.22 &#181;M filter</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 42213-PS</td>
			<td></td>
		</tr>
		<tr>
			<td>100 kDa cut-off concentrator</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 88533</td>
			<td></td>
		</tr>
		<tr>
			<td>6-well plate</td>
			<td>Corning</td>
			<td>Cat# 43016</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well plate</td>
			<td>Corning</td>
			<td>Cat# 3917</td>
			<td></td>
		</tr>
		<tr>
			<td>Aprotinin</td>
			<td>Sigma-Aldrich</td>
			<td>Cat# 9087-70-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Apyrase</td>
			<td>NEB</td>
			<td>Cat# M0398S</td>
			<td></td>
		</tr>
		<tr>
			<td>Baculovirus transfection reagent</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 10362100</td>
			<td>For the preparation of P0 baculovirus</td>
		</tr>
		<tr>
			<td>Benzamidine</td>
			<td>Sigma-Aldrich</td>
			<td>Cat# B6506</td>
			<td></td>
		</tr>
		<tr>
			<td>CHO-K1</td>
			<td>ATCC</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>CHS</td>
			<td>Sigma-Aldrich</td>
			<td>Cat# C6512</td>
			<td></td>
		</tr>
		<tr>
			<td>CryoSPARC</td>
			<td>Punjani, A., et al.,2017</td>
			<td>https://cryosparc.com/</td>
			<td></td>
		</tr>
		<tr>
			<td>DH5&#945; competent E.coli</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# EC0112</td>
			<td></td>
		</tr>
		<tr>
			<td>D-Luciferin-Potassium Salt</td>
			<td>Sigma- Aldrich</td>
			<td>Cat# 50227</td>
			<td></td>
		</tr>
		<tr>
			<td>DMSO</td>
			<td>Sigma- Aldrich</td>
			<td>Cat# D2438</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# S311-500</td>
			<td></td>
		</tr>
		<tr>
			<td>ESF921 cell culture medium</td>
			<td>Expression Systems</td>
			<td>Cat#&#160; 96-001</td>
			<td></td>
		</tr>
		<tr>
			<td>Excel</td>
			<td>microsoft</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>F12 medium</td>
			<td>Invitrogen</td>
			<td>Cat# 11765</td>
			<td></td>
		</tr>
		<tr>
			<td>FBS</td>
			<td>Cell Box</td>
			<td>Cat# SAG-01U-02</td>
			<td></td>
		</tr>
		<tr>
			<td>Flag resin</td>
			<td>Sigma- Aldrich</td>
			<td>Cat# A4596</td>
			<td></td>
		</tr>
		<tr>
			<td>Forskolin</td>
			<td>APExBIO</td>
			<td>Cat# B1421</td>
			<td></td>
		</tr>
		<tr>
			<td>Gctf</td>
			<td>Zhang, 2016</td>
			<td>&#160;https://www.mrc-lmb.cam.ac.uk/kzhang/Gctf/</td>
			<td></td>
		</tr>
		<tr>
			<td>GDN</td>
			<td>Anatrace</td>
			<td>Cat# GDN101</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel filtration column</td>
			<td>GE healthcare</td>
			<td>Cat# 28990944</td>
			<td></td>
		</tr>
		<tr>
			<td>Gen5 3.11</td>
			<td>BIO-TEK</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Gentamicin</td>
			<td>Solarbio</td>
			<td>Cat# L1312</td>
			<td></td>
		</tr>
		<tr>
			<td>GloSensor cAMP assay kit</td>
			<td>Promega</td>
			<td>Cat# E1291</td>
			<td>Gi-inhibition cAMP assay kit</td>
		</tr>
		<tr>
			<td>GloSensor plasmid</td>
			<td>Promega</td>
			<td>Cat# E2301</td>
			<td>Sensor plasmid</td>
		</tr>
		<tr>
			<td>Grace&#8217;s medium</td>
			<td>GIBCO</td>
			<td>Cat# 11595030</td>
			<td></td>
		</tr>
		<tr>
			<td>GraphPad Prism 8</td>
			<td>Graphpad</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>HBSS</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 88284</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Sigma- Aldrich</td>
			<td>Cat# H4034</td>
			<td></td>
		</tr>
		<tr>
			<td>jetPRIME Reagent</td>
			<td>Polyplus Transfection</td>
			<td>Cat# 114-15</td>
			<td>transfection reagent</td>
		</tr>
		<tr>
			<td>Janamycin</td>
			<td>Solarbio</td>
			<td>Cat# K1030</td>
			<td></td>
		</tr>
		<tr>
			<td>LB medium</td>
			<td>Invitrogen</td>
			<td>Cat# 12780052</td>
			<td></td>
		</tr>
		<tr>
			<td>Leupeptin</td>
			<td>Sigma-Aldrich</td>
			<td>Cat# L2884</td>
			<td></td>
		</tr>
		<tr>
			<td>LMNG</td>
			<td>Anatrace</td>
			<td>Cat# NG310</td>
			<td></td>
		</tr>
		<tr>
			<td>MotionCor2</td>
			<td>(Zheng et al., 2017)</td>
			<td>https://emcore.ucsf.edu/ucsf-software</td>
			<td></td>
		</tr>
		<tr>
			<td>NanoCab</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 1121822</td>
			<td></td>
		</tr>
		<tr>
			<td>PBS</td>
			<td>Invitrogen</td>
			<td>Cat# 14190-144</td>
			<td></td>
		</tr>
		<tr>
			<td>pcDNA3.1-HA-FLAG-S1PRs</td>
			<td>GenScript</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>pFastBac1-G&#945;i</td>
			<td>GenScript</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>pFastBac1-HA-FLAG-T4L-S1PRs-His10</td>
			<td>GenScript</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>pFastBacdual-G&#946;1&#947;2</td>
			<td>GenScript</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>PureLink HiPure Plasmid Miniprep Kit</td>
			<td>Invitrogen</td>
			<td>Cat# K210003</td>
			<td>For the preparation of plasmids and P0 baculovirus</td>
		</tr>
		<tr>
			<td>Q5 site-Directed Mutagenesis kit</td>
			<td>NEB</td>
			<td>Cat# E0554S</td>
			<td>For the preparation of plasmids</td>
		</tr>
		<tr>
			<td>Quantifoil</td>
			<td>Quantifoil</td>
			<td>Cat# 251448</td>
			<td></td>
		</tr>
		<tr>
			<td>RELION-3.1</td>
			<td>(Zivanov et al., 2018)</td>
			<td>https://www2.mrc-lmb.cam.ac.uk/relion</td>
			<td></td>
		</tr>
		<tr>
			<td>S1PRs cDNA</td>
			<td>addgene</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>scFv16</td>
			<td>Invitrogen</td>
			<td>Cat# 703976</td>
			<td></td>
		</tr>
		<tr>
			<td>Sf9</td>
			<td>Expression Systems</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Siponimod</td>
			<td>Selleck</td>
			<td>Cat# S7179</td>
			<td></td>
		</tr>
		<tr>
			<td>sodium cholate</td>
			<td>Sigma-Aldrich</td>
			<td>Cat# C1254</td>
			<td></td>
		</tr>
		<tr>
			<td>Synergy H1 microplate reader</td>
			<td>BIO-TEK</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Synthetic T4L DNA (sequence)</td>
			<td>N/A</td>
			<td>N/A</td>
			<td>Aacatcttcgagatgctgcgcatcgacgaagg 
			cctgcgtctcaagatttacaagaataccgaagg 
			ttattacacgattggcatcggccacctcctgaca 
			aagagcccatcactcaacgctgccaagtctga 
			actggacaaagccattggtcgcaacaccaac 
			ggtgtcattacaaaggacgaggcggagaaac 
			tcttcaaccaagatgtagatgcggctgtccgtgg 
			catcctgcgtaatgccaagttgaagcccgtgt 
			atgactcccttgatgctgttcgccgtgcagcctt 
			gatcaacatggttttccaaatgggtgagaccgg 
			agtggctggttttacgaactccctgcgcatgctcc 
			agcagaagcgctgggacgaggccgcagtga 
			atttggctaaatctcgctggtacaatcagacacc 
			taaccgtgccaagcgtgtcatcactaccttccg 
			tactggaacttgggacgcttac</td>
		</tr>
		<tr>
			<td>TCEP</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 77720</td>
			<td></td>
		</tr>
		<tr>
			<td>Tetracycline</td>
			<td>Solarbio</td>
			<td>Cat# T8180</td>
			<td></td>
		</tr>
		<tr>
			<td>Vitrobot Mark IV</td>
			<td>Thermo Fisher Scientific</td>
			<td>N/A</td>
			<td></td>
		</tr>
	</tbody>
</table>

a pipeline to investigate the structures and signaling pathways of sphingosine 1-phosphate receptors

Lysophospholipids (LPLs) are bioactive lipids that include sphingosine 1-phosphate (S1P), lysophosphatidic acid, etc. S1P, a metabolic product of sphingolipids in the cell membrane, is one of the best-characterized LPLs that regulates a variety of cellular physiological responses via signaling pathways mediated by sphingosine 1-phosphate receptors (S1PRs). This implicated that the S1P-S1PRs signaling system is a remarkable potential therapeutic target for disorders, including multiple sclerosis (MS), autoimmune disorders, cancer, inflammation, and even COVID-19. S1PRs, a small subset of the class A G-protein coupled receptor (GPCR) family, are composed of five subtypes: S1PR1, S1PR2, S1PR3, S1PR4, and S1PR5. The lack of detailed structural information, however, impedes the drug discovery targeting S1PRs. Here, we applied the cryo-electron microscopy method to solve the structure of the S1P-S1PRs complex, and elucidated the mechanism of activation, selective drug recognition, and G-protein coupling by using cell-based functional assays. Other lysophospholipid receptors (LPLRs) and GPCRs can also be studied using this strategy.

Before freezing the sample of S1PRs-Gi complex, the purified sample needs to be separated by size-exclusion chromatography (SEC) and analyzed with gel filtration chromatography. Figure 2 shows the S1PR3-Gi complex as an example. The peak fraction of the homogeneous GPCR-G protein complex was usually located at ~10.5 mL of the size-exclusion chromatography (Figure 2A). SDS-page analysis of the S1PR3-Gi complex (Figure 2B) reveals fou...

Watch this Scientific Journal Video about A Pipeline to Investigate the Structures and Signaling Pathways of Sphingosine 1-Phosphate Receptors at JoVE.com

A Pipeline to Investigate the Structures and Signaling Pathways of Sphingosine 1-Phosphate Receptors

S1P exerts its diverse physiological effects through the S1P receptors (S1PRs) subfamily. Here, a pipeline is described to expound on the structures and function of S1PRs.

Lysophospholipids (LPLs) are bioactive lipids that include sphingosine 1-phosphate (S1P), lysophosphatidic acid, etc. S1P, a metabolic product of ...

Research

JoVE Journal

Biochemistry

Mimicking the Function of Signaling Proteins: Toward Artificial Signal Transduction Therapy

Signal transduction pathways, which control the response of cells to various environmental signals, are mediated by the function of signaling proteins ...

Measuring G-protein-coupled Receptor Signaling via Radio-labeled GTP Binding

G-Protein-Coupled Receptors (GPCRs) are a large family of transmembrane receptors that play critical roles in normal cellular physiology and constitute a ...

Lighting Up the Pathways to Caspase Activation Using Bimolecular Fluorescence Complementation

The caspase family of proteases play essential roles in apoptosis and innate immunity. Among these, a subgroup known as initiator caspases are the first ...

Titration ELISA as a Method to Determine the Dissociation Constant of Receptor Ligand Interaction

The dissociation constant describes the interaction between two partners in the binding equilibrium and is a measure of their affinity. It is a crucial ...

Using the Open-Source MALDI TOF-MS IDBac Pipeline for Analysis of Microbial Protein and Specialized Metabolite Data

In order to visualize the relationship between bacterial phylogeny and specialized metabolite production of bacterial colonies growing on nutrient agar, ...

Identification of Orexin and Endocannabinoid Receptors in Adult Zebrafish Using Immunoperoxidase and Immunofluorescence Methods

Immunohistochemistry (IHC) is a highly sensitive and specific technique involved in the detection of target antigens in tissue sections with labeled ...

Strategic Screening and Characterization of the Visual GPCR-mini-G Protein Signaling Complex for Successful Crystallization

The key to determining crystal structures of membrane protein complexes is the quality of the sample prior to crystallization. In particular, the choice ...

Fluorescent Leakage Assay to Investigate Membrane Destabilization by Cell-Penetrating Peptide

Cell-penetrating peptides (CPPs) are defined as carriers that are able to cross the plasma membrane and to transfer a cargo into cells. One of the main ...

A Sample Preparation Pipeline for Microcrystals at the VMXm Beamline

The mounting of microcrystals (&#60;10 &#181;m) for single crystal cryo-crystallography presents a non-trivial challenge. Improvements in data quality ...

Utilizing Time-Resolved Protein-Induced Fluorescence Enhancement to Identify Stable Local Conformations One &#945;-Synuclein Monomer at a Time

Utilizing Time-Resolved Protein-Induced Fluorescence Enhancement to Identify Stable Local Conformations One ÃƒÅ½Ã‚Â±-Synuclein Monomer at a Time

Using spectroscopic rulers to track multiple conformations of single biomolecules and their dynamics have revolutionized the understanding of structural ...