J.L.S. is supported by the German Research Foundation (DFG) under Germany&#39;s Excellence Strategy (EXC2151-390873048), as well as under SCHU 950/8-1; GRK 2168, TP11; CRC SFB 1454 Metaflammation, IRTG GRK 2168, WGGC INST 216/981-1, CCU INST 217/988-1, the BMBF-funded excellence project Diet-Body-Brain (DietBB); and the EU project SYSCID under grant number 733100. M.B. is supported by DFG (IRTG2168-272482170, SFB1454-432325352). L.B. is supported by DFG (ImmuDiet BO 6228/2-1 - Project number 513977171) and Germany&#39;s Excellence Strategy (EXC2151-390873048). Images created with BioRender.com.

This protocol follows the guidelines of the local ethics committees of the University of Bonn.
1. Preparation of buffers, solutions, and equipment
<ol>
	<li>Prepare the solutions and gather the materials described in Table of Materials.</li>
	<li>Heat up the water bath to 37 &#176;C and warm up the complete growth medium (RPMI-1640 + 10% fetal calf serum (FCS) + 1% penicillin/streptomycin).</li>
	<li>For cell harvesting, use ice-cold phosphate-buffered saline (PBS). 
	&#8203;NOTE: Keep a clean environment while working with cells to maintain sterility.</li>
</ol>
2. Cell handling
NOTE: A detailed protocol for the cryopreservation of peripheral blood mononuclear cells (PBMC) from human blood can be found in7.
<ol>
	<li>Cell thawing and counting
	<ol>
		<li>Remove the cryovials from liquid nitrogen and thaw them in a water bath at 37 &#176;C for 2 - 3 min while gently inverting.</li>
		<li>Transfer the thawed cells into a 50 mL conical tube.</li>
		<li>Rinse the cryovial with 1 mL warm complete growth medium and add this solution dropwise to the cells in the tube (1st dilution step).</li>
		<li>Repeat the dilution 1:1 until reaching a volume of 32 mL (5 dilutions total with respectively 1, 2, 4, 8, and 16 mL of warm complete growth medium). Add the medium dropwise to reduce cell disturbance while slightly agitating the conical tube.</li>
		<li>Centrifuge the cell suspension for 5 min (300 x g, 20 &#176;C) and remove the supernatant by gently tipping the conical tube in one fluent motion.</li>
		<li>Resuspend the cells in 3 mL of warm complete growth medium and proceed with cell counting.</li>
		<li>For counting, mix 10 &#181;L of cell suspension with Trypan Blue (1:2 to 1:10 dilution depending on the density of the cell suspension) to distinguish living from dead cells while counting. Dead or damaged cells will appear blue due to the uptake of the dye, while vital cells are not stained. 
		NOTE: Trypan Blue is slightly cytotoxic, stained cells should not be stored for more than 5 min.</li>
		<li>Count the cells with either an automated cell counter or counting chamber by using 10 &#181;L of stained cell solution.
		<ol>
			<li>When using the Neubauer-improved cell chamber, count all cells within the four large squares located at the corners and use the following equation to calculate the concentration of the cell suspension. 
			<img alt="Equation 1" src="/files/ftp_upload/65930/65930eq01.jpg" style="margin: auto;" /></li>
		</ol>
		</li>
		<li>Dilute the cells to a final concentration of 1 x 106 cells/mL with warm complete growth medium. Centrifuge only if the required volume is lower than 3 mL and resuspend the cell pellet to the right volume.</li>
	</ol>
	</li>
	<li>Cell seeding and treatment
	<ol>
		<li>Seed 100 &#181;L of cell suspension per well in a 96-well cell culture plate (1 x 105 cells / well). 
		NOTE: The cell number for seeding was optimized for PBMC cultures. While low cell concentrations will not yield a sufficient amount of RNA for sequencing, an excessive number of cells will increase the risk of suboptimal cell lysis and inhibition of the reverse transcription reaction.</li>
		<li>Prepare drug dilutions at a concentration two times the one used for treatment (2x). Choose the solvent according to the solubility of the compound, preferably complete growth medium. 
		NOTE: PBS or dimethyl sulfoxide (DMSO) can be used if sufficient solubility cannot be reached otherwise. The maximum concentration of DMSO in the resulting incubation volume should not exceed 0.5 % to prevent cytotoxicity induced by the solvent.</li>
		<li>Add 100 &#181;L of the 2x drug dilution (final concentration in well 1X) and incubate at 37 &#176;C for the defined time. 
		NOTE: Complementary investigations should be carried out in order to establish the optimal drug incubation time and to exclude potential mechanisms of cytotoxicity.</li>
	</ol>
	</li>
	<li>Cell harvesting and lysis
	<ol>
		<li>Centrifuge the cell culture plate for 10 min (300 x g, 20 &#176;C). Gently remove the supernatant with a vacuum pump keeping the plate at an angle (30&#176;-45&#176;) while aiming the tip at the low corner of the well to remove as little cells as possible.</li>
		<li>Wash the cells by adding 200 &#181;L of ice-cold PBS to each well and centrifuge the plate for 5 min (300 x g, 4 &#176;C). Remove the supernatant with a vacuum pump, again, keeping the plate at a sharp angle to remove as much PBS as possible.</li>
		<li>Prepare the lysis buffer as described in Table 1 for the number of reactions (rxn) needed, adding 10% overage.</li>
		<li>Add 15 &#181;L of lysis buffer to each well and seal the plate with adhesive sealing film to protect the samples against contamination. Vortex the plate before centrifuging for 1 min (1000 x g, 4 &#176;C) and incubate for 5 min on ice.</li>
		<li>Collect 6 &#181;L of lysed cell solution in a PCR plate and shortly freeze the cell lysate at -80 &#176;C to ensure optimal cell lysis. Be sure to avoid multiple freezing cycles of the plates. 
		&#8203;NOTE: STOPPING POINT: If cDNA production is not carried out subsequently, the cell lysate can be stored at -80 &#176;C for up to several months without considerable decrease of RNA quality.</li>
	</ol>
	</li>
</ol>
3. Library preparation for sequencing
<ol>
	<li>Reverse transcriptase (RT) reaction 
	NOTE: When working with RNA, place all samples on ice and be sure to use nuclease-free equipment (sterile, disposable plasticware) and water.
	<ol>
		<li>Prepare the RT reaction mix as described in Table 2 for the number of reactions needed, adding 10% overage. Briefly vortex the mix and shortly spin it down. Keep the mix on ice until use.</li>
		<li>Thaw the cell lysate at room temperature (RT) and briefly spin it down to collect all cell lysate at the bottom of the plate.</li>
		<li>Perform mRNA denaturation on a thermocycler as per Table 3.</li>
		<li>Take the plate out of the thermocycler and shortly spin it down to collect potential condensate. Add 6 &#181;L of RT reaction mix into each well for a final volume of 12 &#181;L. Seal the plate to protect the plate and to avoid evaporation, vortex, and spin it down.</li>
		<li>Place the plate on the thermocycler and start the RT reaction program as per Table 3.</li>
	</ol>
	</li>
	<li>Pre-amplification
	<ol>
		<li>Thaw the high-fidelity DNA polymerase and in-situ PCR (ISPCR) primer at room temperature.</li>
		<li>Prepare the pre-amplification mix as per Table 4 for the number of reactions needed, adding 10% overage. Briefly vortex the mix and spin it down. 
		NOTE: The enzyme mix is stable at room temperature for hours.</li>
		<li>Spin down the PCR plate, add 15 &#181;L of the pre-amplification mix to each well and seal the plate.</li>
		<li>Place it on the thermocycler and start the pre-amplification reaction as per Table 5.
		<ol>
			<li>Adjust the number of cycles due to RNA content. Start with a lower number and increase if cDNA yield is not sufficient. 
			NOTE: In our experience, optimal number of cycles should be established for each cell type, experimental condition and treatment will not influence the optimal number of cycles. We, therefore, recommend establishing the optimal number of cycles experimentally when establishing this protocol for a new cell type. In general, primary cells will require a higher number of cycles compared to cell lines. STOPPING POINT: The pre-amplification product can be stored at - 20 &#176;C.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>cDNA clean-up and quality control (QC) 
	NOTE: Sample clean-up can be performed sequentially for each plate as the samples are rather stable at this stage. Increasing the number of samples will lead to a longer duration of the protocol but will not limit the number of samples that can be processed simultaneously.
	<ol>
		<li>Before starting, bring the magnetic purification beads to room temperature and vortex on high speed for 1 min to fully resuspend the beads.</li>
		<li>Add 0.8x v/v (20 &#181;L) magnetic purification beads to each well and incubate at room temperature for 5 min.</li>
		<li>Place the PCR plate on a magnetic rack for 5 min until the beads are fully separated. Remove the supernatant carefully.</li>
		<li>Keeping the plate on the magnetic rack, gently add 100 &#181;L of freshly prepared 80% ethanol to wash the beads and incubate for 30 s. Use a small volume pipette to remove the supernatant. Repeat for an additional washing step. Be sure to remove as much ethanol as possible.</li>
		<li>Air-dry the beads on the magnetic rack at room temperature for up to 5 min until the ethanol is fully evaporated and the beads no longer look shiny.</li>
		<li>Remove the plate from the magnetic rack, resuspend the beads in 20 &#181;L of nuclease-free water and incubate for 2 min.</li>
		<li>Place the plate again on the magnetic rack until the beads are separated.</li>
		<li>Recover the eluate in a new PCR plate for cDNA QC and tagmentation.</li>
		<li>Perform a TapeStation or FragmentAnalyser assay to evaluate the size distribution and concentration of the cDNA library (Recommended: TapeStation D5000 assay). For details, see manufacturer instructions. A typical yield of 20 ng is to be expected.</li>
	</ol>
	</li>
	<li>Tagmentation with kit 
	NOTE: Other Tagmentation protocols can be used if already established.
	<ol>
		<li>Dilute the cDNA to a final concentration of 150 - 300 pg/&#181;L using nuclease-free water.</li>
		<li>Preprogram the thermocycler as per Table 6 to ensure an immediate start of the tagmentation reaction after adding the cDNA to the enzyme mix.</li>
		<li>Prepare the tagmentation mix as per Table 7 for the number of reactions needed, adding 10% overage.</li>
		<li>Dispense 3 &#181;L of the tagmentation mix per reaction onto a new PCR plate and add 1 &#181;L of cDNA to each reaction.</li>
		<li>Start the tagmentation reaction immediately after adding the cDNA.</li>
		<li>Inactivate the reaction by adding 1 &#181;L of neutralize tagment buffer (NT; alternatively, 0.2% sodium dodecyl sulfate (SDS) can be used).</li>
	</ol>
	</li>
	<li>Enrichment PCR
	<ol>
		<li>Prepare the enrichment PCR mix Table 7 for the number of reactions, adding 10% overage. (Recommended: Nextera UDI set to prevent index hopping on patterned flow cells (e.g., Illumina NovaSeq 6000)).</li>
		<li>Add 9 &#181;L of the enrichment PCR mix to each reaction for a total volume of 14 &#181;L.</li>
		<li>Run the enrichment PCR program as per Table 8. 
		NOTE: For the enrichment PCR, 16 cycles are standard. If the cDNA quality is poor, additional cycles can be added.</li>
	</ol>
	</li>
	<li>Clean-up and QC
	<ol>
		<li>Before starting, bring magnetic purification beads to room temperature and vortex on high speed for 1 min to fully resuspend the beads.</li>
		<li>Add 1.0x v/v (14 &#181;L) magnetic purification beads and incubate at room temperature for 5 min.</li>
		<li>Place the plate on a magnetic rack and wait for 5 min until the beads are fully separated. Remove the supernatant carefully.</li>
		<li>Keeping the plate on the magnetic rack, gently add 100 &#181;L of freshly prepared 80% ethanol to wash the beads and incubate for 30 s. Use a small volume pipette to remove the supernatant. Repeat for an additional washing step. Be sure to remove as much ethanol as possible.</li>
		<li>Air-dry the beads at room temperature for 3 min or until they no longer look shiny.</li>
		<li>Remove the plate from the magnetic rack, resuspend the beads in 20 &#181;L of nuclease-free water and incubate for 2 min.</li>
		<li>Place the plate again on the magnetic rack until the beads separate and recover the eluate in a new PCR plate for library QC.</li>
		<li>Perform a TapeStation or Fragment Analyzer assay to evaluate the size distribution and concentration of the cDNA library (Recommended: TapeStation D1000 high-sensitivity assay). For details, see manufacturer instructions. On average, a yield of 10 ng is to be expected. 
		&#8203;NOTE: STOPPING POINT: The PCR product can be stored at - 20 &#176;C.</li>
	</ol>
	</li>
</ol>
4. Sequencing and data pre-processing
<ol>
	<li>Sequencing 
	NOTE: The following guideline will be applicable to all Illumina instruments for short-read sequencing. If the instrumentation is not available, the sequencing can be performed by an external sequencing facility. Other sequencing approaches could also be used. For simplicity, we chose to report on the most widely used sequencing technology only. 
	NOTE: The following steps related to software usage describe the procedure on an Illumina NovaSeq6000 sequencer.
	<ol>
		<li>Pool uniquely indexed libraries in an equimolar ratio according to the results obtained in step 3.6.8.</li>
		<li>Measure the concentration of the final pool with a high-sensitivity assay to calculate the sample molarity as follows: 
		<img alt="Equation 2" src="/files/ftp_upload/65930/65930eq02.jpg" style="margin: auto;" /></li>
		<li>Load the flow cell according to the instrument&#39;s specification and to experimental optimization. Examples for loading concentrations of common instruments are shown in Table 9.</li>
		<li>By touching the screen select Sequence to initiate the run setup.</li>
		<li>Follow the instructions on screen and load flow cell, sequence-by-synthesis cartridge, clustering cartridge, buffer cartridge and ensure the waste containers are empty.</li>
		<li>Once all reagents have been recognized by the instrument click on Run Setup. Define here the run name and the output folder to store the data.</li>
		<li>Define the sequencing details as paired-end with both reads of 51 bp. Two index reads are also sequenced with 8 bp each.</li>
		<li>Press Review and after checking if all sequencing details are correct press Start Run. 
		NOTE: The recommended sequencing depth is 5 x 106 reads/sample, with a minimum 1 x 106 reads/sample.</li>
	</ol>
	</li>
	<li>Data pre-processing
	<ol>
		<li>Transform raw sequencing data to FASTQ format and demultiplex according to the sample indexes with the tool Bcl2Fastq2. Perform demultiplexing with default settings. For detailed instructions on Bcl2Fastq2, see the reference manual. 
		NOTE: FASTQ conversion and demultiplexing are usually performed by the sequencing facility if sequencing is not performed in-house. Sequencing facilities will usually provide demultiplexed FASTQ for further processing.</li>
		<li>Several options are available for data alignment and abundance quantification of sequencing reads (Recommended: nf-core RNA-seq pipeline (https://nf-co.re/rnaseq)). The pipeline provides several options, use the default setting with STAR8 as aligned and Salmon9 to quantify the transcript abundance.</li>
		<li>NOTE: For further bioinformatics analysis, several methods are available. It is not in the scope of this protocol to cover all (Recommended: DEseq2 pipeline10). A standard script based on the DEseq2 workflow developed by us can be found on GitHub (https://github.com/jsschrepping/RNA-DESeq2).</li>
	</ol>
	</li>
</ol>

Transcriptome Profiling for High-Throughput Drug Screening

<ol>
	<li>Hughes, J. P., Rees, S., Kalindjian, S. B., Philpott, K. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Principles+of+early+drug+discovery.">Principles of early drug discovery.</a> Br J Pharmacol. 162 (6), 1239-1249 (2011).</li><li>Yang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+transcriptome+profiling+in+drug+and+biomarker+discovery.">High-throughput transcriptome profiling in drug and biomarker discovery.</a> Front Genet. 11, 19 (2020).</li><li>Bonaguro, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+guide+to+systems-level+immunomics.">A guide to systems-level immunomics.</a> Nat Immunol. 23 (10), 1412-1423 (2022).</li><li>Carraro, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Decoding+mechanism+of+action+and+sensitivity+to+drug+candidates+from+integrated+transcriptome+and+chromatin+state.">Decoding mechanism of action and sensitivity to drug candidates from integrated transcriptome and chromatin state.</a> ELife. 11, 78012 (2022).</li><li>Picelli, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Smart-seq2+for+sensitive+full-length+transcriptome+profiling+in+single+cells.">Smart-seq2 for sensitive full-length transcriptome profiling in single cells.</a> Nat Methods. 10 (11), 1096-1098 (2013).</li><li>Picelli, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Full-length+RNA-seq+from+single+cells+using+Smart-seq2.">Full-length RNA-seq from single cells using Smart-seq2.</a> Nat Protoc. 9 (1), 171-181 (2014).</li><li>De Domenico, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimized+workflow+for+single-cell+transcriptomics+on+infectious+diseases+including+COVID-19.">Optimized workflow for single-cell transcriptomics on infectious diseases including COVID-19.</a> STAR Protoc. 1 (3), 100233 (2020).</li><li>Dobin, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ultrafast+universal+RNA-seq+aligner.">ultrafast universal RNA-seq aligner.</a> Bioinformatics. 29 (1), 15-21 (2013).</li><li>Patro, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Salmon+provides+fast+and+bias-aware+quantification+of+transcript+expression.">Salmon provides fast and bias-aware quantification of transcript expression.</a> Nat Methods. 14 (4), 417-419 (2017).</li><li>Love, M. I., Huber, W., Anders, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Moderated+estimation+of+fold+change+and+dispersion+for+RNA-seq+data+with+DESeq2.">Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2.</a> Genome Biol. 15 (12), 550 (2014).</li><li>Frankish, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GENCODE+reference+annotation+for+the+human+and+mouse+genomes.">GENCODE reference annotation for the human and mouse genomes.</a> Nucleic Acids Res. 47, D766-D773 (2019).</li></ol>

The authors declare no competing interests.

Drug discovery and drug development can greatly benefit from the holistic view of cellular processes that bulk transcriptomics can provide. Nevertheless, this approach is often limited by the high cost of the experiment with standard bulk RNA-seq protocol, prohibiting its application in academic settings as well as its potential for industrial scalability.
The most critical steps of the protocol are cell thawing and the initial steps of library preparation. Ensuring high viability of the cells...

The development of new drugs is a complex and time-consuming process that involves identifying potential drugs and their targets, optimizing and synthesizing drug candidates, and testing their efficacy and safety in preclinical and clinical trials1. Traditional methods for drug screening, i.e., the systematic assessment of libraries of candidate compounds for therapeutic purposes, involve the use of animal models or cell-based assays to test the effects on specific targets or pathways. While these methods have been successful in identifying drug candidates, they often did not provide sufficient insights into the complex molecular mechanisms underlying drug efficacy and also toxicity and mechanisms of potential side effects.
Assessing genome-wide transcriptional states presents a powerful approach to overcome current limitations in drug screening, as it enables comprehensive assessments of gene expression in response to drug treatments2. By measuring RNA transcripts in a genome-wide fashion expressed at a given time, transcriptomics aims to provide a holistic view of the transcriptional changes that occur in response to drugs, including changes in gene expression patterns, alternative splicing, and non-coding RNA expression3. This information can be used to determine drug targets, predict drug efficacy and toxicity, and optimize drug dosing and treatment regimens.
One of the key benefits of combining transcriptomics with unbiased drug screening is the potential to identify new drug targets that have not been previously considered. Conventional drug screening approaches often focus on established target molecules or pathways, hindering the identification of new targets and potentially resulting in drugs with unforeseen side effects and restricted effectiveness. Transcriptomics can overcome these limitations by providing insights into the molecular changes that occur in response to drug treatment, uncovering potential targets or pathways that may not have been previously considered2.
In addition to the identification of new drug targets, transcriptomics can also be used to predict drug efficacy and toxicity. By analyzing the gene expression patterns associated with drug responses, biomarkers can be developed that can be used to predict a patient's response to a particular drug or treatment regimen. This can also help to optimize drug dosing and reduce the risk of adverse side effects4.
Despite its potential benefits, the cost of transcriptomics remains a significant barrier to its widespread application in drug screening. Transcriptomic analysis requires specialized equipment, technical expertise, and data analysis, which can make it challenging for smaller research teams or organizations with limited funding to utilize transcriptomics in drug screening. However, the cost of transcriptomics has been steadily decreasing, making it more accessible to the research communities. Additionally, advancements in technology and data analysis methods have made transcriptomics more efficient and cost-effective, further increasing its accessibility2.
In this protocol, we describe a high-dimensional and explorative system for transcriptome-based drug screening, combining miniaturized perturbation cultures with mini-bulk transcriptomics analysis5,6. With this protocol, it is possible to reduce the cost per sample to 1/6th of the current cost of commercial solutions for full-length mRNA sequencing. The protocol requires only standard laboratory equipment, the only exception being the use of short-read sequencing technologies, which can be outsourced if sequencing instruments are not available in-house. The optimized mini-bulk protocol provides information-rich biological signals at cost-effective sequencing depth, enabling extensive screening of known drugs and new molecules.
The aim of the experiment is to screen for drug activity on PBMCs in different biological contexts. This protocol can be applied to any biological question where several drugs should be tested with a transcriptomic readout, giving a transcriptome-wide view of the cellular effect of the treatment.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>50 mL conical tube</td>
			<td>fisher scientific</td>
			<td>10203001</td>
			<td></td>
		</tr>
		<tr>
			<td>Adhesive PCR Plate Seals</td>
			<td>Thermo Fisher Scientific</td>
			<td>AB0558</td>
			<td></td>
		</tr>
		<tr>
			<td>Amplicon Tagment Mix (ATM)</td>
			<td>Illumina</td>
			<td>FC-131-1096</td>
			<td>Nextera XT DNA Library Prep Kit (96 samples)</td>
		</tr>
		<tr>
			<td>AMPure XP beads</td>
			<td>Beckman Coulter</td>
			<td>A 63881</td>
			<td></td>
		</tr>
		<tr>
			<td>Betaine&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>61962</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell culture grade 96-well plates</td>
			<td>Thermo Fisher Scientific</td>
			<td>260860</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell culture vacuum pump (VACUSAFE)</td>
			<td>Integra Bioscience</td>
			<td>158300</td>
			<td></td>
		</tr>
		<tr>
			<td>Deoxynucleotide triphosphates (dNTPs) mix 10 mM each</td>
			<td>Fermentas</td>
			<td>R0192</td>
			<td></td>
		</tr>
		<tr>
			<td>DMSO</td>
			<td>Sigma-Aldrich</td>
			<td>276855</td>
			<td></td>
		</tr>
		<tr>
			<td>DTT (100 mM)</td>
			<td>Invitrogen</td>
			<td>18064-014</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Sigma-Aldrich</td>
			<td>798681</td>
			<td>for adherent cells</td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>Sigma-Aldrich</td>
			<td>51976</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>Thermo Fisher Scientific</td>
			<td>26140079</td>
			<td></td>
		</tr>
		<tr>
			<td>Filter tips (10 &#181;L)</td>
			<td>Gilson&#160;</td>
			<td>F171203</td>
			<td></td>
		</tr>
		<tr>
			<td>Filter tips (100 &#181;L)</td>
			<td>Gilson&#160;</td>
			<td>F171403</td>
			<td></td>
		</tr>
		<tr>
			<td>Filter tips (20 &#181;L)</td>
			<td>Gilson&#160;</td>
			<td>F171303</td>
			<td></td>
		</tr>
		<tr>
			<td>Filter tips (200 &#181;L)</td>
			<td>Gilson&#160;</td>
			<td>F171503</td>
			<td></td>
		</tr>
		<tr>
			<td>Guanidine Hydrochloride</td>
			<td>Sigma-Aldrich</td>
			<td>G3272</td>
			<td></td>
		</tr>
		<tr>
			<td>ISPCR primer (10 &#181;M)</td>
			<td>Biomers.net GmbH</td>
			<td>SP10006</td>
			<td>5&#8242;-AAGCAGTGGTATCAACGCAGAG 
			T-3&#8242;</td>
		</tr>
		<tr>
			<td>KAPA HiFi HotStart ReadyMix (2X)</td>
			<td>KAPA Biosystems</td>
			<td>KK2601</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnesium chloride (MgCl2)&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>M8266</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnetic stand 96</td>
			<td>Ambion</td>
			<td>AM10027</td>
			<td></td>
		</tr>
		<tr>
			<td>Neutralize Tagment (NT) Buffer&#160;</td>
			<td>Illumina</td>
			<td>FC-131-1096</td>
			<td>Nextera XT DNA Library Prep Kit (96 samples), alternatively 0.2 % SDS</td>
		</tr>
		<tr>
			<td>Nextera-compatible indexing primer</td>
			<td>Illumina</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Nuclease-free water</td>
			<td>Invitrogen</td>
			<td>10977049</td>
			<td></td>
		</tr>
		<tr>
			<td>PBS</td>
			<td>Thermo Fisher Scientific</td>
			<td>AM9624</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR 96-well plates</td>
			<td>Thermo Fisher Scientific</td>
			<td>AB0600</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR plate sealer</td>
			<td>Thermo Fisher Scientific</td>
			<td>HSF0031</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin / Streptomycin&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>15070063</td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit 4 fluorometer</td>
			<td>Invitrogen</td>
			<td>15723679</td>
			<td></td>
		</tr>
		<tr>
			<td>Recombinant RNase inhibitor (40 U/ul)</td>
			<td>TAKARA</td>
			<td>2313A</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI-1640 cell culture medium&#160;</td>
			<td>Gibco</td>
			<td>61870036</td>
			<td>If not working with PBMCs, adjust to cell type&#160;</td>
		</tr>
		<tr>
			<td>SMART dT30VN primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#39; Bio-AAGCAGTGGTATCAACGCAGAG 
			TACT30VN-3</td>
		</tr>
		<tr>
			<td>Standard lab equipment</td>
			<td>various</td>
			<td>various</td>
			<td>e.g. centrifuge, ice machine, ice bucket, distilled water, water bath</td>
		</tr>
		<tr>
			<td>SuperScript II Reverse Transcriptase (SSRT II)</td>
			<td>Thermo Fisher Scientific</td>
			<td>18064-014</td>
			<td></td>
		</tr>
		<tr>
			<td>SuperScript II Reverse Transcriptase (SSRT II) buffer (5x)</td>
			<td>Thermo Fisher Scientific</td>
			<td>18064-014</td>
			<td></td>
		</tr>
		<tr>
			<td>Tagment DNA Buffer (TD)</td>
			<td>Illumina</td>
			<td>FC-131-1096</td>
			<td>Nextera XT DNA Library Prep Kit (96 samples)</td>
		</tr>
		<tr>
			<td>TapeStation system 4200</td>
			<td>Agilent</td>
			<td>G2991BA</td>
			<td></td>
		</tr>
		<tr>
			<td>Thermocycler (S1000)</td>
			<td>Bio-Rad</td>
			<td>1852148</td>
			<td></td>
		</tr>
		<tr>
			<td>TSO-LNA (100 uM)</td>
			<td>Eurogentec</td>
			<td></td>
			<td>5&#39; Biotin AAGCAGTGGTATCAACGCAGAG 
			TACAT(G)(G){G</td>
		</tr>
		<tr>
			<td>Vortex-Genie 2 Mixer</td>
			<td>Sigma-Aldrich</td>
			<td>Z258415</td>
			<td></td>
		</tr>
	</tbody>
</table>

cost-efficient transcriptomic-based drug screening

Transcriptomics allows&#160;to obtain comprehensive insights into cellular programs and their responses to perturbations. Despite a significant decrease in the costs of library production and sequencing in the last decade, applying these technologies at the scale necessary for drug screening remains prohibitively expensive, obstructing the immense potential of these methods. Our study presents a cost-effective system for transcriptome-based drug screening, combining miniaturized perturbation cultures with mini-bulk transcriptomics. The optimized mini-bulk protocol provides informative biological signals at cost-effective sequencing depth, enabling extensive screening of known drugs and new molecules. Depending on the chosen treatment and incubation time, this protocol will result in sequencing libraries within approximately 2 days. Due to several stopping points within this protocol, the library preparation, as well as the sequencing, can be performed time-independently. Processing simultaneously a high number of samples is possible; measurement of up to 384 samples was tested without loss of data quality. There are also no known limitations to the number of conditions and/or drugs, despite considering variability in optimal drug incubation times.

Following the reported protocol, human PBMCs were seeded, treated with different immunomodulatory drugs and, after different incubation times, harvested for bulk transcriptomic analysis using the sequencing protocol (Figure 1).
Ideal drug concentrations and incubation times for test compounds should be identified upstream this protocol with the help of complementary experimental strategies and based on the specific scientific question. In most cases, 2 - 4 h and 2...

Watch this Scientific Journal Video about Cost-Effective Transcriptomic Drug Screening — Unlocking New Targets at JoVE.com

Author Spotlight: Cost-Effective Transcriptomic Drug Screening - Unlocking New Targets 

This protocol describes a workflow from ex vivo or in vitro cell cultures to transcriptomic data pre-processing for cost-effective transcriptome-based drug screening.

Cost-Efficient Transcriptomic-Based Drug Screening

Transcriptomics allows&#160;to obtain comprehensive insights into cellular programs and their responses to perturbations. Despite a significant decrease ...

cost-efficient-transcriptomic-based-drug-screening

Research

JoVE Journal

Biology

1.2K Views.  German Center for Neurodegenerative Diseases (DZNE) eV.. This protocol describes a workflow from ex vivo or in vitro cell cultures to transcriptomic data pre-processing for cost-effective transcriptome-based drug screening. 

Video: Author Spotlight: Cost-Effective Transcriptomic Drug Screening - Unlocking New Targets 

Visualization of Mitochondrial Respiratory Function using Cytochrome C Oxidase / Succinate Dehydrogenase (COX/SDH) Double-labeling Histochemistry

Mitochondrial DNA (mtDNA) defects are an important cause of disease and may underlie aging and aging-related alterations 1,2. The mitochondrial theory of aging suggests a role for mtDNA mutations, which can alter bioenergetics homeostasis and cellular function, in the aging process 3. A wealth of evidence has been compiled in support of this theory 1,4, an example being the mtDNA mutator mouse 5; however, the precise role of mtDNA damage in aging is not entirely understood 6,7.
Observing the activity of respiratory enzymes is a straightforward approach for investigating mitochondrial dysfunction. Complex IV, or cytochrome c oxidase (COX), is essential for mitochondrial function. The catalytic subunits of COX are encoded by mtDNA and are essential for assembly of the complex (Figure 1). Thus, proper synthesis and function are largely based on mtDNA integrity 2. Although other respiratory complexes could be investigated, Complexes IV and II are the most amenable to histochemical examination 8,9. Complex II, or succinate dehydrogenase (SDH), is entirely encoded by nuclear DNA (Figure 1), and its activity is typically not affected by impaired mtDNA, although an increase might indicate mitochondrial biogenesis 10-12. The impaired mtDNA observed in mitochondrial diseases, aging, and age-related diseases often leads to the presence of cells with low or absent COX activity 2,12-14. Although COX and SDH activities can be investigated individually, the sequential double-labeling method 15,16 has proved to be advantageous in locating cells with mitochondrial dysfunction 12,17-21.
Many of the optimal constitutions of the assay have been determined, such as substrate concentration, electron acceptors/donors, intermediate electron carriers, influence of pH, and reaction time 9,22,23. 3,3'-diaminobenzidine (DAB) is an effective and reliable electron donor 22. In cells with functioning COX, the brown indamine polymer product will localize in mitochondrial cristae and saturate cells 22. Those cells with dysfunctional COX will therefore not be saturated by the DAB product, allowing for the visualization of SDH activity by reduction of nitroblue tetrazolium (NBT), an electron acceptor, to a blue formazan end product 9,24. Cytochrome c and sodium succinate substrates are added to normalize endogenous levels between control and diseased/mutant tissues 9. Catalase is added as a precaution to avoid possible contaminating reactions from peroxidase activity 9,22. Phenazine methosulfate (PMS), an intermediate electron carrier, is used in conjunction with sodium azide, a respiratory chain inhibitor, to increase the formation of the final reaction products 9,25. Despite this information, some critical details affecting the result of this seemly straightforward assay, in addition to specificity controls and advances in the technique, have not yet been presented.

Visualization of Mitochondrial Respiratory Function using Cytochrome C Oxidase / Succinate Dehydrogenase COX/SDH Double-labeling Histochemistry

The cytochrome c oxidase/sodium dehydrogenase (COX/SDH) double-labeling method allows for direct visualization of mitochondrial respiratory enzyme deficiencies in fresh-frozen tissue sections. This is a straightforward histochemical technique and is useful in investigating mitochondrial diseases, aging, and aging-related disorders.

Mitochondrial DNA (mtDNA) defects are an important cause of disease and may underlie aging and aging-related alterations 1,2. The mitochondrial theory of ...

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. coli O157:H7 by targeting ORF Z3276. With this assay, we can detect as low as a few copies of the genome of DNA of E. coli O157:H7. The sensitivity and specificity of the assay were confirmed by intensive validation tests with a large number of E. coli O157:H7 strains (n = 369) and non-O157 strains (n = 112). Furthermore, we have combined propidium monoazide (PMA) procedure with the newly developed qPCR protocol for selective detection of live cells from dead cells. Amplification of DNA from PMA-treated dead cells was almost completely inhibited in contrast to virtually unaffected amplification of DNA from PMA-treated live cells. Additionally, the protocol has been modified and adapted to a 96-well plate format for an easy and consistent handling of a large number of samples. This method is expected to have an impact on accurate microbiological and epidemiological monitoring of food safety and environmental source.

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A qPCR assay was developed for detection of Escherichia coli O157:H7 targeting a unique genetic marker, Z3276. The qPCR was combined with propidium monoazide (PMA) treatment for live cell detection. This protocol has been modified and adapted to a 96-well plate format for easy and consistent handling of numerous samples

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. ...

Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

One major limitation with current human embryonic stem cell (ESC) differentiation protocols is the generation of heterogeneous cell populations.&#160;These cultures contain the cells of interest, but are also contaminated with undifferentiated ESCs, non-neural derivatives and other neuronal subtypes.&#160; This limits their use in in vitro and in vivo applications, such as in vitro modeling for drug discovery or cell replacement therapy. To help overcome this, reporter cell lines, which offer a means to visualize, track and isolate cells of interest, can be engineered.&#160;However, to achieve this in human embryonic stem cells via conventional homologous recombination is extremely inefficient.&#160;This protocol describes targeting of the Pituitary homeobox 3 (PITX3) locus in human embryonic stem cells using custom designed zinc-finger nucleases, which introduce site-specific double-strand DNA breaks, together with a PITX3-EGFP-specific DNA donor vector. Following the generation of the PITX3 reporter cell line, it can then be differentiated using published protocols for use in studies such as in vitro Parkinson&#8217;s disease modeling or cell replacement therapy.

Reporter cell lines offer a means to visualize, track and isolate cells of interest from heterogeneous populations.&#160;However, gene-targeting using conventional homologous recombination in human embryonic stem cells is extremely inefficient. Herein, we describe targeting CNS midbrain specific transcription factor PITX3 locus with EGFP using zinc-finger nuclease enhanced homologous recombination.

One major limitation with current human embryonic stem cell (ESC) differentiation protocols is the generation of heterogeneous cell ...

Development of Inhibitors of Protein-protein Interactions through REPLACE: Application to the Design and Development Non-ATP Competitive CDK Inhibitors

REPLACE is a unique strategy developed to more effectively target protein-protein interactions (PPIs). It aims to expand available drug target space by providing improved methodology for the identification of inhibitors for such binding sites and which represent the majority of potential drug targets. The main goal of this paper is to provide a methodological overview of the use and application of the REPLACE strategy which involves computational and synthetic chemistry approaches. REPLACE is exemplified through its application to the development of non-ATP competitive cyclin dependent kinases (CDK) inhibitors as anti-tumor therapeutics. CDKs are frequently deregulated in cancer and hence are considered as important targets for drug development. Inhibition of CDK2/cyclin A in S phase has been reported to promote selective apoptosis of cancer cells in a p53 independent manner through the E2F1 pathway. Targeting the protein-protein interaction at the cyclin binding groove (CBG) is an approach which will allow the specific inhibition of cell cycle over transcriptional CDKs. The CBG is recognized by a consensus sequence derived from CDK substrates and tumor suppressor proteins termed the cyclin binding motif (CBM). The CBM has previously been optimized to an octapeptide from p21Waf (HAKRRIF) and then further truncated to a pentapeptide retaining sufficient activity (RRLIF). Peptides in general are not cell permeable, are metabolically unstable and therefore the REPLACE (REplacement with Partial Ligand Alternatives through Computational Enrichment) strategy has been applied in order to generate more drug-like inhibitors. The strategy begins with the design of Fragment ligated inhibitory peptides (FLIPs) that selectively inhibit cell cycle CDK/cyclin complexes. FLIPs were generated by iteratively replacing residues of HAKRRLIF/RRLIF with fragment like small molecules (capping groups), starting from the N-terminus (Ncaps), followed by replacement on the C-terminus. These compounds are starting points for the generation of non-ATP competitive CDK inhibitors as anti-tumor therapeutics.

We describe implementation of the REPLACE strategy for targeting protein-protein interactions. REPLACE is an iterative strategy involving synthetic and computational approaches for the conversion of optimized peptidic inhibitors into drug like molecules.

REPLACE is a unique strategy developed to more effectively target protein-protein interactions (PPIs). It aims to expand available drug target space by ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays focus on transcriptional regulation, being essentially aimed at the identification of promoter-targeting molecules. As a result, post-transcriptional mechanisms are largely uncovered by gene expression targeted drug development. Here we describe a cell-based assay aimed at investigating the role of the 3&#39; untranslated region (3&#8217; UTR) in the modulation of the fate of its mRNA, and at identifying compounds able to modify it. The assay is based on the use of a luciferase reporter construct containing the 3&#8217; UTR of a gene of interest stably integrated into a disease-relevant cell line. The protocol is divided into two parts, with the initial focus on the primary screening aimed at the identification of molecules affecting luciferase activity after 24 hr of treatment. The second part of the protocol describes the counter-screening necessary to discriminate compounds modulating luciferase activity specifically through the 3&#8217; UTR. In addition to the detailed protocol and representative results, we provide important considerations about the assay development and the validation of the hit(s) on the endogenous target. The described cell-based reporter gene assay will allow scientists to identify molecules modulating protein levels via post-transcriptional mechanisms dependent on a 3&#8217; UTR.

Here we describe a cell-based reporter gene assay as a valuable tool to screen chemical libraries for compounds modulating post-transcriptional control mechanisms exerted through 3&#8217; UTR.

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

A High Yield and Cost-efficient Expression System of Human Granzymes in Mammalian Cells

When cytotoxic T lymphocytes (CTL) or natural killer (NK) cells recognize tumor cells or cells infected with intracellular pathogens, they release their cytotoxic granule content to eliminate the target cells and the intracellular pathogen. Death of the host cells and intracellular pathogens is triggered by the granule serine proteases, granzymes (Gzms), delivered into the host cell cytosol by the pore forming protein perforin (PFN) and into bacterial pathogens by the prokaryotic membrane disrupting protein granulysin (GNLY). To investigate the molecular mechanisms of target cell death mediated by the Gzms in experimental in-vitro settings, protein expression and purification systems that produce high amounts of active enzymes are necessary. Mammalian secreted protein expression systems imply the potential to produce correctly folded, fully functional protein that bears posttranslational modification, such as glycosylation. Therefore, we used a cost-efficient calcium precipitation method for transient transfection of HEK293T cells with human Gzms cloned into the expression plasmid pHLsec. Gzm purification from the culture supernatant was achieved by immobilized nickel affinity chromatography using the C-terminal polyhistidine tag provided by the vector. The insertion of an enterokinase site at the N-terminus of the protein allowed the generation of active protease that was finally purified by cation exchange chromatography. The system was tested by producing high levels of cytotoxic human Gzm A, B and M and should be capable to produce virtually every enzyme in the human body in high yields.

We describe here a cost-efficient granzyme expression system using HEK293T cells that produces high yields of pure, fully glycosylated and enzymatically active protease.

When cytotoxic T lymphocytes (CTL) or natural killer (NK) cells recognize tumor cells or cells infected with intracellular pathogens, they release their ...

Identification of Kinase-substrate Pairs Using High Throughput Screening

We have developed a screening platform to identify dedicated human protein kinases for phosphorylated substrates which can be used to elucidate novel signal transduction pathways. Our approach features the use of a library of purified GST-tagged human protein kinases and a recombinant protein substrate of interest. We have used this technology to identify MAP/microtubule affinity-regulating kinase 2 (MARK2) as the kinase for a glucose-regulated site on CREB-Regulated Transcriptional Coactivator 2 (CRTC2), a protein required for beta cell proliferation, as well as the Axl family of tyrosine kinases as regulators of cell metastasis by phosphorylation of the adaptor protein ELMO. We describe this technology and discuss how it can help to establish a comprehensive map of how cells respond to environmental stimuli.

Protein phosphorylation is a central feature of how cells interpret and respond to information in their extracellular milieu. Here, we present a high throughput screening protocol using kinases purified from mammalian cells to rapidly identify kinases that phosphorylate a substrate(s) of interest.


We have developed a screening platform to identify dedicated human protein kinases for phosphorylated substrates which can be used to elucidate novel ...

Monitoring Endoplasmic Reticulum Calcium Homeostasis Using a Gaussia Luciferase SERCaMP

The endoplasmic reticulum (ER) contains the highest level of intracellular calcium, with concentrations approximately 5,000-fold greater than cytoplasmic levels. Tight control over ER calcium is imperative for protein folding, modification and trafficking. Perturbations to ER calcium can result in the activation of the unfolded protein response, a three-prong ER stress response mechanism, and contribute to pathogenesis in a variety of diseases. The ability to monitor ER calcium alterations during disease onset and progression is important in principle, yet challenging in practice. Currently available methods for monitoring ER calcium, such as calcium-dependent fluorescent dyes and proteins, have provided insight into ER calcium dynamics in cells, however these tools are not well suited for in vivo studies. Our lab has demonstrated that a modification to the carboxy-terminus of Gaussia luciferase confers secretion of the reporter in response to ER calcium depletion. The methods for using a luciferase based, secreted ER calcium monitoring protein (SERCaMP) for in vitro and in vivo applications are described herein. This video highlights hepatic injections, pharmacological manipulation of GLuc-SERCaMP, blood collection and processing, and assay parameters for longitudinal monitoring of ER calcium.

Monitoring Endoplasmic Reticulum Calcium Homeostasis Using a Gaussia Luciferase SERCaMP

Endoplasmic reticulum calcium homeostasis is disrupted in diverse pathologies. A secreted ER calcium monitoring protein (SERCaMP) reporter can be used to detect disruptions in the ER calcium store. This protocol describes the use of a Gaussia luciferase SERCaMP to examine ER calcium homeostasis in vitro and in vivo.

The endoplasmic reticulum (ER) contains the highest level of intracellular calcium, with concentrations approximately 5,000-fold greater than cytoplasmic ...

Multi-enzyme Screening Using a High-throughput Genetic Enzyme Screening System

The recent development of a high-throughput single-cell assay technique enables the screening of novel enzymes based on functional activities from a large-scale metagenomic library1. We previously proposed a genetic enzyme screening system (GESS) that uses dimethylphenol regulator activated by phenol or p-nitrophenol. Since a vast amount of natural enzymatic reactions produce these phenolic compounds from phenol deriving substrates, this single genetic screening system can be theoretically applied to screen over 200 different enzymes in the BRENDA database. Despite the general applicability of GESS, applying the screening process requires a specific procedure to reach the maximum flow cytometry signals. Here, we detail the developed screening process, which includes metagenome preprocessing with GESS and the operation of a flow cytometry sorter. Three different phenolic substrates (p-nitrophenyl acetate, p-nitrophenyl-&#946;-D-cellobioside, and phenyl phosphate) with GESS were used to screen and to identify three different enzymes (lipase, cellulase, and alkaline phosphatase), respectively. The selected metagenomic enzyme activities were confirmed only with the flow cytometry but DNA sequencing and diverse in vitro analysis can be used for further gene identification.

This work presents a method of high-throughput screening using a universal genetic enzyme screening system that can be theoretically applied to over 200 enzymes. Here, the single screening system identifies three different enzymes (lipase, cellulase, and alkaline phosphatase) by simply changing the substrate used (p-nitrophenyl acetate, p-nitrophenyl-&#946;-D-cellobioside, and phenyl phosphate).

The recent development of a high-throughput single-cell assay technique enables the screening of novel enzymes based on functional activities from a ...

Loop-Mediated Isothermal Amplification for Screening Salmonella in Animal Food and Confirming Salmonella from Culture Isolation

Loop-mediated isothermal amplification (LAMP) has emerged as a powerful nucleic acid amplification test for the rapid detection of numerous bacterial, fungal, parasitic, and viral agents. Salmonella is a bacterial pathogen of worldwide food safety concern, including food for animals. Presented here is a multi-laboratory-validated Salmonella LAMP protocol that can be used to rapidly screen animal food for the presence of Salmonella contamination and can also be used to confirm presumptive Salmonella isolates recovered from all food categories. The LAMP assay specifically targets the Salmonella invasion gene (invA) and is rapid, sensitive, and highly specific. Template DNAs are prepared from enrichment broths of animal food or pure cultures of presumptive Salmonella isolates. The LAMP reagent mixture is prepared by combining an isothermal master mix, primers, DNA template, and water. The LAMP assay runs at a constant temperature of 65 &#176;C for 30 min. Positive results are monitored via real-time fluorescence and can be detected as early as 5 min. The LAMP assay exhibits high tolerance to inhibitors in animal food or culture medium, serving as a rapid, reliable, robust, cost-effective, and user-friendly method for screening and confirming Salmonella. The LAMP method has recently been incorporated into the U.S. Food and Drug Administration&#8217;s Bacteriological Analytical Manual (BAM) Chapter 5.

Loop-Mediated Isothermal Amplification for Screening Salmonella in Animal Food and Confirming Salmonella from Culture Isolation

Loop-mediated isothermal amplification (LAMP) is an isothermal nucleic acid amplification test (iNAAT) that has attracted broad interest in the pathogen detection field. Here, we present a multi-laboratory-validated Salmonella LAMP protocol as a rapid, reliable, and robust method for screening Salmonella in animal food and confirming presumptive Salmonella from culture isolation.

Loop-mediated isothermal amplification (LAMP) has emerged as a powerful nucleic acid amplification test for the rapid detection of numerous bacterial, ...

Cost-Efficient Transcriptomic-Based Drug Screening

Summary

Explore More Videos

Chapters in this video

Visualization of Mitochondrial Respiratory Function using Cytochrome C Oxidase / Succinate Dehydrogenase (COX/SDH) Double-labeling Histochemistry

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

Development of Inhibitors of Protein-protein Interactions through REPLACE: Application to the Design and Development Non-ATP Competitive CDK Inhibitors

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

A High Yield and Cost-efficient Expression System of Human Granzymes in Mammalian Cells

Identification of Kinase-substrate Pairs Using High Throughput Screening

Monitoring Endoplasmic Reticulum Calcium Homeostasis Using a Gaussia Luciferase SERCaMP

Multi-enzyme Screening Using a High-throughput Genetic Enzyme Screening System

Loop-Mediated Isothermal Amplification for Screening Salmonella in Animal Food and Confirming Salmonella from Culture Isolation