Wir möchten Monika Tarnowska, Cornelia Albrecht, und Ewa Skoczylas für hervorragende technische Unterstützung danken. Diese Studie wurde vom SNF Sinergia Zuschuss CRSI33-125073 PP finanziert.

<ol>
	<li>Capecchi, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+in+mice:+functional+analysis+of+the+mammalian+genome+for+the+twenty-first+century.">Gene targeting in mice: functional analysis of the mammalian genome for the twenty-first century.</a> Nat. Rev. Genetics. 6, 507-512 (2005).</li><li>Johansson, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Building+a+zoo+of+mice+for+genetic+analyses:+a+comprehensive+protocol+for+the+rapid+generation+of+BAC+transgenic+mice.">Building a zoo of mice for genetic analyses: a comprehensive protocol for the rapid generation of BAC transgenic mice.</a> Genesis. 48, 264-280 (2010).</li><li>Skarnes, W. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conditional+knockout+resource+for+the+genome-wide+study+of+mouse+gene+function.">A conditional knockout resource for the genome-wide study of mouse gene function.</a> Nature. 474, 337-342 (2011).</li><li>Carbery, I. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+modification+in+mice+using+zinc-finger+nucleases.">Targeted genome modification in mice using zinc-finger nucleases.</a> Genetics. 186, 451-459 (2010).</li><li>Meyer, M., de Angelis, M. H., Wurst, W., Kuhn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+by+homologous+recombination+in+mouse+zygotes+mediated+by+zinc-finger+nucleases.">Gene targeting by homologous recombination in mouse zygotes mediated by zinc-finger nucleases.</a> Proc. Natl. Acad. Sci. U.S.A. 107, 15022-15026 (2010).</li><li>Cui, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+integration+in+rat+and+mouse+embryos+with+zinc-finger+nucleases.">Targeted integration in rat and mouse embryos with zinc-finger nucleases.</a> Nat. Biotechnol. 29, 64-67 (2011).</li><li>Sung, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Knockout+mice+created+by+TALEN-mediated+gene+targeting.">Knockout mice created by TALEN-mediated gene targeting.</a> Nat. Biotechnol. 31, 23-24 (2013).</li><li>Wefers, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+production+of+mouse+disease+models+by+embryo+microinjection+of+TALENs+and+oligodeoxynucleotides.">Direct production of mouse disease models by embryo microinjection of TALENs and oligodeoxynucleotides.</a> Proc. Natl. Acad. Sci. U.S.A. 110, 3782-3787 (2013).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-Step+generation+of+mice+carrying+mutations+in+multiple+genes+by+CRISPR/Cas-mediated+genome+engineering.">One-Step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering.</a> Cell. 153, 910-918 (2013).</li><li>Urnov, F. D., Rebar, E. J., Holmes, M. C., Zhang, H. S., Gregory, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+editing+with+engineered+zinc+finger+nucleases.">Genome editing with engineered zinc finger nucleases.</a> Nat. Rev. Genetics. 11, 636-646 (2010).</li><li>ZFN, T. A. L. E. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas-based+methods+for+genome+engineering.">CRISPR/Cas-based methods for genome engineering.</a> Trends Biotechnol. 31, 397-405 (2013).</li><li>Joung, J. K., Sander, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TALENs:+a+widely+applicable+technology+for+targeted+genome+editing.">TALENs: a widely applicable technology for targeted genome editing.</a> Nat. Rev. Mol. Cell Biol. 14, 49-55 (2013).</li><li>Cermak, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+design+and+assembly+of+custom+TALEN+and+other+TAL+effector-based+constructs+for+DNA+targeting.">Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting.</a> Nucleic Acids Res. 39, (2011).</li><li>Reyon, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FLASH+assembly+of+TALENs+for+high-throughput+genome+editing.">FLASH assembly of TALENs for high-throughput genome editing.</a> Nat. Biotechnol. 30, 460-465 (2012).</li><li>Sanjana, N. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcription+activator-like+effector+toolbox+for+genome+engineering.">A transcription activator-like effector toolbox for genome engineering.</a> Nat. Protoc. 7, 171-192 (2012).</li><li>Kim, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+library+of+TAL+effector+nucleases+spanning+the+human+genome.">A library of TAL effector nucleases spanning the human genome.</a> Nat. Biotechnol. 31, 251-258 (2013).</li><li>Schmid-Burgk, J. L., Schmidt, T., Kaiser, V., Honing, K., Hornung, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+ligation-independent+cloning+technique+for+high-throughput+assembly+of+transcription+activator-like+effector+genes.">A ligation-independent cloning technique for high-throughput assembly of transcription activator-like effector genes.</a> Nat. Biotechnol. 31, 76-81 (2013).</li><li>Hsu, P. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+targeting+specificity+of+RNA-guided+Cas9+nucleases.">DNA targeting specificity of RNA-guided Cas9 nucleases.</a> Nat. Biotechnol. 31, 827-832 (2013).</li><li>Fu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-frequency+off-target+mutagenesis+induced+by+CRISPR-Cas+nucleases+in+human+cells.">High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells.</a> Nat. Biotechnol. 31, 822-826 (2013).</li><li>Hermann, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+OPEN+zinc+finger+nucleases+for+direct+gene+targeting+of+the+ROSA26+locus+in+mouse+embryos.">Evaluation of OPEN zinc finger nucleases for direct gene targeting of the ROSA26 locus in mouse embryos.</a> PLoS ONE. 7, (2012).</li><li>Meyer, M., Ortiz, O., Hrabe de Angelis, M., Wurst, W., Kuhn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+disease+mutations+by+gene+targeting+in+one-cell+mouse+embryos.">Modeling disease mutations by gene targeting in one-cell mouse embryos.</a> Proc. Natl. Acad. Sci. U.S.A. 109, 9354-9359 (2012).</li><li>Doyle, E. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TAL+Effector-Nucleotide+Targeter+(TALE-NT)+2.0:+tools+for+TAL+effector+design+and+target+prediction.">TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction.</a> Nucleic Acids Res. 40, 117-122 (2012).</li><li>Miller, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+TALE+nuclease+architecture+for+efficient+genome+editing.">A TALE nuclease architecture for efficient genome editing.</a> Nat. Biotechnol. 29, 143-148 (2011).</li><li>Guo, J., Gaj, T., Barbas, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+an+enhanced+and+highly+efficient+FokI+cleavage+domain+for+zinc+finger+nucleases.">Directed evolution of an enhanced and highly efficient FokI cleavage domain for zinc finger nucleases.</a> J. Mol. Biol. 400, 96-107 (2010).</li><li>Doyon, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancing+zinc-finger-nuclease+activity+with+improved+obligate+heterodimeric+architectures.">Enhancing zinc-finger-nuclease activity with improved obligate heterodimeric architectures.</a> Nat. Methods. 8, 74-79 (2011).</li><li>Wefers, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Mouse Biology. , (2011).</li><li>Wefers, B., Wurst, W., K&#252;hn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Mouse Biology. , (2011).</li><li>Haueter, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+vasectomy-overexpression+of+Prm1-EGFP+fusion+protein+in+elongating+spermatids+causes+dominant+male+sterility+in+mice.">Genetic vasectomy-overexpression of Prm1-EGFP fusion protein in elongating spermatids causes dominant male sterility in mice.</a> Genesis. 48, 151-160 (2010).</li><li>Perez-Pinera, P., Ousterout, D. G., Brown, M. T., Gersbach, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+to+the+ROSA26+locus+directed+by+engineered+zinc+finger+nucleases.">Gene targeting to the ROSA26 locus directed by engineered zinc finger nucleases.</a> Nucleic Acids Res. 40, 3741-3752 (2012).</li><li>Bultmann, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+transcriptional+activation+of+silent+oct4+pluripotency+gene+by+combining+designer+TALEs+and+inhibition+of+epigenetic+modifiers.">Targeted transcriptional activation of silent oct4 pluripotency gene by combining designer TALEs and inhibition of epigenetic modifiers.</a> Nucleic Acids Res. 40, 5368-5377 (2012).</li><li>Valton, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overcoming+TALE+DNA+binding+domain+sensitivity+to+cytosine+methylation.">Overcoming TALE DNA binding domain sensitivity to cytosine methylation.</a> J. Biol. Chem. 287, 38427-38432 (2012).</li><li>Cradick, T. J., Ambrosini, G., Iseli, C., Bucher, P., McCaffrey, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ZFN-Site+searches+genomes+for+zinc+finger+nuclease+target+sites+and+off-target+sites.">ZFN-Site searches genomes for zinc finger nuclease target sites and off-target sites.</a> BMC Bioinform. 12, (2011).</li><li>Doyle, E. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TAL+Effector-Nucleotide+Targeter+(TALE-NT)+2.0:+tools+for+TAL+effector+design+and+target+prediction.">TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction.</a> Nucleic Acids Res. 40, 117-122 (2012).</li><li>Byers, S. L., Payson, S. J., Taft, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+ten+inbred+mouse+strains+following+assisted+reproductive+technologies+(ARTs).">Performance of ten inbred mouse strains following assisted reproductive technologies (ARTs).</a> Theriogenology. 65, 1716-1726 (2006).</li><li>Luo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Superovulation+strategies+for+6+commonly+used+mouse+strains.">Superovulation strategies for 6 commonly used mouse strains.</a> J. Am. Assoc. Lab. Animal Sci. 50, 471-478 (2011).</li><li>Pease, S., Saunders, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> International Society for Transgenic Technologies. Advanced protocols for animal transgenesis : an ISTT manual. , (2011).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339, 819-823 (2013).</li><li>Mali, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Guided+human+genome+engineering+via+Cas9.">RNA-Guided human genome engineering via Cas9.</a> Science. 339, 823-826 (2013).</li></ol>

Die Autoren erklären, keine Interessenskonflikte.

Designer Nuklease-driven Genom Bearbeitung Ansätze haben das Spektrum der Arten zugänglich gezielte Modifikationen der jeweiligen Genome 10,12 deutlich erweitert. Bei Mäusen, Gen-Targeting in ES-Zellen hat eine Standard-Technik seit über zwei Jahrzehnten; jedoch ist es schwierig, an ES-Zellen von anderen Spezies als der Maus anpassen bewährt, obwohl es gab einige jüngsten Erfolg in ES-Zellen der Ratte. Auch mit der Verfügbarkeit von &quot;off-the-shelf&quot;-Gen-Targeting Maus-ES-Zellklone von Konsortien wie EUCOMM, KOMP oder NorCOMM 3 Genom Bearbeitung von ZFN TALEN und bietet eine höhere Präzision und Flexibilität in Bezug auf das Spektrum der Veränderungen, die sein können, sofern in das Mausgenom eingeführt. Gründer Tiere, die Nuclease-vermittelten Mutationen scheinen sehr Keimbahn zuständigen 4-6,20,21, was nicht immer der Fall bei Chimären aus Blastozysteninjektion von ES-Zellen Ursprung sein. Somit wird in bestimmten Fällen die Mikroinjektion designer Nukleasen kann deutlich schneller Generation von neuen Mauslinien mit gezielten Genom-Modifikationen führen. Die erfolgreiche Generierung von Knockout-Mäusen durch Injektion von ZFN und TALEN hängt zu einem großen Teil auf die Aktivität des injizierten Nuklease-Paar. TALENS wurde gezeigt, dass eine hohe Erfolgsrate bei der Ausrichtung einer Vielzahl von Genen in verschiedenen Organismen; Jedoch weisen neuere Studien, dass TALEN Bindung empfindlich Cytosin-Methylierung 30,31. Somit neu erzeugten Nuklease Paare, beispielsweise TALENS kloniert in pCAG T7-Vektoren, können vorübergehend in eine Maus-Zelllinie, wie NIH-3T3-oder Neuro transfizierenden -2a, die die Chromatinstruktur Zustand des Mausembryo zu einem gewissen Grad zu imitieren. Hier können Nuklease-Aktivität unter Verwendung des T7-Endonuklease-Assay oder einen Restriktionsverdau von PCR-Produkt, wie in Abschnitt 5 vor der mRNA-Synthese und die Mikroinjektion beschrieben geschätzt werden. Wir empfehlen Sequenzierung der genomischen Region von Interesse in der Hinsicht,ive Zelllinie und die Maus-Stamm für die Mikroinjektion Experimente verwendet. In Maus-Zygoten werden verschiedene TALEN oder ZFN Paare optimal auf verschiedenen mRNA-Konzentrationen zu arbeiten und damit die optimale Arbeitskonzentration der Mikroinjektion Nuklease mRNA kann müssen experimentell ermittelt werden. Abhängig von der Nuklease Paar wird eine zu niedrige Konzentration in keiner Spaltung führen, während eine zu hohe Letalität in Embryo führen. Abhängig von der Nuklease Paar haben wir Erfolg mit Gesamt-mRNA-Konzentrationen so niedrig wie 2 ng / ul und so hoch wie 200 ug / ul. Diese Effekte sind nur schwer von Versuchen in der Zellkultur und die Nuklease eine optimale Konzentration für sowohl Embryoüberlebensrate und Veränderung des Zielorts muß empirisch bestimmt werden, vorherzusagen. Hochaktive ZFN oder TALEN können ihre Zielsequenz über die Ein-Zell-Stadium des Embryos mikroinjizierten spalten und damit zu komplexen Mustern der Mutagenese eind Mosaik in Gründer. Wir und andere 4 haben drei oder mehr verschiedene mutierte Allele in einer einzigen Gründer (5C) beobachtet. Wenn also zur Schaffung einer neuen Mauslinie aus diesen Gründern, Nachwuchs sollte sorgfältig durch Sequenzierung auf die Anwesenheit des günstigen Mutation, da die Verdauung Tests belegen, dass nur eine undefinierte Mutation vorhanden ist abgeschirmt werden. Einer der Kritik häufig geäußerte gegen die ZFN und TALEN Systemen ist die Möglichkeit, dass diese Nukleasen sind auch zur Spaltung irgendwo anders im Genom vorhanden, die ähnlich zu den Zielstellen-Sequenzen sind. Solche Off-Target-Effekte wurden mit frühen Generation Reagenzien mit dem homodimeres Fokl Domäne beobachtet und Heterodimer Konstrukte wurden entwickelt, um Off-Target-Effekte 25 zu lindern. Potential off-Zielstellen in einem gewissen Ausmaß in silico vorhergesagten 32,33 und durch PCR und Sequenzierung gescreent werden. Ein offensichtlicher Vorteil of mit ZFNs Talens und zur Erzeugung von Mäusen und nicht-Zelllinien ist die Möglichkeit der Entfernung vom Ziel Mutationen nicht verknüpfte, um die gewünschten Änderungen durch Genom Durchführung mehrerer Rückkreuzungen zu einem Wildtyp-Stamm der Wahl. Für die Analyse einer großen Anzahl von Gründermäuse nächsten Generation tiefen Sequenzierung von PCR-Produkten aus der Nuklease geplanten Ortskurve erzeugt und in silico vorhergesagten Off-Target-Loci könnte eine alternative qualitative und quantitative Anzeige für die Verdauung des PCR-Assays Produkte. Die in diesem Protokoll beschriebenen Techniken der assistierten Reproduktion sind für Standard-Mausstämme für die Mikroinjektion Experimente wie C57Bl/6J oder B6D2F1 verwendet optimiert. Mäuse unterschiedlicher Herkunft, wie outbred Stämme, kann im Prinzip für die Genom Bearbeitung Ansätze verwendet werden und vielleicht einen besser geeigneten genetischen Hintergrund für bestimmte Forschungsfragen bieten. Die Leistung der assistierten Reproduktionstechniken wie Superovulation kann Prädikat seinfür eine Reihe von Stämmen 34-36 cted könnte aber eine weitere Optimierung für Nicht-Standard-Stämme erfordern, um eine ausreichende Anzahl von Embryonen für die Nuklease Mikroinjektion erhalten. Neben ZFN und TALEN haben neue Designer-Nukleasen wie die RNA-guided CRISPR/Cas9 System 9,37,38 jetzt für Genom-Editing-Anwendungen eingeführt. Alle Verfahren für die Mikroinjektion und Analyse der hier beschriebenen Gründertiere sind auch auf CRISPR/Cas9 und zukünftige Arten der Genom-Bearbeitung.

Mäuse sind mit Abstand die beliebteste Plattform zur Erzeugung transgener Tiermodelle. Die vielseitige Werkzeugkasten für die Gentechnik von Mausembryo 1-3 wurde kürzlich von Genom Bearbeitung Ansätzen für Designer Nukleasen wie Zink-Finger-Nukleasen (ZFN) verlängert 4-6, Transkriptionsaktivator-Effektor wie Nukleasen (TALEN) 7,8, und die Cluster regelmäßig beabstandet kurze Palindrom-Wiederholungen (CRISPR) / CRISPR-assoziierten (Cas) 9 System 9. ZFN und TALEN Funktion als Paare von zwei maßgeschneiderten Protein-basierten DNA-bindende Domänen (Arrays von Zinkfinger-Proteine ​​und wiederholen Variablen di-Rückstände (RVDS), respectively), die jeweils mit der FokI Endonuklease 10-12 gekoppelt sind. Umgekehrt wird die Spezifität der Cas9-vermittelten DNA-Spaltung durch zu trans CRISPR RNAs (crRNA und tracrRNA, die auch in einem einzigen chimären RNA-Molekül bezeichnet Führungs RNA kombiniert werden können) zur Verfügung gestellt, die 11 in einem Komplex mit dem GesetzCRISPR Protein. TALENS mit einer definierten Sequenz des RVDS schnell einzelner Experimentatoren mit einer Vielzahl von Strategien zur Montage 13-17 wählen konstruiert werden. CRISPR/Cas9 verspricht noch weniger arbeitsintensiv Generation von Designer-Nukleasen, aber die Spezifität von Führungs RNA-DNA-Bindung ist immer noch nicht vollständig gelöst 18,19. Erstellung von benutzerdefinierten ZFNs bisher an spezialisierte akademische Labors und kommerzielle Anbieter wie Sangamo Biosciences und Sigma CompoZr Dienst beschränkt. In der Regel soll Genom Bearbeitung mit Designer-Nukleasen auf die Einführung Doppelstrangbrüche (DSB) an definierten genomischen Loci, die anschließend zu gewinnen nicht-homologe Ende (NHEJ) oder homologe Rekombination (HR) DNA-Reparatur-Maschinen 10,12. NHEJ-vermittelte Reparatur eines DSB oft zur Einführung von Insertionen und Deletionen in der Nähe der Stelle der Reparatur. So NHEJ Reparatur czum Ausschlagen der Funktion eines Zielgens durch die Einführung einer Rahmenverschiebungsmutation in der Gene-Protein-kodierende Sequenz ein 4,7,9 ausgenutzt werden. Alternativ kann definiert Hinzufügen oder Austauschen von genetischer Information durch die Bereitstellung einer DNA-Donor zusammen mit den Designer Nukleasen erreicht werden. Ein DNA-Donor umfasst Forschern entwickelt DNA-Sequenzen, die durch Bereiche der Homologie mit dem Ziel-Locus flankiert, so als Vorlage für DSB-Reparatur dien von HR. Beide Plasmide 5,6,20 und einzelsträngige Oligonukleotide 8,9,21 wurden erfolgreich als Donoren verwendet. Weder NHEJ-oder HR-vermittelte Genom Bearbeitung erfordern die Einführung eines selektierbaren Markers in das Genom der Maus-Embryo, der diese Strategien besonders gut für die Erstellung von kleinen Veränderungen in der Nukleotidsequenz, ohne die Gesamtarchitektur genetische Störung geeignet macht. In diesem Protokoll beschreiben wir alle wesentlichen Verfahren für die Genom-Bearbeitung in derMaus-Embryo mit Talens. Dazu gehören 1) Identifizierung eines TALEN Zielstelle 22, 2) Bau von Talens von golden gate Klonen 13, 3) in vitro Synthese von mRNA TALEN, 4), die Mikroinjektion von mRNA TALEN in befruchtete Eizellen der Maus, 5) chirurgische Verfahren zur Embryo-Transfer und 6) Analyse der TALEN-induzierten Mutagenese in Gründertiere. Wir konzentrieren uns auf TALEN mRNA-Mikroinjektion und Screening von Gründern für NHEJ-induzierte Insertionen / Deletionen. Zu diesem Zweck haben wir bifunktionellen TALEN Konstrukte, die sowohl die Expression in Säugerzellen, wenn sie als Plasmide und in vitro Synthese von mRNA TALEN für die Mikroinjektion in transfizierten Mäuse-Embryonen ermöglichen erzeugt. Diese Konstrukte umfassen einen Kegel GESCHICHTE Rückgrat 23 bis heterodimeren FokI-Domänen fusioniert 24,25 optimale Genom Bearbeitung in Säugerzellen. Dieses Protokoll kann auch für die Mikroinjektion von anderen Designer-Nukleasen oder zur kombinierten Injektionen von Designer-Nukleasen angenommen werdenund Geber Konstrukte (Design von DNA-Geber ist in der ausgezeichneten technischen Publikationen von Wefers et al. 26,27) beschrieben worden. Ethische Erklärung Alle Tierversuche wurden in Übereinstimmung mit den Richtlinien und Bestimmungen der kantonalen Veterinäramt des Kantons Zürich durchgeführt.

<table border="0" cellpadding="0" cellspacing="0" width="524">
	<colgroup>
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">BsaI</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">R0535S or L</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Esp3I</td>
			<td style="width:111px;">Thermo Scientific</td>
			<td style="width:119px;">ER0451</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">T4 Ligase</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">M0202S or L</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Spectinomycin</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">S0692-1ML</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ampicillin&#160;</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">A0166</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">X-Gal</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">B4252</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">IPTG</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">I6758</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Plasmid-Safe nuclease</td>
			<td style="width:111px;">Epicentre</td>
			<td style="width:119px;">E3101K</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">27106</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAGEN Plasmid Midi Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">12143</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAquick PCR Purification Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">28106</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">mMESSAGE mMACHINE T7 Ultra Kit</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM1345</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">NucAway Spin Columns</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM10070</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNaseZAP</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">R2020-250ML</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">NorthernMax Formaldyde Load Dye</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM8552</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNA Millennium Markers</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM7150</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">10x TBE buffer</td>
			<td style="width:111px;">Thermo Scientific</td>
			<td style="width:119px;">B52</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">T7 endonuclease</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">M0302S or L</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">pGEM-T EasyVector System I</td>
			<td style="width:111px;">Promega</td>
			<td style="width:119px;">A3600</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">SYBR Green I Nucleic Acid Gel Stain</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">S-7563</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">pregnant mare&#39;s serum gonadotrophin (PMSG)</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">G4877</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">human chorionic gonadotropin (hCG)</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">CG5</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">M2 embryo culture medium</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M7167</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">M16 embryo culture medium</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M7292</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Mineral oil, embryo tested</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M8410</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ketamine</td>
			<td style="width:111px;">CentraVet</td>
			<td style="width:119px;">Ket 201</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Xylazine</td>
			<td style="width:111px;">Sigma Aldrich</td>
			<td style="width:119px;">46995</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Equipment/Tools</td>
			<td style="width:111px;"></td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Inverted microscope with Nomarski DIC optics (for example Nikon Eclipse TE200)</td>
			<td style="width:111px;">Nikon</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Micromanipulator units (for example Narishige, NT88NF)</td>
			<td style="width:111px;">&#160;Narishige</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Embryo holding capillaries</td>
			<td style="width:111px;">Sutter instruments</td>
			<td style="width:119px;">B100-75-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Embryo injection capillaries</td>
			<td style="width:111px;">Narishige</td>
			<td style="width:119px;">GD-1</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Capillary puller (for example Sutter P97)</td>
			<td style="width:111px;">Sutter instruments</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Microforge (for example Narishige MF-900)</td>
			<td style="width:111px;">Narishige&#160;</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Walton skin scissors</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">14077-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Surgical scissors</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">14041-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Surgical probe</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">10140-03</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Reflex wound clip system (9mm)</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">12031-09</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Reflex wound clips (9mm)</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">12032-09</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Dumont fine forceps 5</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11254-20</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Moria curvrd forceps</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11370-31</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Moria fine forceps</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11399-80</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Dietrich bulldog clamp</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">18038-45</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Animals</td>
			<td style="width:111px;"></td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">C57BL/6J mice</td>
			<td style="width:111px;">Jackson labs</td>
			<td style="width:119px;">strain code 000664</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">CD-1 mice</td>
			<td style="width:111px;">Charles river</td>
			<td style="width:119px;">strain code 000664</td>
		</tr>
	</tbody>
</table>

mouse genome engineering using designer nucleases

Transgene Mäuse, die ortsspezifische Genom-Modifikationen (KO, Knock-in) sind von entscheidender Bedeutung für die Zerlegung komplexer biologischer Systeme als auch für die Modellierung menschlichen Krankheiten und Therapiestrategien testen. Jüngste Fortschritte in der Verwendung von Designer-Nukleasen wie Zink-Finger-Nukleasen (ZFNs), Transkriptions-Aktivator-Effektor wie Nukleasen (Talens) und den Cluster regelmäßig beabstandet kurze Palindrom-Wiederholungen (CRISPR) / CRISPR-assoziierten (Cas) 9-System für Website- spezifische Genomtechnik die Möglichkeit offen, um eine schnelle gezielte Modifikation Genom in praktisch allen Labortieren durchführen, ohne die Notwendigkeit, an embryonalen Stammzellen (ES)-Technologie verlassen. Ein Genom Bearbeitung Experiment beginnt in der Regel mit der Identifizierung von Designer-Nuklease Zielorten innerhalb eines Gens von Interesse, gefolgt von Bau von kundenspezifischen DNA-bindenden Domänen Nuklease-Aktivität direkt an die Ermittler definierten genomischen Locus. Designer Nuklease Plasmide sind in vitro &lt;/ Em&gt; transkribiert, um mRNA für die Mikroinjektion von befruchteten Eizellen der Maus zu erzeugen. Hier bieten wir ein Protokoll für das zielgerichtete Modifikation Genom durch direkte Injektion TALEN mRNA in befruchtete Eizellen der Maus.

Wir konstruierten Ziel Plasmide mit dem Goldenen GateTALEN Anordnung nach Cermak et al. 13, der die Expression in Säugetierzellen TALENS als auch in vitro-mRNA-Synthese aus dem T7-Phagen-Promotor (Fig. 1C) zu ermöglichen veröffentlicht kompatibel. Diese Plasmide tragen heterodimeren Fokl Domains (ELD oder KKR Mutationen), die gezeigt haben, um Off-Target-Effekte in Bezug auf Fokl Homodimere zu reduzieren und die Spaltungsaktivität verbessern im Vergleich zu der ersten Generation Fokl Heterodimere 25,29. Golden Gate Anordnung Reaktionen Nr. 1 und Nr. 2 sind in der Regel sehr effizient, und jedes weiße Kolonie, wenn durch Kolonie-PCR analysiert, zeigt das erwartete Muster für die bestimmte Anzahl von RVDS kloniert (Fig. 1B und 1D). Gel-Analyse der in vitro synthetisierten mRNA (Abbildung 2) sollte eine einzelne unterscheidbar Band mit wenig oder ohne Abstrich für jede Probe analysiert offenbaren. Es sollte eine klare Größe Verschiebung zwischen Proben und L1/R1 L2/R2, L3/R3, die erfolgreiche Polyadenylierung zeigt sein. Gründer-Tiere können beispiels NHEJ-induzierten mutierten Allele Genotypisierung mit PCR, gefolgt von entweder T7 Endonuklease-Verdauung (Fig. 3) oder einen Restriktionsverdau unter Verwendung eines Enzyms untersucht werden, dass spaltet die Wildtyp-Sequenz in der Spacer-Region der Nuklease Paar (Abbildung 4). Die T7-Endonuklease Assay ist auf jede Art von Mutation unabhängig von der speziellen genomische Sequenz innerhalb der Spacer-Region der Nuklease Paar injiziert wird; jedoch erkennt nur Fehlanpassungen zwischen DNA-Strängen in Heteroduplex-PCR-Produkte. So wird in dem seltenen Fall, dass einer der Gründer trägt zwei identisch mutierten Allele, PCR-Produkte würden keine T7 Verdauungsmuster zeigen. Solche Unterscheidung ist jedoch immer möglich, wenn eine spezifische Restriktionsstelle innerhalb der Nuklease Spacerregion, die von NHEJ eliminiert werden entferntInduzierten Insertionen / Deletionen (Abbildung 5). Hier unverdaute Banden weisen auf das Vorhandensein von Mutationen und das Fehlen von Abbauprodukte stark darauf eine gegründet, die Mutationen in beiden Allelen des Zielgens (mit Sternchen in Fig. 4b dargestellt). <img alt="Figur 1" fo:content-width="6in" fo:src="/files/ftp_upload/50930/50930fig1highres.jpg" src="/files/ftp_upload/50930/50930fig1.jpg" width="600" /> Fig. 1 ist. Golden Gate Klonen von TALEN RVDS in heterodimeren pCAG-T7-Destination-Vektoren. A) Versammlung der RVD Arrays in PFUS Vektoren. Hier ein Beispiel für ein Paar mit individuellen TALEN TALE-Arrays mit 15 und 17 RVDS RVDS jeweils dargestellt (für TALE Arrays länger als 21 RVDS werden drei PFUS-RVDS Baugruppen erforderlich ist, nicht gezeigt). Die Pfeile zeigen die Primer für PFUS spezifischen Kolonie-PCR-Reaktionen. B) PCR-Produktevon der richtigen PFUS Baugruppen verstärkt zeigen typischerweise eine Band, die der Gesamtlänge aller RVDS kloniert (zB rund 1,1 kb für 10 RVDS) und eine &quot;Leiter&quot; der kleineren, weniger prominenten Bands aufgrund der repetitiven Natur der RVD-Arrays. C) Endmontage von PFUS-RVD-Arrays und einem Plasmid, das die letzte Wiederholung (PLR) in heterodimeren TALEN Expressionsvektoren mit FokIELD und FokIKKR Varianten auf. Die TALEN Rückgrat (wie N-und C-kommentierten) ähnelt dem von Miller et al. 23 veröffentlicht Architektur Die CAG (frühen CMV-Enhancer-Element / Huhn-beta-Aktin)-Promotor für hohe Expressionsniveaus in transfizierten Säugerzellen, während der T7-Phagen-Promotor kann in vitro-mRNA-Synthese (Verwendung SacI für die Linearisierung des Vektors stromabwärts von der Nuklease STOP-Codon). D) Kolonie-PCR unter Verwendung von Primern durch Pfeile in C angegeben) ermöglicht die Identifizierung korrekt montiert TALENS. Voll length PCR-Produkte sind oft weniger prominent, während die &quot;Leitereffekt&quot; stellt eine robuste Indikator für die erfolgreiche Montage. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig1highres.jpg" target="_blank">Klicken Sie hier für eine größere Ansicht</a> . <img alt="Figur 2" fo:content-width="3in" fo:src="/files/ftp_upload/50930/50930fig2highres.jpg" src="/files/ftp_upload/50930/50930fig2.jpg" width="300" /> 2. . Qualitätskontrolle von Nuklease-mRNA in vitro-Synthese unter Verwendung von Agarose-Gelelektrophorese ZFN mRNAs werden als Beispiel gezeigt (L, linke ZFN, R rechten ZFN). Proben L1/R1 mRNA vor Polyadenylierung zeigen, Proben L2/R2 Show polyadenyliert mRNA und L3/R3 zeigen gereinigte polyadenylierten mRNA. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig2highres.jpg" target="_blank">Klicken Sie hier für eine größere Ansicht</a> . <img<html> alt = &quot;3&quot; fo: content-width = &quot;6in&quot; fo: src = &quot;/ files/ftp_upload/50930/50930fig3highres.jpg&quot; src = &quot;/ files/ftp_upload/50930/50930fig3.jpg&quot; width = &quot;600&quot; /&gt; 3. Beispiel für einen T7-Endonuklease-Assay zur Identifizierung von Gründertieren Durchführung Nuklease-induzierten Mutationen des Ziel-Locus verwendet werden. A) Eine TALEN Paar wurde entwickelt, um innerhalb der kodierenden Region des Maus-Prionprotein-Gen (Prnp spalten kann TALEN Zielsequenz auf Anfrage zur Verfügung gestellt werden). Ein PCR-Produkt wird mit einem Vorwärtsprimer (F) liegt 110 bp stromaufwärts und ein Rückwärts-Primer (R) 250 bp stromabwärts der Spaltstelle TALEN. B) Das PCR-Produkt wird anschließend Bildung ausgesetzt und T7-Endonuklease-Verdauung erzeugten Heteroduplex. C) TALEN-induzierte Mutagenese innerhalb der genomischen Region des Zieleinzel Gründer wird durch die Anwesenheit von einer Volllängen-PCR-Produkts mit Produkten des Verdaus von 250 und 110 bp ergab.50930/50930fig3highres.jpg &quot;target =&quot; _blank &quot;&gt; Klicken Sie hier für eine größere Ansicht. <img alt="Fig. 4" fo:content-width="6in" fo:src="/files/ftp_upload/50930/50930fig4highres.jpg" src="/files/ftp_upload/50930/50930fig4.jpg" width="600" /> 4. Beispiel für einen Restriktionsverdau zur Identifizierung der Tiere, die Gründer Nuklease-induzierte Mutationen des Zielorts. ZFN spezifisch für die Maus Rosa26 Locus 29 Ziel eine XbaI-Schnittstelle in Intron 1 verwendeten PCR-Produkte. A) Gründer wurden durch PCR Genotypisierung geschirmten ein Vorwärtsprimer (F) 500 bp stromaufwärts und ein Rückwärts-Primer (R) 250 bp stromabwärts der Spaltstelle. B) Verdau der PCR-Produkte mit XbaI Verdau zeigt Muster, die Mäuse, die mit bi-allelische Mutationen (markiert mit Sternchen), mono -Allel-Mutationen (verdaut und unverdaute Bands, z. B. Tier 2)und wt-Mäuse (vollständige Verdauung, zB Tier 21). C) Sequenzierung von Mäusen mit Potential bi-allelische Modifikationen zeigt bis zu 3 (Tier 24) verschiedene Insertionen / Deletionen. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig4highres.jpg" target="_blank">Klicken Sie hier für eine größere Ansicht</a> . <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Name der Primer </td><td> Sequenz 5 &#39;zu 3&#39; </td></tr><tr><td> pCR8_F1 </td><td> ttgatgcctggcagttccct </td></tr><tr><td> pCR8_R1 </td><td> cgaaccgaacaggcttatgt </td></tr><tr><td> TAL_F1 </td><td> ttggcgtcggcaaacagtgg </td></tr><tr><td> TAL_R2 </td><td> ggcgacgaggtggtcgttgg </td></tr><tr><td> TAL_Seq_5-1 </td><td> catcgcgcaatgcactgac </td></tr></tbody></table> Tabelle 1. Sequenzen von Primern für die Kolonie PCR und Sequenzierung innerhalb der Golden Gate TALEN Montage verwendetProtokoll. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Plasmid / Sammlung </td><td> Anbieter </td><td> Addgene ID </td><td> Kommentare </td></tr><tr><td> Golden Gate TALEN und TAL-Effektor Kit 2.0 </td><td> Voytas Labor </td><td> 1000000024 </td><td> Enthält alle Plasmide für die Golden Gate TALEN Montage notwendig </td></tr><tr><td> pCAG-T7-TALEN -KKR/ELD Zielvektoren </td><td> Pelczar Labor </td><td> 40131, 40132 </td><td> Add-on-Plasmide für TALEN Expression in Säugerzellen und in vitro-mRNA-Synthese </td></tr></tbody></table> Tabelle 2. Plasmide und Plasmid-Kollektionen für Golden Gate TALEN Montage erforderlich kann von Addgene (erhältlich <a href="http://www.addgene.org">www.addgene.org</a> ). <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> OnlineRessource </td><td> Kommentare </td></tr><tr><td> http://tale-nt.cac.cornell.edu </td><td> Design TALEN; TALEN Off-Target-Vorhersage </td></tr><tr><td> http://zifit.partners.org/ZiFiT/ </td><td> Design TALEN, OPEN ZFN, CoDA ZFN, CRISPR/Cas9 </td></tr><tr><td> http://www.genome-engineering.org </td><td> Design TALEN, CRISPR/Cas9; CRISPR/Cas9 Off-Target-Vorhersage </td></tr><tr><td> http://baolab.bme.gatech.edu/Research/BioinformaticTools/assembleTALSequences.html </td><td> Versammlung der TALEN Sequenzen für die Bestätigung der Sequenzierungsergebnisse </td></tr><tr><td> http://pgfe.umassmed.edu/ZFPmo dularsearchV2.html </td><td> Gestaltung von Baukasten ZFN </td></tr><tr><td> www.genomecenter.ucdavis.edu/s egallab / segallabsoftware </td><td> Gestaltung von Baukasten ZFN </td></tr></tbody></table> Tabelle 3. Online-Ressourcen für die Gestaltung von ZFN, TALEN und CRISPR/Cas9. </sTrong&gt;

Watch this Scientific Journal Video about Mouse Genome Engineering Using Designer Nucleases at JoVE.com

Mouse Genome Engineering Using Designer Nucleases

Designer-Nukleasen wie Zink-Finger-Nukleasen (ZFNs) und Transkriptionsaktivator-Effektor wie Nukleasen (Talens) kann verwendet werden, um das Genom der Maus Präimplantationsembryonen durch Auslösen sowohl die nicht-homologe Ende (NHEJ) und die homologe Rekombination (HR) Wege ändern. Diese Fortschritte ermöglichen die schnelle Generierung von Mäusen, die mit präzisen genetischen Veränderungen.

Maus-Genom-Engineering mit Designer Nukleasen

Transgenic mice carrying site-specific genome modifications (knockout, knock-in) are of vital importance for dissecting complex biological systems as well ...

mouse-genome-engineering-using-designer-nucleases

Research

JoVE Journal

Biology

28.6K Aufrufe.  University of Zurich.  Designer-Nukleasen wie Zink-Finger-Nukleasen (ZFNs) und Transkriptionsaktivator-Effektor wie Nukleasen (Talens) kann verwendet werden, um das Genom der Maus Präimplantationsembryonen durch Auslösen sowohl die nicht-homologe Ende (NHEJ) und die homologe Rekombination (HR) Wege ändern. Diese Fortschritte ermöglichen die schnelle Generierung von Mäusen, die mit präzisen genetischen Veränderungen. 

Serie: Mouse Genome Engineering Using Designer Nucleases

Gross and Fine Dissection of Inner Ear Sensory Epithelia in Adult Zebrafish (Danio rerio)

Neurosensory epithelia in the inner ear are the crucial structures for hearing and balance functions. Therefore, it is important to understand the cellular and molecular features of the epithelia, which are mainly composed of two types of cells: hair cells (HCs) and supporting cells (SCs). Here we choose to study the inner ear sensory epithelia in adult zebrafish not only because the epithelial structures are highly conserved in all vertebrates studied, but also because the adult zebrafish is able to regenerate HCs, an ability that mammals lose shortly after birth. We use the inner ear of adult zebrafish as a model system to study the mechanisms of inner ear HC regeneration in adult vertebrates that could be helpful for clinical therapy of hearing/balance deficits in human as a result of HC loss.
Here we demonstrate how to do gross and fine dissections of inner ear sensory epithelia in adult zebrafish. The gross dissection removes the tissues surrounding the inner ear and is helpful for preparing tissue sections, which allows us to examine the detailed structure of the sensory epithelia. The fine dissection cleans up the non-sensory-epithelial tissues of each individual epithelium and enables us to examine the heterogeneity of the whole epithelium easily in whole-mount epithelial samples.

Gross and Fine Dissection of Inner Ear Sensory Epithelia in Adult Zebrafish Danio rerio

The inner ear sensory epithelium of adult zebrafish is a good model system for understanding the mechanisms of hair cell regeneration in adult vertebrates. This protocol demonstrates the fine dissection of the epithelia, through which we can get tissue samples for studying the regenerative events at cellular and subcellular levels.

Gross und Fine Dissection of Inner Ear Sinnesepithelien in Adult Zebrafisch ( Danio rerio)

Neurosensory epithelia in the inner ear are the crucial structures for hearing and balance functions. Therefore, it is important to understand the ...

Forschung

Biologie

Engineering Cell-permeable Protein

The protein transduction technique enables the direct delivery of biologically active material into mammalian cells [for review see 1,2]. For this one can make use of the translocating ability of so-called cell penetrating peptides (CPPs), also designated as protein transduction domains (PTDs). The TAT-CPP derived from the human immunodeficiency virus type 1 (HIV-1) Tat (trans-activator of transcription) protein has been widely used. The positively charged TAT promotes cell permeability thereby overcoming the barriers of the cellular membrane by endocytosis or/and direct membrane penetration2. In combination with a nuclear localization signal (NLS) fusion proteins are able to enter the nucleus exhibiting functionality. Our video presentation demonstrates, as an exemplification for the engineering of cell-permeable proteins, the construction, production and application of a cell-permeable version of the DNA-modifying enzyme Cre.
Cre is a site-specific recombinase that is able to recognize and recombine 34 base pair loxP sites in mammalian cells in vitro and in vivo. Therefore the Cre/loxP system is widely used to conditionally induce mutations in the genome of living cells3,4. The delivery of active Cre recombinase to cells, however, represents a limitation.
We describe the pSESAME vector system, which allows a direct insertion of the gene-of-interest and provides a platform to rapidly clone different domains and tags used within the vector in a convenient and standardized manner. Rearranging of the different tags has been shown to modify the biochemical properties of the fusion proteins providing a possibility to achieve higher yield and better solubility. We demonstrate how to express and purify recombinant cell-permeant proteins in and from E. coli. The functionality of the recombinant Cre protein is finally validated in cell culture by assessing its intracellular recombinase activity.

Protein transduction enables the direct delivery of biologically active proteins into cells. In contrast to conventional methods such as DNA transfection or viral transduction this non-invasive paradigm allows highly efficient cellular manipulation in a titratable manner circumventing cellular toxicity and the risk of oncogenic transformation by permanent genetic modification.

Engineering zellpermeablen Protein

The protein transduction technique enables the direct delivery of biologically active material into mammalian cells [for review see 1,2]. For this one can ...

Genome-wide Analysis of Aminoacylation (Charging) Levels of tRNA Using Microarrays

tRNA aminoacylation, or charging, levels can rapidly change within a cell in response to the environment[1]. Changes in tRNA charging levels in both prokaryotic and eukaryotic cells lead to translational regulation which is a major cellular mechanism of stress response. Familiar examples are the stringent response in E. coli and the Gcn2 stress response pathway in yeast ([2-6]). Recent work in E. coli and S. cerevisiae have shown that tRNA charging patterns are highly dynamic and depends on the type of stress experienced by cells [1, 6, 7]. The highly dynamic, variable nature of tRNA charging makes it essential to determine changes in tRNA charging levels at the genomic scale, in order to fully elucidate cellular response to environmental variations. In this review we present a method for simultaneously measuring the relative charging levels of all tRNAs in S. cerevisiae . While the protocol presented here is for yeast, this protocol has been successfully applied for determining relative charging levels in a wide variety of organisms including E. coli and human cell cultures[7, 8].

Genome-wide Analysis of Aminoacylation Charging Levels of tRNA Using Microarrays

We describe a method for microarray analysis to determine relative aminoacylation levels of all tRNAs from S. cerivisiae.

Genomweite Analyse der Aminoacylierung (Charging) Ebenen der tRNA mittels Microarrays

tRNA aminoacylation, or charging, levels can rapidly change within a cell in response to the environment[1]. Changes in tRNA charging levels in both ...

Genome-wide Analysis using ChIP to Identify Isoform-specific Gene Targets

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the protein domains that bind to specific histone modifications. One such domain is the plant homeodomain (PHD), found in several chromatin-binding proteins. The epigenetic factor RBP2 has multiple PHD domains, however, they have different functions (Figure 4). In particular, the C-terminal PHD domain, found in a RBP2 oncogenic fusion in human leukemia, binds to trimethylated lysine 4 in histone H3 (H3K4me3)1. The transcript corresponding to the RBP2 isoform containing the C-terminal PHD accumulates during differentiation of promonocytic, lymphoma-derived, U937 cells into monocytes2. Consistent with both sets of data, genome-wide analysis showed that in differentiated U937 cells, the RBP2 protein gets localized to genomic regions highly enriched for H3K4me33. Localization of RBP2 to its targets correlates with a decrease in H3K4me3 due to RBP2 histone demethylase activity and a decrease in transcriptional activity. In contrast, two other PHDs of RBP2 are unable to bind H3K4me3. Notably, the C-terminal domain PHD of RBP2 is absent in the smaller RBP2 isoform4. It is conceivable that the small isoform of RBP2, which lacks interaction with H3K4me3, differs from the larger isoform in genomic location. The difference in genomic location of RBP2 isoforms may account for the observed diversity in RBP2 function. Specifically, RBP2 is a critical player in cellular differentiation mediated by the retinoblastoma protein (pRB). Consistent with these data, previous genome-wide analysis, without distinction between isoforms, identified two distinct groups of RBP2 target genes: 1) genes bound by RBP2 in a manner that is independent of differentiation; 2) genes bound by RBP2 in a differentiation-dependent manner.
To identify differences in localization between the isoforms we performed genome-wide location analysis by ChIP-Seq. Using antibodies that detect both RBP2 isoforms we have located all RBP2 targets. Additionally we have antibodies that only bind large, and not small RBP2 isoform (Figure 4). After identifying the large isoform targets, one can then subtract them from all RBP2 targets to reveal the targets of small isoform. These data show the contribution of chromatin-interacting domain in protein recruitment to its binding sites in the genome.

Here we are presenting a chromatin immunoprecipitation (ChIP) procedure for genome-wide location analysis of protein isoforms that differ in a histone-binding domain. We are applying it to ChIP-Seq analysis to identify the targets of the KDM5A/JARID1A/RBP2 histone demethylase.

Genomweite Analyse mittels ChIP zu Isoform-spezifische Gene-Targets zu identifizieren

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the ...

In vivo Imaging and Therapeutic Treatments in an Orthotopic Mouse Model of Ovarian Cancer

Human cancer and response to therapy is better represented in orthotopic animal models. This paper describes the development of an orthotopic mouse model of ovarian cancer, treatment of cancer via oral delivery of drugs, and monitoring of tumor cell behavior in response to drug treatment in real time using in vivo imaging system. In this orthotopic model, ovarian tumor cells expressing luciferase are applied topically by injecting them directly into the mouse bursa where each ovary is enclosed. Upon injection of D-luciferin, a substrate of firefly luciferase, luciferase-expressing cells generate bioluminescence signals. This signal is detected by the in vivo imaging system and allows for a non-invasive means of monitoring tumor growth, distribution, and regression in individual animals. Drug administration via oral gavage allows for a maximum dosing volume of 10 mL/kg body weight to be delivered directly to the stomach and closely resembles delivery of drugs in clinical treatments. Therefore, techniques described here, development of an orthotopic mouse model of ovarian cancer, oral delivery of drugs, and in vivo imaging, are useful for better understanding of human ovarian cancer and treatment and will improve targeting this disease.

In vivo Imaging and Therapeutic Treatments in an Orthotopic Mouse Model of Ovarian Cancer

Orthotopic animal models of ovarian cancer replicate better human disease and therefore enhance our understanding of cancer progression and tumor response to therapy. A mouse model receives an intrabursal injection of luciferase-expressing ovarian tumor cells. Treatment is administered via oral gavage. Tumor growth is monitored by in vivo imaging system.

In-vivo-Imaging und therapeutische Behandlungen in einem orthotopen Mausmodell des Eierstockkrebs

Human cancer and response to therapy is better represented in orthotopic animal models.  This paper describes the development of an orthotopic mouse model ...

Flow Cytometry Purification of Mouse Meiotic Cells

The heterogeneous nature of cell types in the testis and the absence of meiotic cell culture models have been significant hurdles to the study of the unique differentiation programs that are manifest during meiosis. Two principal methods have been developed to purify, to varying degrees, various meiotic fractions from both adult and immature animals: elutriation or Staput (sedimentation) using BSA and/or percoll gradients. Both of these methods rely on cell size and density to separate meiotic cells1-5. Overall, except for few cell populations6, these protocols fail to yield sufficient purity of the numerous meiotic cell populations that are necessary for detailed molecular analyses. Moreover, with such methods usually one type of meiotic cells can be purified at a given time, which adds an extra level of complexity regarding the reproducibility and homogeneity when comparing meiotic cell samples.
Here, we describe a refined method that allows one to easily visualize, identify, and purify meiotic cells, from germ cells to round spermatids, using FACS combined with Hoechst 33342 staining7,8. This method provides an overall snapshot of the entire meiotic process and allows one to highly purify viable cells from most stage of meiosis. These purified cells can then be analyzed in detail for molecular changes that accompany progression through meiosis, for example changes in gene expression9,10and the dynamics of nucleosome occupancy at hotspots of meiotic recombination11.

An efficient method to obtain highly purified viable meiotic fractions from mouse testis is described, which combines a refined cell dissociation protocol with fluorescent activated cell sorting (FACS). This method takes advantage of differences in the DNA content and nuclear density of discrete meiotic fractions.

Durchflusszytometrie Reinigung der Maus meiotischen Zellen

The heterogeneous nature of cell types in the testis and the absence of meiotic cell culture models have been significant hurdles to the study of the ...

Genome-wide Screen for miRNA Targets Using the MISSION Target ID Library

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, genome-wide cDNA library cloned into the 3'UTR downstream from the dual-selection fusion protein, thymidine kinase-zeocin (TKzeo). The first round of selection is for stable transformants, followed with introduction of a miRNA of interest, and finally, selecting for cDNAs containing the miRNA's target. Selected cDNAs are identified by sequencing (see Figure 1-3 for Target ID Library Workflow and details).
To ensure broad coverage of the human transcriptome, Target ID Library cDNAs were generated via oligo-dT priming using a pool of total RNA prepared from multiple human tissues and cell lines. Resulting cDNA range from 0.5 to 4 kb, with an average size of 1.2 kb, and were cloned into the p3&#900;TKzeo dual-selection plasmid (see Figure 4 for plasmid map). The gene targets represented in the library can be found on the Sigma-Aldrich webpage. Results from Illumina sequencing (Table 3), show that the library includes 16,922 of the 21,518 unique genes in UCSC RefGene (79%), or 14,000 genes with 10 or more reads (66%).

The Target ID Library is a plasmid-based, genome-wide collection of cloned cDNA used to identify miRNA targets. Here we demonstrate its use and application.

Genomweiten Screen für miRNA-Targets mit dem Missionsziel ID-Bibliothek

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, ...

Genome Editing with CompoZr Custom Zinc Finger Nucleases (ZFNs)

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such as chemical-based mutagenesis or random integration of DNA sequences confer indiscriminate genetic changes in an overall inefficient manner and require incorporation of undesirable synthetic sequences or use of aberrant culture conditions, potentially confusing biological study. By contrast, transient ZFN expression in a cell can facilitate precise, heritable gene editing in a highly efficient manner without the need for administration of chemicals or integration of synthetic transgenes.
Zinc finger nucleases (ZFNs) are enzymes which bind and cut distinct sequences of double-stranded DNA (dsDNA). A functional CompoZr ZFN unit consists of two individual monomeric proteins that bind a DNA "half-site" of approximately 15-18 nucleotides (see Figure 1). When two ZFN monomers "home" to their adjacent target sites the DNA-cleavage domains dimerize and create a double-strand break (DSB) in the DNA.1 Introduction of ZFN-mediated DSBs in the genome lays a foundation for highly efficient genome editing. Imperfect repair of DSBs in a cell via the non-homologous end-joining (NHEJ) DNA repair pathway can result in small insertions and deletions (indels). Creation of indels within the gene coding sequence of a cell can result in frameshift and subsequent functional knockout of a gene locus at high efficiency.2 While this protocol describes the use of ZFNs to create a gene knockout, integration of transgenes may also be conducted via homology-directed repair at the ZFN cut site.
The CompoZr Custom ZFN Service represents a systematic, comprehensive, and well-characterized approach to targeted gene editing for the scientific community with ZFN technology. Sigma scientists work closely with investigators to 1) perform due diligence analysis including analysis of relevant gene structure, biology, and model system pursuant to the project goals, 2) apply this knowledge to develop a sound targeting strategy, 3) then design, build, and functionally validate ZFNs for activity in a relevant cell line. The investigator receives positive control genomic DNA and primers, and ready-to-use ZFN reagents supplied in both plasmid DNA and in-vitro transcribed mRNA format. These reagents may then be delivered for transient expression in the investigator&#x2019;s cell line or cell type of choice. Samples are then tested for gene editing at the locus of interest by standard molecular biology techniques including PCR amplification, enzymatic digest, and electrophoresis. After positive signal for gene editing is detected in the initial population, cells are single-cell cloned and genotyped for identification of mutant clones/alleles.

Genome Editing with CompoZr Custom Zinc Finger Nucleases ZFNs

The CompoZr Custom Zinc-Finger Nuclease (ZFN) Service enables precise genome editing in any organism or cell line at any locus defined by the user. This article describes the process for the design, manufacture, validation and implementation of the CompoZr Custom ZFN Service.

Genome Editing mit CompoZr Benutzerdefinierte Zinkfinger Nukleasen (ZFNs)

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such ...

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present methods for the development of assays to query potentially clinically significant nonsynonymous changes using in vivo complementation in zebrafish. Zebrafish (Danio rerio) are a useful animal system due to their experimental tractability; embryos are transparent to enable facile viewing, undergo rapid development ex vivo, and can be genetically manipulated.1 These aspects have allowed for significant advances in the analysis of embryogenesis, molecular processes, and morphogenetic signaling. Taken together, the advantages of this vertebrate model make zebrafish highly amenable to modeling the developmental defects in pediatric disease, and in some cases, adult-onset disorders. Because the zebrafish genome is highly conserved with that of humans (~70% orthologous), it is possible to recapitulate human disease states in zebrafish. This is accomplished either through the injection of mutant human mRNA to induce dominant negative or gain of function alleles, or utilization of morpholino (MO) antisense oligonucleotides to suppress genes to mimic loss of function variants. Through complementation of MO-induced phenotypes with capped human mRNA, our approach enables the interpretation of the deleterious effect of mutations on human protein sequence based on the ability of mutant mRNA to rescue a measurable, physiologically relevant phenotype. Modeling of the human disease alleles occurs through microinjection of zebrafish embryos with MO and/or human mRNA at the 1-4 cell stage, and phenotyping up to seven days post fertilization (dpf). This general strategy can be extended to a wide range of disease phenotypes, as demonstrated in the following protocol. We present our established models for morphogenetic signaling, craniofacial, cardiac, vascular integrity, renal function, and skeletal muscle disorder phenotypes, as well as others.

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present a systematic approach for developing physiologically relevant, sensitive and specific in vivo assays for interpreting variation in human pathology. Transient genetic manipulation via microinjection of WT and mutant human mRNA and morpholino (MO) antisense oligonucleotides harness the tractability of the developing zebrafish embryo to rapidly assay pathogenic mutations, especially, but not exclusively, in the context of human developmental disorders.

In Vivo Modellierung des Morbid Human Genome mit Danio rerio

Here,  we present methods for the development of assays to query potentially clinically  significant nonsynonymous changes using in  vivo complementation ...

Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases (TALENs)

Identifying alleles of genes underlying evolutionary change is essential to understanding how and why evolution occurs. Towards this end, much recent work has focused on identifying candidate genes for the evolution of traits in a variety of species. However, until recently it has been challenging to functionally validate interesting candidate genes. Recently developed tools for genetic engineering make it possible to manipulate specific genes in a wide range of organisms. Application of this technology in evolutionarily relevant organisms will allow for unprecedented insight into the role of candidate genes in evolution. Astyanax mexicanus (A. mexicanus) is a species of fish with both surface-dwelling and cave-dwelling forms. Multiple independent lines of cave-dwelling forms have evolved from ancestral surface fish, which are interfertile with one another and with surface fish, allowing elucidation of the genetic basis of cave traits. A. mexicanus has been used for a number of evolutionary studies, including linkage analysis to identify candidate genes responsible for a number of traits. Thus, A. mexicanus is an ideal system for the application of genome editing to test the role of candidate genes. Here we report a method for using transcription activator-like effector nucleases (TALENs) to mutate genes in surface A. mexicanus. Genome editing using TALENs in A. mexicanus has been utilized to generate mutations in pigmentation genes. This technique can also be utilized to evaluate the role of candidate genes for a number of other traits that have evolved in cave forms of A. mexicanus.

Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases TALENs

Gene-targeting mutagenesis is now possible in a wide range of organisms using genome editing techniques. Here, we demonstrate a protocol for targeted gene mutagenesis using transcription activator like effector nucleases (TALENs) in Astyanax mexicanus, a species of fish that includes surface fish and cavefish.

Genome Editing in<em&gt; Astyanax mexicanus</em&gt; Verwendung von Transkriptionsaktivator- artigen Effektor Nukleasen (Talens)

Identifying alleles of genes underlying evolutionary change is essential to understanding how and why evolution occurs.  Towards this end, much recent ...