In diesem Protokoll beschriebenen Arbeiten wurden durch Mittel aus der viktorianischen Regierung als Teil eines kollaborativen Allianz mit dem kalifornischen Institut für Regenerative Medizin (CIRM) möglich.

Alle Verfahren werden in einer sterilen Laminar Flow durchgeführt. Alle Medien und Lösungen werden auf 37 ° C äquilibriert, sofern nicht anders angegeben. 1. Erweiterung des menschlichen PSCs (hES-Zellen und hiPSCs, WA-09 in diesem Protokoll verwendet wird) für die Transfektion Hinweis: Es ist nicht notwendig, auf hES Matrigel oder Geltrex erweitern. hES auf embryonale Maus-Fibroblasten (MEF) erweitert werden kann, für die Elektroporation oder Nukleofektion nach einer MEF-Entfernungsstufe verwendet werden (siehe Abschnitt 2.8). <ol><li> Vorbereitung 1 x 100-mm-Schale und 1 x 75cm2 Kolben DR4 MEFs auf 2,0 x 10 4 Zellen pro cm 2 in MEF Medium (siehe Tabelle 1) auf Platten mit 0,1% w / v Gelatine vorbeschichtet. Hinweis: CF1, BLK6 oder MF1 MEFs verwendet werden, jedoch empfiehlt es sich, Antibiotika-resistenten MEF Leitungen verwendet werden, beispielsweise DR410. </li><li> Am nächsten Tag, Passage hES auf eine 100-mm-Schale mit MEFs in Abschnitt 1.1 vorbereiteten, überzogen. Um dieses zu tun ASPIRate hESC Medien aus Kulturen Geschirr, waschen hES mit Ca2 + / Mg2 + -freie Hanks &#39;Salzlösung (HBSS), fügen Dispase (siehe Tabelle 2 angemessenen Mengen) und in einem befeuchteten Brutschrank bei 37 ° C / 5% CO 2. Nach 3-5 min Inkubation aspirieren Dispase und vorsichtig waschen 1-2 mal mit HBSS auf MEFs entfernen. Fügen hESC Medien (siehe Tabelle 3) und mit einem Zellschaber oder 5 ml Pipette vorsichtig abkratzen die Kolonien von der Oberfläche der Kulturschale. </li><li> Sammeln Sie die Bruchstücke Kolonie in Suspension von der Kulturschale in ein 15 ml-Zentrifugenröhrchen. Spülen Kulturschale mit hESC Medien und Transfer zum 15-ml-Tube. Seien Sie vorsichtig, um nicht brechen Klumpen in einzelne Zellen oder kleine Fragmente. </li><li> Zentrifuge 5 min bei 160 × g pelletiert Kolonie Fragmente. </li><li> Überstand wird abgesaugt. Tippen Sie unten auf 15-ml-Tube mit dem Finger zu Kolonie Fragment Pellet zu lösen. Vorsichtig resuspendieren Kolonie Fragmente in hESC Medien nach Split-Verhältnis (normallya Aufteilungsverhältnis zwischen 1: 4 und 1: 8 angebracht ist). Seien Sie äußerst vorsichtig, nicht zu Klumpen in einzelne Zellen oder kleine Fragmente, da dies machen beeinflussen Neubelegung Effizienz. </li><li> Vor der Neubelegung hESC-Fragmente auf MEFs waschen 1x mit HBSS. Langsam eine entsprechende Menge (siehe Tabelle 2) der Zellsuspension, die hES-Fragmente in hESC Medien, Gerichte mit MEFs vorgestrichen. </li><li> Zeigen Kulturschalen auf Regal im Inkubator und bewegen sich langsam hin und her und her, um gleichmäßig zu verteilen Kolonie Fragmente. </li><li> Ersetzen hESC Medien täglich. </li><li> Um konditionierten Medien von MEF (MEF-CM) vorbereiten waschen die 75 cm 2-Kolben mit MEFs 1 x mit HBSS vorgestrichen. Fügen hESC Medien. Nach 24 Stunden, sammeln konditionierten Medien und ersetzen mit frischen hESC Medien. Wiederholen täglich für maximal 12 Tage. Speichern MEF-cm bei 4 ° C, bis sie benötigt. </li></ol> 2. Vorbereitung der Menschen WSR für die Transfektion <ol><li> Beobachten das Wachstum von hESunter dem Mikroskop täglich. Wenn Kolonien werden 40-50% konfluent, Platte 3 x 100-mm-Schalen mit 2,0 x 10 5 MEFs pro cm 2. </li><li> Wenn Kolonien werden bei 60 - 70% konfluent sind sie bereit, transfiziert werden. &#39;Bräutigam&#39; Kolonien, indem differenzierte Kolonien oder Kolonie Kerne. Hinweis: Da wir glauben, dass höhere Transfektion und Targeting-Effizienz auf, wenn Zellen in der logarithmischen Wachstumsphase, wird vorgeschlagen, dass die Elektroporation durchgeführt werden, bevor hES erreichen ≥ 70% Konfluenz. </li><li> Waschen hESC Kolonien mit HBSS und fügen Accutase. Hinweis: Es ist nicht notwendig, vor der Behandlung mit hES ROCK-Inhibitor Y-27632 als ausreichend Hemmung tritt auf, wenn mit Y-27632 während der Stufe 2,7 inkubiert </li><li> Inkubation für 10 - 20 min bei 37 ° C / 5% CO 2, bis Kolonien gemacht einzelnen Zellen unter einem Mikroskop betrachtet. Man reibt Zellen mit einer 1 ml Pipette. </li><li> Fügen hESC Medien und Filter in eine 15 ml konischen Röhrchen mit einer 40 um Zell Strainer, um Zellklumpen zu entfernen. </li><li> Zentrifuge bei 160 × g für 5 min. Resuspendieren Zellpellet in frischem hESC Medien und wiederholen, um jegliche Rest Accutase Lösung zu entfernen. </li><li> Die Zellen in hESC Medien mit 10 uM Y-27632 und übertragen die gesamte Zellsuspension auf eine 100-mm-Schale mit Gelatine vor-beschichtet. </li><li> Bei 37 ° C / 5% CO 2 für mindestens 30 min. </li><li> Während dieser Zeit wird MEFs auf die Gelatine beschichtete Schale haften. Sammeln Sie nicht haft hES mit einer 1 ml-Pipette in ein frisches 15 ml-Zentrifugenröhrchen und bestimmen die Zelldichte mit einer Zählkammer. </li></ol> 3. Elektroporation von hES <ol><li> Filter CM-MEF Medien mit einem 0,22 um Filter hinzuzufügen und 10 ng / ml rekombinanten humanen Fibroblasten-Wachstumsfaktor 2 (rhFGF2). </li><li> 7,5 x 106 übertragen hES aus Abschnitt 2.9 zu einem neuen 15 ml konischen Röhrchen und Zentrifuge bei 160 xg für 5 min. </li><li> Während dieser Zeit die Elektroporator gesetzt: Wählen Sie das Programm für die exponentielle electroporation und stellen Sie die folgenden Parameter, Spannung: 250 V, Kapazität: 500 uF, und Widerstand: ∞-. </li><li> Saugen Sie den Überstand und resuspendieren Zellpellet in 0,8 ml eiskaltem HBSS 0,22 um filtriert. Die Lösung wird in einer sterilen 0,4 cm Elektroporationsküvette. </li><li> TV-fügen hPITX3-Forward-Targeting-Konstrukt (30 ug DNA) und vorsichtig mit einer Pipette 200 ul. Inkubieren auf Eis für 5 min. Während dieser Zeit entfernen Sie eine aliquote Menge PITX3 ZFN mRNA und auf Eis auftauen. Wenn in Elektroporationsküvette taut Transfer 7,5 ul der ZFN-mRNA, DNA / Zellgemisch. Vorsichtig mischen mit 200 ul Pipette. Anmerkung: Die Ortskurve abgezielt ist der wichtigste Faktor, um Targeting Effizienz beiträgt. Loci Codierung stille Gene, Gene nicht in WSR ausgedrückt, wie PITX3 sind schwer zu zielen mit herkömmlichen homologe Rekombination 6. So nutzt dieses Protokoll speziell für das menschliche PITX3 Ort konzipiert ZFNs einen DNA-Doppelstrang b induzierenreak. </li><li> Elektroporieren, indem Sie die Anweisungen auf dem Bildschirm auf der Elektroporator. </li><li> Mit einem 200 ul Pipette übertragen Sie die Inhalte aus der Elektroporationsküvette zu einem 15-ml-Tube mit 10 ml HES-Medien. Zweimal waschen Sie die Küvette mit 200 ul hESC Medien jedes Mal und in ein 15-ml-Tube. Es wird &quot;Schleim-wie&quot; Schutt, bestehend aus DNA und Protein aus den lysierten Zellen, die sich negativ auf die Zellüberlebens. Zentrifuge bei 160 × g für 5 min auf diese Ablagerungen zu entfernen. </li><li> Saugen Sie den Überstand und klopfen Sie leicht Zellpellet zu lockern. Re-suspend in 30 ml ergänzt MEF-CM mit 10 uM Y-27632 und Ausstrich auf 3 x 100 mm Gerichte mit MEFs vorplattiert. </li><li> Ändern Sie die Medien täglich. An Tag 2, Y-27632 entnommen und in Zellen nur HES Medien gezüchtet. </li><li> Nach 2-3 Tagen werden die HES-Zellen sollten 50-70% konfluent sein. An diesem Punkt beginnen Antibiotika-Selektion (zB 0,5 g / ml Puromycin). </li><li> Pflegen selReflexion durch Zugabe von frischem hESC / Puromycin Medien täglich. Nach ~ 7 Tage sollten kleine Kolonien sichtbar sein. Wenn Antibiotika resistenten MEFs nicht verwendet werden, können MEFs durch Hinzufügen eines zusätzlichen 1,0 x 10 4 Zellen pro cm 2 ergänzt werden. </li></ol> 4. Heben Transgene hESC Clones <ol><li> Ca. 14 - 21 Tage nach Auswahl (wenn Kolonien ~ 1 mm Durchmesser erreicht) vorzubereiten Platten für Expansion und Screening. Beginnen durch Auftauen eines Aliquots von Matrigel oder Geltrex bei 4 ° C für mindestens 5 Stunden. Verdünnen nach den Anweisungen des Herstellers, und fügen Sie 75 ul in jede Vertiefung der 3 x 96-Well-Platten. Vorbereitung 3 x 48-Well-Platten durch Plattieren MEFs auf 2,0 x 10 4 Zellen pro cm 2. Beide Platten O / N bei 37 ° C / 5% CO 2. </li><li> Am folgenden Tag sezieren Kolonien in 16-25 Stücke unter Verwendung einer 21 G-Nadel am Ende einer 2-ml-Pipette, indem ein Raster. </li><li> Absaugen Matrigel von 96-Well-Platten und ersetzen mit Nachtrtierten CM-MEF Medien. Wasch MEFs in 48-Well-Platten 1 x mit HBSS und fügen hESC Medien. </li><li> Mit einer 200 ul Pipette vorsichtig übertragen 3.1 des seziert Kolonie in eine 48-Well-Platte für die Expansion. Übertragen die anderen zwei Drittel der Kolonie präpariert in eine entsprechende 96-Well-Platte, die ergänzt CM-MEF Medien. </li><li> Halten beide Platten durch Veränderung der Medien täglich (ergänzt CM-MEF Medien für 96-Well-Platten und Matrigel beschichtet hESC Medien für 48-Well-Platten, die MEFs, beide mit 0,5 g / ml Puromycin ergänzt). </li><li> Erweitern bis 96-Well-Platten zu 100% konfluent und dann zunächst mittels PCR zu screenen. </li></ol> 5. Screening und Ausbau von positiven Klonen <ol><li> Zur Vorbereitung der genomischen DNA (Methode basierend auf 11) entfernen Sie alle Medien aus Platten durch Umdrehen, dann auf Küchenpapier tupfen. </li><li> Spülen Sie jede Vertiefung zweimal mit RT PBS (100 ul / jeder Wäsche), umdrehen und Blot wie für Schritt 5.1. Ort Platten bei -80 ° C foder 1-2 Stunden in Zell-Lyse zu unterstützen (kann auf unbestimmte Zeit Platten wie diese gespeichert werden). </li><li> Während Zellen bei -80 ° C machen Sarcosyl Lysepuffer (siehe Tabelle 4) (50 ul / Vertiefung). Um Zellen, warme Platten Lyse für 5 min bei RT dann Pipette Lyse-Puffer in jedes Well. Die Ränder jeder Platte mit Band, in einen dicht verschließbaren Behälter mit feuchten Papiertüchern Luftfeuchtigkeit zu schaffen, und Inkubation O / N bei 60 ° C. </li><li> Nach Inkubation mit 150 ul 5 M NaCl auf 10 ml von -20 ° C absolutem Ethanol, gut mischen und mit 100 ul in jede Vertiefung (Hinweis: Ethanol gehen bewölkt wenn NaCl hinzugefügt). Tippen Platten sanft zu mischen (nicht Pipette) und lassen für mindestens 30 min bei RT. Während dieser Zeit wird die Lösung gehen klar und die DNA auszufällen. </li><li> Entfernen Lösung, wie in Schritt 5.1, dann mit 150 ul 70% igem Ethanol zu jeder Vertiefung. Invertieren Platte sanft und tupfen Sie wie zuvor. Wiederholen Sie diesen Schritt eine weitere 2x. Hinweis: Da das ausgefallene DNA natürlich Adheres auf die Gewebekultur Kunststoff es wird nicht bei diesen Waschschritten verrutschen.) </li><li> Nach dem letzten Waschen kurz zentrifugieren Platten mit höchster Geschwindigkeit die DNA auf den Boden jeder Vertiefung dann luftgetrocknet bei Raumtemperatur (oder 37 ° C) für mindestens 30 Minuten zu konzentrieren. </li><li> Fügen 40-50 ul T0.1E (pH 8,0) (siehe Tabelle 5) oder TE (pH 8,0) in jede Vertiefung und Ort Platten bei 65 ° C für 1 h oder bei 4 ° CO / N vor der Verwendung für die PCR. Resuspendieren DNA durch leichtes Antippen der Seiten der Platte. Verwenden Sie 1-2 ul resuspendierten DNA / 10 ul PCR-Reaktion. </li><li> Verwendung des Expand Long Template PCR System mit hPITX3 L Arm gen. F und L hPITX3 Arm GFP R Primer durchzuführen erste Screening der Klone bei 58 ° C Annealing, 45 sec Verlängerung, 35 Zyklen. </li><li> Elektrophorese-Proben mit Hyperladder 1kb in einem 1% Agarose-Gel, das bei 100 V für 45 min GelRed und Erkennung von positiven Klonen durch UV-Beleuchtung. </li><li> Validieren PCR positiven Klone durch Verdauen von genomischer DNA aus EXPANDED Klonen (siehe unten) mit HindIII und Hybridisierungssonden 5 &#39;und 3&#39; der Vektor Homologiearme auf einem Southern-Blot (wie zuvor in 1 beschrieben). Sonden durch PCR unter Verwendung von Primerpaaren hPITX3 5&#39;-Sonde F und R, und hPITX3 3 &#39;Sonde F und R, mit EcoRI verdaut und in einem allgemeinen Klonierungsvektor ligiert. </li><li> Abhängig von der Anzahl von positiven Klonen, Herstellung von 2 Vertiefungen einer Platte mit 6 Vertiefungen von Vor-Galvanisieren mit MEFs (2,0 x 10 4 Zellen pro cm 2). </li><li> Am nächsten Tag vorzubehandeln positive Klone im 48-Well-Platte mit 10 uM Y-27632 für mindestens 1 Stunde. </li><li> Waschen positive Klone mit HBSS und 300 ul Accutase. </li><li> Wenn Kolonien werden einzelne Zellen gemacht, 1 ml der hESC Medien und sammeln in einen 15-ml-Tube. </li><li> Ändern Sie die Medien täglich. An Tag 2, Y-27632 entnommen und in Zellen HES Medien gezüchtet. </li><li> Wenn Kolonien sind 70-80% konfluent, Subkultur und frieren den Rest der Colony Fragmente. </li></ol>

<ol>
	<li>Nefzger, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lmx1a+Allows+Context-Specific+Isolation+of+Progenitors+of+GABAergic+or+Dopaminergic+Neurons+During+Neural+Differentiation+of+Embryonic+Stem+Cells.">Lmx1a Allows Context-Specific Isolation of Progenitors of GABAergic or Dopaminergic Neurons During Neural Differentiation of Embryonic Stem Cells.</a> Stem Cells. 30 (7), 1349-1361 (2012).</li><li>Zeng, W. R., Fabb, S. R. A., Haynes, J. M., Pouton, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extended+periods+of+neural+induction+and+propagation+of+embryonic+stem+cell-derived+neural+progenitors+with+EGF+and+FGF2+enhances+Lmx1a+expression+and+neurogenic+potential.">Extended periods of neural induction and propagation of embryonic stem cell-derived neural progenitors with EGF and FGF2 enhances Lmx1a expression and neurogenic potential.</a> Neurochemistry International. 59 (3), 394-403 (2011).</li><li>Collin, J., Lako, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concise+review:+putting+a+finger+on+stem+cell+biology:+zinc+finger+nuclease-driven+targeted+genetic+editing+in+human+embryonic+stem+cells.">Concise review: putting a finger on stem cell biology: zinc finger nuclease-driven targeted genetic editing in human embryonic stem cells.</a> Stem Cells. 29 (7), 1021-1033 (2011).</li><li>Carroll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progress+and+prospects:+zinc-finger+nucleases+as+gene+therapy+agents.">Progress and prospects: zinc-finger nucleases as gene therapy agents.</a> Gene Therapy. 15 (22), 1463-1468 (2008).</li><li>Urnov, F. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+endogenous+human+gene+correction+using+designed+zinc-finger+nucleases.">Highly efficient endogenous human gene correction using designed zinc-finger nucleases.</a> Nature. 435 (7042), 646-651 (2005).</li><li>Hockemeyer, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+targeting+of+expressed+and+silent+genes+in+human+ESCs+and+iESCs+using+zinc-finger+nucleases.">Efficient targeting of expressed and silent genes in human ESCs and iESCs using zinc-finger nucleases.</a> Nature Biotechnology. 27 (9), 851-857 (2009).</li><li>Lombardo, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+editing+in+human+stem+cells+using+zinc+finger+nucleases+and+integrase-defective+lentiviral+vector+delivery.">Gene editing in human stem cells using zinc finger nucleases and integrase-defective lentiviral vector delivery.</a> Nature Biotechnology. 25 (11), (2007).</li><li>Boch, J., Bonas, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xanthomonas+AvrBs3+family-type+III+effectors:+discovery+and+function.">Xanthomonas AvrBs3 family-type III effectors: discovery and function.</a> Annual Review of Phytopathology. 48, 419-436 (2010).</li><li>Hockemeyer, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+engineering+of+human+embryonic+cells+using+TALE+nucleases.">Genetic engineering of human embryonic cells using TALE nucleases.</a> Nature Biotechnology. 29 (8), 731-734 (2011).</li><li>Tucker, K. L., Wang, Y., Dausman, J., Jaenisch, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transgenic+mouse+strain+expressing+four+drug-selectable+marker+genes.">A transgenic mouse strain expressing four drug-selectable marker genes.</a> Nucleic Acids Research. 25 (18), 3745-3746 (1997).</li><li>Ram&#237;rez-Solis, R., Rivera-P&#233;rez, J., Wallace, J. D., Wims, M., Zheng, H., Bradley, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+DNA+microextraction:+a+method+to+screen+numerous+samples.">Genomic DNA microextraction: a method to screen numerous samples.</a> Analytical Biochemistry. 201 (2), 331-335 (1992).</li><li>Kawasaki, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+midbrain+dopaminergic+neurons+from+ES+cells+by+stromal+cell-derived+inducing+activity.">Induction of midbrain dopaminergic neurons from ES cells by stromal cell-derived inducing activity.</a> Neuron. 28 (1), 31-40 (2000).</li><li>Denham, M., Thompson, L. H., Leung, J., P&#233;bay, A., Bj&#246;rklund, A., Dottori, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gli1+is+an+inducing+factor+in+generating+floor+plate+progenitor+cells+from+human+embryonic+stem+cells.">Gli1 is an inducing factor in generating floor plate progenitor cells from human embryonic stem cells.</a> Stem Cells. 28 (10), 1805-1815 (2010).</li><li>Smidt, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+homeodomain+gene+Ptx3+has+highly+restricted+brain+expression+in+mesencephalic+dopaminergic+neurons.">A homeodomain gene Ptx3 has highly restricted brain expression in mesencephalic dopaminergic neurons.</a> Proceedings of the National Academy of Sciences U.S.A. 94, 13305-13310 (1997).</li></ol>

Die Autoren haben nichts zu offenbaren.

Die Erzeugung von Reporterzelllinien bietet ein leistungsfähiges Mittel zu verfolgen, zu visualisieren und zu isolieren Zellen von Interesse aus einer heterogenen Population von hES-Zellen abgeleitet. Allerdings Gen-Targeting über herkömmliche homologe Rekombination hat sich als äußerst ineffizient für den menschlichen WSR 3 zu sein. In diesem Protokoll beschreiben wir eine relativ einfache Technik für die Einführung eines RP in Exon eines der PITX3 Ort, in hES-Zellen mittels eines allgemein ...

Strom embryonalen Stammzellen (ESC) Differenzierungsprotokollen führen in heterogenen Zellpopulationen, insbesondere hinsichtlich der Ableitung von spezifischen neuronalen Phänotypen. Obwohl Kulturen enthalten die gewünschte Mobil Phänotyp, andere neuronale, sind nicht-neuronalen und un-differenzierten Zelltypen häufig vorhanden 1. Diese Eigenschaften beschränken die Anwendung der ESC abgeleiteten Zellquellen für Zellersatztherapie und in vitro-Krankheitsmodelle. Genetische Reporterzelllinien bieten ein Mittel, um zu visualisieren, zu verfolgen und zu isolieren Zellen von Interesse, vorausgesetzt, dass die Expression des Reporterproteins (RP) reproduziert endogene Expression. Verwendung von Promotoren, die unmittelbar stromaufwärts von einem Gen kodierende Region kann verwendet werden, um rohe genetische Reporter abgeleitet werden, sondern solche Konstrukte fehlen die genaue regulatorische Elemente, die endogene Genexpression zu steuern. Im Gegensatz dazu bietet der homologen RekombinationMöglichkeit, High-Fidelity-Expression des RP zu gewährleisten. In der Vergangenheit Targeting-Vektoren für die homologe Rekombination an bestimmten Loci von Interesse entworfen wurden zur RPs in Maus WSR (mESCs) Ziel unter Verwendung von Elektroporation als Mittel zur DNA-Abgabe 1,2. Doch die Generation der Reporterzelllinien über herkömmliche homologen Rekombination ist extrem ineffizient für den menschlichen WSR (hES-Zellen) und damit nur in einer Handvoll von Fällen (3 Bewertung) dokumentiert. Durch die Verwendung eines manipulierten chimären Protein, das eine Fusion eines FokI Nukleaseaktivität mit ortsspezifischen Zinkfingermotiven, die zusammen als Zinkfinger-Nucleasen (ZFNs) bekannt ist, DNA-Doppelstrangbrüche können an vorbestimmten Loci eingeführt werden. Wenn ein DNA-Vektor mit Homologie zu beiden Seiten des DNA-Doppelstrangbruch zugesetzt wird, kann die genomische Stelle durch homologe Rekombination repariert werden, so dass der Einbau der DNA-Donor-Sequenz. Diese Technik hat sich als nützlich erwiesen foder genomische Bearbeitung sowohl in primären humanen Zellen 4,5 und 6,7 HES. Neuere Arbeiten genutzt hat Transkriptionsaktivator-wie Effektor Nukleasen (Talens), Transkriptionsfaktoren durch Pflanzenpathogene verwendet 8, bei der Gestaltung von standortspezifischen Nukleasen 9 unterstützen. In dem folgenden Protokoll zeigen wir die Erzeugung einer HES-Reporterzelllinie durch Elektroporation eines EGFP enthaltende homologe Zielvektor 6 zusammen mit ZFNs der menschlichen Hypophysen-Homeobox-3 (PITX3) Locus. Nach Antibiotika-Selektion für 2-3 Wochen kann mit hES richtig integriert DNA manuell abgeholt werden, erweitert und gesiebt zunächst über PCR und anschließend durch Southern Blotting validiert.

<table border="0" cellpadding="0" cellspacing="0" width="883">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Mouse Embryonic Fibroblasts (DR4)</td>
			<td style="width:207px;">GlobalStem</td>
			<td style="width:119px;">GSC-6004G</td>
			<td style="width:67px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gelatin</td>
			<td style="width:207px;">Sigma</td>
			<td style="width:119px;">G1393-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">HBSS, no Calcium, no Magnesium, no Phenol Red (HBSS)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">14175-095</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dispase</td>
			<td style="width:207px;">StemCell Technologies</td>
			<td style="width:119px;">7923</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Cell Scraper</td>
			<td style="width:207px;">Corning</td>
			<td style="width:119px;">3008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Accutase</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">A11105-01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Y27632</td>
			<td style="width:207px;">Axon Medchem</td>
			<td style="width:119px;">Axon 1683</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer - 40um</td>
			<td>BD Biosciences</td>
			<td>352340</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">33mm - 0.22 um filter</td>
			<td style="width:207px;">Millipore</td>
			<td style="width:119px;">SLGP033RS</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">rhFGF2</td>
			<td style="width:207px;">R&#38;D Systems</td>
			<td>233-FB-025/CF</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Electroporator</td>
			<td style="width:207px;">BioRad</td>
			<td style="width:119px;">165-2661</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">0.4cm electroporation cuvette</td>
			<td style="width:207px;">BioRad</td>
			<td style="width:119px;">165-2088</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Human TV-hPITX3-forward targeting construct</td>
			<td style="width:207px;">Addgene</td>
			<td style="width:119px;">31942</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:491px;">ZFN Kit; Human PITX3</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td style="width:119px;">CKOZFN1050-1KT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Puromycin</td>
			<td style="width:207px;">Invivogen</td>
			<td style="width:119px;">ant-pr-1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Matrigel</td>
			<td style="width:207px;">BD Biosciences</td>
			<td>354277</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Geltrex</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">A1569601</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">NaCl</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td>S3014</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td style="width:207px;">Life Technologies</td>
			<td>10566-016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Fetal Bovine Serum, Qualified, Heat Inactivated, US Origin (FBS)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">16140-071</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Pen/Strep</td>
			<td style="width:207px;">Life Technologies</td>
			<td>15070-063</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dulbecco&#39;s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">11320-033</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">KnockOut Serum Replacement (KSR)</td>
			<td style="width:207px;">Life Technologies</td>
			<td>10828-028</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">MEM Non-Essential Amino Acids&#160; (NEAA)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">11140-050</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">GlutaMAX</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">35050-061</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">&#223;-mercaptoethanol</td>
			<td style="width:207px;">Life Technologies</td>
			<td>21985-023</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">N-Lauroylsarcosine sodium salt solution (Sarcosyl) (30%)</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td style="width:119px;">61747</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">EDTA</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td><a href="http://www.sigmaaldrich.com/catalog/product/sial/e9884?lang=en&amp;region=US">E9884</a></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Trizma Hydrochloride</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td>T3253</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Proteinase K solution (20mg/ml)</td>
			<td style="width:207px;">Bioline Australia</td>
			<td>BIO-37084</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Expand Long Template PCR System</td>
			<td style="width:207px;">Roche Australia</td>
			<td style="width:119px;">11681834001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">hPITX3 L arm gen. F (primer): 5&#8217; TGTCCTAAGGAGAATGGGTAACAGACA 3&#8217;</td>
			<td style="width:207px;">GeneWorks, Australia</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:491px;">hPITX3 L arm GFP R (primer): 5&#8217; ACACGCTGAACTTGTGGCCGTTTA 3&#8217;</td>
			<td style="width:207px;">GeneWorks, Australia</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">HyperLadder 1kb&#160;</td>
			<td style="width:207px;">Bioline Australia</td>
			<td>BIO-33025</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:491px;">GelRed</td>
			<td style="width:207px;">Jomar Bioscience, Australia</td>
			<td style="width:119px;">41003</td>
			<td></td>
		</tr>
	</tbody>
</table>

zinc-finger nuclease enhanced gene targeting in human embryonic stem cells

Eine große Einschränkung mit den aktuellen menschlichen embryonalen Stammzellen (ESC) Differenzierungsprotokollen ist die Erzeugung von heterogenen Zellpopulationen. Diese Kulturen enthalten die Zellen von Interesse, sondern auch mit undifferenzierten WSR nichtneuralen Derivaten und anderen neuronalen Subtypen verunreinigt. Dies beschränkt ihre Verwendung in in vitro-und in vivo-Anwendungen, beispielsweise in vitro-Modellierung für die Arzneimittelentdeckung oder Zellersatztherapie. Zur Überwindung dieser, Reporterzelllinien, die ein Mittel zur Visualisierung, zu verfolgen und zu isolieren Zellen von Interesse anbieten, können entwickelt werden. Um dies jedoch in menschlichen embryonalen Stammzellen zu erreichen über konventionellen homologen Rekombination ist äußerst ineffizient. Dieses Protokoll beschreibt Targeting der Hypophyse Homöobox 3 (PITX3) Locus in menschlichen embryonalen Stammzellen mit maßgeschneiderten Zink-Finger-Nukleasen, die ortsspezifische DNA-Doppelstrangbrüche vorstellen, zusammen mit einemPITX3 - EGFP-spezifischen DNA-Donor-Vektor. Nach der Erzeugung des PITX3 Reporterzelllinie kann dann unter Verwendung veröffentlichter Protokolle für die Verwendung in Studien unterschieden werden, wie in vitro-Parkinson-Krankheit Modellierung oder Zellersatztherapie.

Nach Co-Elektroporation von dem individuell gestalteten PITX3 Zinkfinger-Paar zusammen mit der PITX3 - EGFP-spezifischen DNA-Donor-Vektor und anschließende Puromycin Selektion wurden positive Klone hESC zunächst über genomische PCR-Screening (Abbildung 1) nachgewiesen. Southern-Blot-Hybridisierung dieser PCR-positiven Klone mit 5 &#39;und 3&#39; spezifischen Sonden bestätigt korrekte Ausrichtung zu Exon 1 des PITX3 Locus (Abbildung 2), mit einem W...

Watch this Scientific Journal Video about Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells at JoVE.com

Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

Reporterzelllinien bieten ein Mittel, um zu visualisieren, zu verfolgen und zu isolieren Zellen von Interesse aus heterogenen Populationen. Jedoch Gen-Targeting unter Verwendung von herkömmlichen homologen Rekombination in embryonalen Stammzellen äußerst ineffizient. Hier beschreiben wir Targeting ZNS Mittelhirn spezifischen Transkriptionsfaktor PITX3 Ortes mit EGFP mit Zink-Finger-Nuklease verbesserte homologe Rekombination.

Zinkfinger-Nuklease Verbesserte Gene Targeting in humanen embryonalen Stammzellen

One major limitation with current human embryonic stem cell (ESC) differentiation protocols is the generation of heterogeneous cell ...

zinc-finger-nuclease-enhanced-gene-targeting-human-embryonic-stem

Research

JoVE Journal

Biology

10.7K Aufrufe.  Monash University.  Reporterzelllinien bieten ein Mittel, um zu visualisieren, zu verfolgen und zu isolieren Zellen von Interesse aus heterogenen Populationen. Jedoch Gen-Targeting unter Verwendung von herkömmlichen homologen Rekombination in embryonalen Stammzellen äußerst ineffizient. Hier beschreiben wir Targeting ZNS Mittelhirn spezifischen Transkriptionsfaktor PITX3 Ortes mit EGFP mit Zink-Finger-Nuklease verbesserte homologe Rekombination. 

Serie: Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

Propagation of Human Embryonic Stem (ES) Cells

Propagation of Human Embryonic Stem ES Cells

Vermehrung von humanen embryonalen Stammzellen (ES-Zellen)

Forschung

Biologie

Derivation of Human Embryonic Stem Cells by Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass. 


The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass.

Gewinnung menschlicher embryonaler Stammzellen durch Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both ...

Probing for Mitochondrial Complex Activity in Human Embryonic Stem Cells

Mitochondria are cytoplasmic organelles that have a primary role in cellular metabolism and homeostasis, regulation of the cell signaling network, and programmed cell death. Mitochondria produce ATP, regulate the cytoplasmic redox state and Ca2+ balance, catabolize fatty acids, synthesize heme, nucleotides, steroid hormones, amino acids, and help assemble iron-sulfur clusters in proteins. Mitochondria also have an essential role in heat production. Mutations of the mitochondrial genome cause several types of human disorder. The accumulation of mtDNA mutations correlates with aging and is suspected to have an important role in the development of cancer. Due to their vitally important role in all cell types, the function of mitochondria must also be critical for stem cells. Key advances have been made in our understanding of stem cell viability, proliferation, and differentiation capacity. But the functional activity of stem cells, in particular their energy status, was not yet been studied in detail. Almost nothing is known about the mitochondrial properties of human embryonic stem cells (hESCs) and their differentiated precursor progeny. One way to understand and evaluate the role of mitochondria in hESC function and developmental potential is to directly measure the activity of mitochondrial respiratory complexes. Here, we describe high resolution clear native gel electrophoresis and subsequent in gel activity visualization as a method for analyzing the five respiratory chain complexes of hESCs.

In this video, we will show you how the mitochondrial respiratory chain complexes of human embryonic stem cells can be analyzed using in gel activity assays.

Probing für Mitochondriale komplexe Aktivität in humanen embryonalen Stammzellen

Mitochondria are cytoplasmic organelles that have a primary role in cellular metabolism and homeostasis, regulation of the cell signaling network, and ...

In vitro and in vivo Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cells

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative medicine. However, direct injection of hESCs, and cells differentiated from hESCs, into living organisms has thus far been hampered by significant cell death, teratoma formation, and host immune rejection. Understanding the in vivo hESC behavior after transplantation requires novel imaging techniques to longitudinally monitor hESC localization, proliferation, and viability. Molecular imaging has given investigators a high-throughput, inexpensive, and sensitive means for tracking in vivo cell proliferation over days, weeks, and even months. This advancement has significantly increased the understanding of the spatio-temporal kinetics of hESC engraftment, proliferation, and teratoma-formation in living subjects.

A major advance in molecular imaging has been the extension of noninvasive reporter gene assays from molecular and cellular biology into in vivo multi-modality imaging platforms. These reporter genes, under control of engineered promoters and enhancers that take advantage of the host cell s transcriptional machinery, are introduced into cells using a variety of vector and non-vector methods. Once in the cell, reporter genes can be transcribed either constitutively or only under specific biological or cellular conditions, depending on the type of promoter used. Transcription and translation of reporter genes into bioactive proteins is then detected with sensitive, noninvasive instrumentation (e.g., CCD cameras) using signal-generating probes such as D-luciferin.

To avoid the need for excitatory light to track stem cells in vivo as is required for fluorescence imaging, bioluminescence reporter gene imaging systems require only an exogenously administered probe to induce light emission. Firefly luciferase, derived from the firefly Photinus pyralis, encodes an enzyme that catalyzes D-luciferin to the optically active metabolite, oxyluciferin. Optical activity can then be monitored with an external CCD camera. Stably transduced cells that carry the reporter construct within their chromosomal DNA will pass the reporter construct DNA to daughter cells, allowing for longitudinal monitoring of hESC survival and proliferation in vivo. Furthermore, because expression of the reporter gene product is required for signal generation, only viable parent and daughter cells will create bioluminescence signal; apoptotic or dead cells will not. 

In this video, the specific materials and methods needed for tracking stem cell proliferation and teratoma formation with bioluminescence imaging will be described.

With the growing interest in stem cell therapies, molecular imaging techniques are ideal for monitoring stem cell behavior after transplantation. Luciferase reporter genes have enabled non-invasive, repetitive assessment of cell survival, location, and proliferation in vivo. This video will demonstrate how to track hESC proliferation in a living mouse.

In vitro und in vivo Biolumineszenz Reporter Gene Imaging von humanen embryonalen Stammzellen

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative ...

Chromatin Immunoprecipitation from Human Embryonic Stem Cells

The functional and structural complexity of the myriad of cells in metazoan organisms arises from a small number of stem cells. Stem cells are characterized by two fundamental properties: self-renewal and multipotency that allows a stem cell to differentiate into virtually any cell type 1. The progression stem cell to differentiated cell is characterized by loss of multipotency, structural and morphological changes and the hierarchic activity of transcription factors and signaling molecules, whose activities establish and maintain cell-type specific gene expression patterns. At the molecular level, cell differentiation involves dynamic changes of the structure and composition of chromatin and the detection of those dynamic changes can provide valuable insights into the functional features of stem cells and the cell differentiation process 2,3. Chromatin is a highly compacted DNA-protein complex that forms when cells package chromosomal DNA with proteins, mainly histones 4. Stemcellness and cell differentiation has been correlated with the presence of specific arrays of regulatory proteins such as epigenetic factors, histone variants, and transcription factors 2,3,5.
 Chromatin immunoprecipitation (ChIP) provides a valuable method to monitor the presence of RNA, proteins, and protein modifications in chromatin 6,7. The comparison of chromatin from different cell types can elucidate dynamic changes in protein-chromatin associations that occur during cell differentiation.
Chromatin immunoprecipitation involves the purification of in vivo cross-linked chromatin. The isolated chromatin is reduced to smaller fragments by enzymatic digestion or mechanical force. Chromatin fragments are precipitated using specific antibodies to target proteins or protein and DNA modifications. The precipitated DNA or RNA is purified and used as a template for PCR or DNA microarray based assays. Prerequisites for a successful ChIP are high quality antibodies to the desired antigen and the availability of chromatin from control cells that do not express the target molecule. ChIP can correlate the presence of proteins, protein and RNA modifications, and RNA with specific target DNA, and depending on the choice of outread tool, detects the association of target molecules at specific target genes or in the context of an entire genome. The comparison of the distribution of proteins in the chromatin of differentiating cells can elucidate the dynamic changes of chromatin composition that coincide with the progression of cells along a cell lineage.

The differentiation of ESC coincides with cell-type specific changes in the structure and composition of chromatin. The detection of those changes provides valuable insights into the mechanisms that define stemcellness and cell differentiation. Chromatin immunoprecipitation (ChIP) represents a valuable method to dissect the molecular mechanisms underlying stem cell differentiation.

Chromatin Immunopräzipitation von humanen embryonalen Stammzellen

The functional and structural complexity of the myriad of cells in metazoan organisms arises from a small number of stem cells. Stem cells are ...

In vitro Labeling of Human Embryonic Stem Cells for Magnetic Resonance Imaging

Human embryonic stem cells (hESC) have demonstrated the ability to restore the injured myocardium. Magnetic resonance imaging (MRI) has emerged as one of the predominant imaging modalities to assess the restoration of the injured myocardium. Furthermore, ex-vivo labeling agents, such as iron-oxide nanoparticles, have been employed to track and localize the transplanted stem cells. However, this method does not monitor a fundamental cellular biology property regarding the viability of transplanted cells. It has been known that manganese chloride (MnCl2) enters the cells via voltage-gated calcium (Ca2+) channels when the cells are biologically active, and accumulates intracellularly to generate T1 shortening effect. Therefore, we suggest that manganese-guided MRI can be useful to monitor cell viability after the transplantation of hESC into the myocardium.
In this video, we will show how to label hESC with MnCl2 and how those cells can be clearly seen by using MRI in vitro. At the same time, biological activity of Ca2+-channels will be modulated utilizing both Ca2+-channel agonist and antagonist to evaluate concomitant signal changes.

In this video, we are showing how to label human embryonic stem cells (hESC) with manganese chloride (MnCl2) which can enter cells via voltage-gated calcium channels when the cells are biologically active. Additionally, we show the use of MnCl2 as cellular MRI contrast agent to determine the in vitro viability of hESC.

In-vitro-Markierung von humanen embryonalen Stammzellen für Magnetic Resonance Imaging

Human embryonic stem cells (hESC) have demonstrated the ability to restore the injured myocardium. Magnetic resonance imaging (MRI) has emerged as one of ...

Culture and Maintenance of Human Embryonic Stem Cells  

Human embryonic stem (hES) cells must be monitored and cared for in order to maintain healthy, undifferentiated cultures. At minimum, the cultures must be  fed  every day by performing a complete medium change to replenish lost nutrients and to keep the cultures free of unwanted differentiation factors. Although a small amount of differentiation is normal and expected in stem cell cultures, the culture should be routinely cleaned up by manually removing, or "picking" differentiated areas. Identifying and removing excess differentiation from hES cell cultures are essential techniques in the maintenance of a healthy population of cells.

Culture and Maintenance of Human Embryonic Stem Cells

This protocol demonstrates how to maintain healthy, undifferentiated human embryonic stem (ES) cells.

Kultur und Wartung von humanen embryonalen Stammzellen

Human embryonic stem (hES) cells must be monitored and cared for in order to maintain healthy, undifferentiated cultures. At minimum, the cultures must be ...

Freezing and Thawing Human Embryonic Stem Cells

Since James Thomson et al developed a technique in 1998 to isolate and grow hES in culture, freezing cells for later use and thawing and expanding cells from a frozen stock have become important procedures performed in routine hES cell culture. Since hES cells are very sensitive to the stresses of freezing and thawing, special care must taken. Here we demonstrate the proper technique for rapidly thawing hES cells from liquid nitrogen stocks, plating them on mouse embryonic feeder cells, and slowly freezing them for long-term storage.

Since James Thomson et al developed a technique in 1998 to isolate and grow hES in culture, freezing cells for later use and thawing and expanding cells from a frozen stock have become important procedures performed in routine hES cell culture. Since hES cells are very sensitive to the stresses of freezing and thawing, special care must taken. Here we demonstrate the proper technique for rapidly thawing hES cells from liquid nitrogen stocks, plating them on mouse embryonic feeder cells, and slowly freezing them for long-term storage.

Einfrieren und Auftauen humanen embryonalen Stammzellen

Since James Thomson et al developed a technique in 1998 to isolate and grow hES in culture, freezing cells for later use and thawing and expanding cells ...

Differentiation of Embryonic Stem Cells into Oligodendrocyte Precursors

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant interest in deriving a pure population of lineage-committed oligodendrocyte precursor cells (OPCs) for transplantation. OPCs are characterized by the activity of the transcription factor Olig2 and surface expression of a proteoglycan NG2. Using the GFP-Olig2 (G-Olig2) mouse embryonic stem cell (mESC) reporter line, we optimized conditions for the differentiation of mESCs into GFP+Olig2+NG2+ OPCs. In our protocol, we first describe the generation of embryoid bodies (EBs) from mESCs. Second, we describe treatment of mESC-derived EBs with small molecules: (1) retinoic acid (RA) and (2) a sonic hedgehog (Shh) agonist purmorphamine (Pur) under defined culture conditions to direct EB differentiation into the oligodendroglial lineage. By this approach, OPCs can be obtained with high efficiency (&gt;80%) in a time period of 30 days. Cells derived from mESCs in this protocol are phenotypically similar to OPCs derived from primary tissue culture. The mESC-derived OPCs do not show the spiking property described for a subpopulation of brain OPCs in situ. To study this electrophysiological property, we describe the generation of spiking mESC-derived OPCs by ectopically expressing NaV1.2 subunit. The spiking and nonspiking cells obtained from this protocol will help advance functional studies on the two subpopulations of OPCs.

We describe a small molecule-based protocol for differentiation of mouse embryonic stem cells into oligodendrocyte precursor cells (OPCs). This protocol generates Olig2+NG2+ OPCs with high efficiency by 30 days of differentiation. We also describe a method to generate "spiking" OPCs that can fire action potentials.

Differenzierung von embryonalen Stammzellen in Oligodendrozyten Precursors

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant ...

Fate Mapping of Human Embryonic Stem Cells by Teratoma Formation

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three embryonic germ layers (1). Directed differentiation of hESCs into specific cell types has generated much interest in the field of regenerative medicine (e.g., (2-5)), and methods for determining the in vivo fate of selected or manipulated hESCs are essential to this endeavor. We have adapted a highly efficient teratoma formation assay for this purpose. A small number of specifically selected hESCs is mixed with undifferentiated wild type hESCs and Phaseolus vulgaris lectin to form a cell pellet. This is grafted beneath the kidney capsule in an immunodeficient mouse. As few as 2.5 x 105 hESCs are needed to form a 16 cm3 teratoma within 8-12 weeks. The fate of the originally selected hESCs can then be determined by immunohistochemistry. This method provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

Directed differentiation of hESCs into specific cells has generated much interest in regenerative medicine. We provide a concise, step-by-step protocol for determining the in vivo fate of selected hESCs that provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.