This research was supported by Cleveland State University Faculty Development Funds.

1. Herstellung von Parasite Zellkulturen, Sammlung von Parasite Pellets <ol><li> Vorbereitung RPMI-1640-HEPES Medien durch Zugabe von 10 g RPMI-1640-Pulver, 66 mg Gentamicinsulfat, 2 g Natriumbicarbonat, 5,9 g HEPES-Puffer, 50 mg Hypoxanthin und 3,8 g Dextrose in 1 l sterilem dH 2 O. Mischen Sie mit Hilfe der Tabelle Magnetrührer, bis das Pulver löst sich in 1 L destilliertem Wasser. Zuführen Mikrofiltration von Medien unter Verwendung von 0,22 um Filter. Lagern Sie das Material in sterile Flaschen. </li><li> Waschen Sie nicht infiziert (frisch) Typ A + Erythrozyten mit RPMI. Bereiten Sie 5% Hämatokrit von Erythrozyten (0,5 ml frisch gewaschenen Erythrozyten in 9,5 ml 10% RPMI + Humanserum). </li><li> Machen Sie 15% Humanserum + RPMI (15 ml Humanserum und 85 ml RPMI), den Anbau von Parasiten zu initiieren. Machen 10% Humanserum und RPMI (10 ml Humanserum und 90 ml RPMI) nach Kultivierung von Parasiten in Erythrozyten fortzusetzen. </li><li> Kultur P. falciparum (3D7 und FCR-3 Stämme) in TypA + menschlichen Erythrozyten bei 5% Hämatokrit und 20% Parasitämie in Petrischale oder einer 75 cm 3 Kulturflasche. Aufrechtzuerhalten Kultur in vitro nach der Methode von Trager und Jensen Kerzenfläschchen 26. Alternativ halten Kulturen sind im Inkubator bei 37 ° C aufrechterhalten 9,5% CO 2 und 3,4% N &amp; sub2; -Gas. Kultur P. falciparum in RPMI 1640-Medium HEPES mit 10% Humanserum. </li><li> Synchronisieren P. falciparum Kultur durch Zugabe von 65% Percoll (65 ml Percoll + 35 ml RPMI-1640 ohne Humanserum) zur Kulturkonzentrat 27. </li><li> Zentrifugieren Sie die Kultur-Konzentrat mit Percoll bei 2500 xg für 5 min, die in 3 Schichten führt. Vorsichtig mit einer Transferpipette isolieren Schizonten von der mittleren Schichtübertragung in ein separates Röhrchen unter aseptischen Bedingungen 27. </li><li> Die isolierten Kulturen mit 10% Humanserum + RPMI-1640 zweimal zu waschen, um überschüssige Percoll durch Zentrifugation bei 7500 × g für 5 Minuten entfernt werden. DiSCARD der Überstand jedes Mal unter aseptischen Bedingungen 27. </li><li> Weiter Kultivieren des synchronisierten P. falciparum-Schizonten in 10% Humanserum + RPMI-1640 27. </li><li> Sammeln Schizonten durch Behandeln Plasmodium infizierten Erythrozyten mit 10 mM Tris pH 8,8 und Zentrifugieren bei 15000 × g für 15 min 23. Speicher Parasiten Pellets bei -70 ° C nach Zugabe von 5 ul Protease-Inhibitor (Aprotinin) auf das Granulat. Verwenden Parasiten Pellets für Proteinextraktion, genomische DNA Isolierung und RNA-Isolierung. </li></ol> 2. Vorbereitung Plasmid Vektor <ol><li> Isolieren genomischer DNA aus P. falciparum Schizont Pellets aus Kulturen von etwa 20% Parasitämie hergestellt. </li><li> Mit 600 &amp; mgr; l 10 mM Tris-HCl pH 7,6, 50 mM EDTA pH 8,0, 0,1% SDS und 1 mg / ml Proteinase K, um Pellets in ein Mikrozentrifugenröhrchen, homogenisieren Pellet unter Verwendung einer 1 ml Spritze mit einer 26 G Nadel. Alternate Befüllen der Spritzemit der Granulatmischung und Entleeren in einem Mikrozentrifugenröhrchen 20 mal. Das Röhrchen haltige Homogenisat O / N in einem 50 ° C Wasserbad. </li><li> Führen Phenol - Chloroform (P + C) Extraktion durch Zugabe von 600 &amp; mgr; l von P + C (300 ul Phenol und 300 ul Chloroform) homogenisierte Pellet. Cap Röhrchen fest und die Mischung kräftig schütteln durch Umkehren Rohr End-to-End. Zentrifugenröhrchen bei 14.000 × g für 2 min und sammeln obere wässrige Lösung mit einer Mikropipette in ein neues Mikrozentrifugenröhrchen. Wiederholen Sie diesen Schritt zweimal. </li><li> Mit 600 &amp; mgr; l Chloroform zu der wäßrigen Schicht in den neuen Rohrs aus Schritt 2.1.2. Das Röhrchen vortexen für 10 sec und Zentrifuge bei 14.000 × g für 2 min. Messen die obere wässrige Schicht wurde mit einer Mikropipette und überträgt es zu einem neuen Reaktionsgefäß. </li><li> In 0,1 Vol von 5 M Natriumacetat pH 5,5 und 1 Vol Isopropanol (wenn wässrige Schicht ist 300 ul fügen 30 ul 5 M Natriumacetat pH 5,5 + 330 ul Isopropanol) zu wässrigen Laiener von Schritt 2.1.3. Das Röhrchen bei RT für 15 min. </li><li> Zentrifugieren Sie die Röhrchen bei 14.000 × g für 10 min, um DNA-Pellet auszufällen. Überstand verwerfen und Pellet Waschen mit 100 ul 70% Ethanol (70 ul Ethanol und 30 ul dH &amp; sub2; O), um überschüssiges Salz aus der DNA zu entfernen. Speicher DNA in 50 ul dH &amp; sub2; O bei -20 ° C. </li><li> Gestalten Sie Vorwärts- und Rückwärtsprimer unter Verwendung von Software oder manuell zur Amplifikation von P. falciparum Genen PF3D7_1361800, PF3D7_0925900, PF3D7_1436300 und PF3D7_0114100 zuvor in Proteomstudien 16,18 mit geeigneten Restriktionsstellen, um die Klonierung der Gensequenzen in die multiplen Klonierungsstellen von Expressionsplasmid pT7CFE1-ChiS Bedingungen zulassen, wie in Tabelle 2 gezeigt. </li><li> Machen Sie eine 50 &amp; mgr; l Reaktionsmischung durch Zugabe; 5 ul der isolierten P. falciparum genomische DNA, 5 ul 10x-Puffer, 5 ul MgCl 2, 1,5 &amp; mgr; l Vorwärts-Primer, 1,5 ulRückwärts-Primer, 0,5 &amp; mgr; l T7-DNA-Polymerase und 31,5 &amp; mgr; l dH 2 O und führen Polymerasekettenreaktion (PCR) bei 94 ° C für 8 min zur Denaturierung, 50 ° C für 1 min 30 sec für die Erweiterung und 72 ° C für 9 min zum Tempern und Renaturierung zum Verstärken in Tabelle 1 gezeigten Genen. </li><li> Getrennte PCR-Produkte auf 1% Agarose-Gel (1 g Agarose und 100 ml Tris-Acetat-EDTA (TAE) -Puffer) 32. </li><li> Schneiden Sie die PCR-amplifizierte DNA-Banden aus dem Agarose-Gel, legen Sie die Gelscheiben DNA enthält, in einem DNA-Gel Extraction Spin-Säule und bei -20 ° C für 5 min. 100 l Isopropanol zu den gefrorenen Gelscheiben und Zentrifuge bei 14.000 xg für 5 min. </li><li> Messung der wässrigen Durchströmung in das Sammelrohr aus Schritt 2.5 filtriert Verwendung einer Mikropipette und Transfer in ein neues Gefäß. Mit 0,1 Vol von 5 M Natriumacetat und Zentrifuge bei 14.000 × g für 5 min. Überstand verwerfen und fügen Sie 10 ul dH 2 O zu the DNA-Pellet. </li><li> Verdauen die pT7CFE1-ChiS Expressionsvektor und gereinigte DNA-Fragmente (2,6) in zwei getrennten Röhrchen durch Zugabe von 3 ul von Plasmid und 5 ul PCR-Genprodukte in jedes Röhrchen. In jedes Röhrchen wurden 1 ul von spezifischen Restriktionsenzymen, 2 ul Reaktionspuffer und 14 ul dH 2 O. </li><li> Werden 3 ul verdauten Plasmid, 5 ul verdauten DNA-Fragmente, 2 ul 10fach Ligasepuffer, 1 ul Ligase und 9 &amp; mgr; l dH 2 O in ein Mikrozentrifugenröhrchen. Inkubation bei 12 ° CO / N. </li><li> Mit 0,1 vol 3 M Natriumacetat bei pH 5,5 und 2 Volumen Ethanol (wenn die Ligationsröhrchen Volumen beträgt 20 &amp; mgr; l add 2 ul 3 M Natriumacetat + 44 ul Ethanol), um die Röhre aus dem Schritt 2.14. Gut mischen und Inkubation bei -20 ° C für 15 min. </li><li> Zentrifugieren Sie die Röhrchen bei 14.000 × g für 15 min. Den Überstand mit einem Mikro-Pipette vorsichtig entfernen, ohne das Pellet zu stören. </li><li> 100 ul 70% Ethanol to des Pellets aus Schritt 2.10. Zentrifugieren Sie die Röhrchen bei 14.000 xg für 5 min. Entfernen und entsorgen Sie den Überstand. Zugabe von 10 &amp; mgr; l Nuklease-freies Wasser auf die DNA-Pellet. </li></ol> 3. Protein Expression mittels in vitro Menschliche Zelle Kostenlose Expression System <ol><li> Es werden 20 &amp; mgr; l-Transkriptionsmischung durch Messung 2 ul des rekombinanten pT7CFE1-ChiS Plasmid-DNA, 4 ul 5x Transkriptionspuffer, 4 ul NTP-Mix, 2 &amp; mgr; l T7-RNA-Polymerase und 8 &amp; mgr; l Nuklease-freies Wasser für 2-Schritt humanen in vitro Proteinexpression mit Hilfe von DNA-Templates. Mischungskomponenten in einem Mikrozentrifugenröhrchen und Inkubation für 75 min bei 30 ° C in einem Wasserbad. </li><li> Take 2 ul der Transkriptionsansatz und auf 23 &amp; mgr; l Translationsgemisch, das 12,5 &amp; mgr; l von HeLa-Zelllysat, 2,5 ul akzessorischen Proteinen, 1 &amp; mgr; l Salzlösung A, 0,5 &amp; mgr; l der Aminosäuren Met, 0,5 ul von Aminosäuren hinzuzufügen Leu, 181; l RNase-Inhibitor, 1,25 ul des Energiemix und 3,75 ul Nuklease-freies Wasser. </li><li> Inkubieren Übersetzung Mischung aus Schritt 3.2 bei 30 ° C für 90 min. Speicher Translationsprodukte bei -20 ° C. </li><li> Vorbereitung 25 ul der Transkription und Translationsgemisch durch Zugabe von 3 &amp; mgr; l der rekombinanten pT7CFE1-ChiS Plasmid-DNA, 2 &amp; mgr; l Nuklease-freies Wasser, 5 ul der Reaktionsmischung wurden 12,5 ul HeLa Lysat und 2,5 ul Helferproteine ​​für 1-Schritt menschliche Coupled IVT Protein Expression der DNA-Vorlagen. </li><li> Inkubieren der Reaktionsmischung aus Schritt 3.4 für 90 min bis 6 h bei 30 ° C. Bewahren Sie die Übersetzung Produkte bei -20 ° C. </li></ol> 4. Reinigung des exprimierten rekombinanten Proteins <ol><li> Hinzuzufügen 75 ul 1x Reinigungspuffer auf 25 &amp; mgr; l Translationsprodukt zu 100 ul Reinigungsmischung herzustellen. </li><li> 100 l Nickel Chelatharz zu 100 ul Reinigungs mixture. Wasch Ni-Harz zweimal durch Zugabe von 300 &amp; mgr; l dH 2 O und 300 &amp; mgr; l Bindungspuffer. Re-suspend Harz und Zentrifuge bei 14.000 · g für 1 min, um überschüssiges Ethanol zu entfernen. </li><li> 100 l Reinigungsmischung aus Schritt 4,2 bis 100 &amp; mgr; l von Nickel Chelatharz und Inkubieren des Gemisches für 60 min bei RT. </li><li> Zentrifugieren der Mischung bei 14.000 · g für 1 min und sammeln Stand in ein frisches Röhrchen als &quot;durchströmen&quot; gekennzeichnet. </li><li> Wasch Harz mit 100 ul 1x-Waschpuffer (20 mM Imidazol, 250 mM NaH 2 PO 4 bei pH 8, 2,5 M NaCl und dH 2 O). Zentrifuge bei 14.000 · g für 1 min und sammeln Stand in frisches Röhrchen &quot;wash&quot; gekennzeichnet. Wiederholen Sie Schritt 4.5 zweimal. </li><li> 100 ul 1x Elutionspuffer (100 mM Imidazol, 250 mM Na 2 PO 4, pH 8,0, 2,5 M NaCl und dH 2 O), um das Harz und die Proben für 15 min. Zentrifugieren bei 14.000 × g für 1 min. Haben die Elutionsschritt zweimal. JederZeit zu sammeln Überstand in frische Reaktionsgefäße und Label als &quot;Eluat&quot;. </li><li> Nach der Elution waschen Harz zweimal, wie in Schritt 4.5 beschrieben. Shop durch, wäscht und Elution Proben fließen bei -20 ° C oder niedriger. Harz muß bei 4 ° C gelagert werden. Verwenden 30 ul jeder Probe für die SDS-PAGE und Immunoblotting-Analyse. </li></ol> 5. Coomassie (Bradford) Protein Assay 34 <ol><li> Sind Standardrinderserumalbumin (BSA) Lösung mit der Konzentration 20 ug / ml (Mischungs 10 ul BSA (2 mg / ml) und 90 ul dH &amp; sub2; O), 40 ug / ml (Mischungs 20 ul BSA (2 mg / ml) und 80 ul dH &amp; sub2; O), 60 ug / ml (Mischungs 30 ul BSA (2 mg / ml) und 70 ul dH &amp; sub2; O), 80 ug / ml (Mischungs 40 ul BSA (2 mg / ml) und 60 ul dH &amp; sub2; O), 100 ug / ml (Mischungs 50 ul BSA (2 mg / ml) und 50 ul dH &amp; sub2; O), 160 ug / ml (Mischungs 80 ul BSA (2 mg / ml) und 20 ul dH2 O) und 200 ug / ml (100 ul BSA (2 mg / ml). </li><li> Maßnahme 5 ul der Strömung durch, wäscht und Eluat-Proben von Schritt 4.7. Hinzuzufügen 95 ul dH 2 O. </li><li> 5 ml Coomassie-Blau-Reagens zu den Mischungen aus den Schritten 5.1 und 5.2. Decken Sie die Röhrchen mit Parafilm und Vortex für 10 Sekunden, dann für 20 min bei RT inkubieren. </li><li> Verwendung eines Spektrophotometers, Die optische Dichte (OD) bei einer Wellenlänge von 650 nm für die Proteinröhrchen aus Schritt 5.3. Plot Konzentration gegen OD Lesen, um die Proteinkonzentrationen 34 zu bestimmen. </li></ol> 6. Western Blotting <ol><li> In 5 ul Schizont Extrakte aus P. falciparum, 2 ul von Escherichia coli exprimierte rekombinante Proteine ​​rhOP-3 31, 5 &amp; mgr; l der rekombinanten Proteine ​​exprimiert unter Verwendung von 2-Schritt-und 1-Schritt in vitro menschliche Expressionssystemen und 10 ul Protein-Produkte wurden gereinigt unter Verwendung von Affinitätsverfahren, um Rohre zu trennen. </li&gt; <li> Hinzuzufügen Elektrophorese-Probenpuffer, enthaltend Mercaptoethanol in jedes Röhrchen bis zu einem Endvolumen von 20 ul zu solubilisierten Proteins Proben bilden. Sieden Rohre für 2 min. </li><li> Laden solubilisierten Proteins Proben auf 10% SDS-PAGE-Gelen, um die Proteine ​​zu trennen. </li><li> Übertragen getrennten Proteine ​​von SDS-PAGE-Gelen auf Nitrozellulosepapier (NCP) durch Elektrophorese bei 35 mA pro Gel in einem halbtrockenen Westernblot Kammer für 2 Stunden. </li><li> Block NKS folgende Übertragungs mit 2% Magermilch. </li><li> Inkubation blockiert NKS mit den folgenden polyklonalen Antikörpern 1: 100 verdünnt in 2% Milch Western-Blot durchzuführen; Kaninchen-Antikörper # 676 21 spezifisch für P. falciparum Merozoiten Rhoptrien, Maus-Antikörper 20 spezifisch für P. yoelii und P. berghei Merozoiten Rhoptrien Antiseren # 685 spezifisch für das P. falciparum parasitophoren Vakuole Protein, SERA (Serin-reiche Antigen) 22 und Antikörper, die für die Maurer217; s Spalte Protein PFMC-2TM 28. </li><li> Inkubieren NKS auch in 1: 100 verdünnt normale Maus und Kaninchen-Serum und verbrachten Kulturüberstand (SCS) von SP2-Myelomzellen als Negativkontrollen. </li><li> Inkubieren NKS mit Antikörpern und Kontrollen bei 4 ºC O / N. </li><li> Wash NKS 4x mit Blot-Puffer und Inkubation NKS mit artspezifischen Sekundärantikörper mit Meerrettich-Peroxidase (HRP) konjugiert 1: 1000 verdünnt in 2% Milch. </li><li> Wash NKS 4x mit Blot-Puffer. Inkubiere gewaschen NCPs mit der Farbentwicklungslösung A + B (Lösung A: in 50 ml 1x Blot-Puffer und 30 ul H &amp; sub2; O &amp; sub2; Lösung B: 10 ml Methanol und 30 mg 3-Chlor-naphtol) 30 min in Dunkelheit. Western-Blot-Analyse Ergebnisse kolorimetrisch. </li></ol>

<ol>
	<li>Alexandrov, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Leishmania.+cell-free+expression+system.">Leishmania. cell-free expression system.</a> Methods. 55 (1), 58-64 (2011).</li><li>Alexandrov, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Towards+the+construction+of+expressed+proteomes+using+a+Leishmania+tarentolae.+based+cell-free+expression+system.">Towards the construction of expressed proteomes using a Leishmania tarentolae. based cell-free expression system.</a> PLOS One. 5 (12), e14388 (2010).</li><li>Baca, A. M., Hol, W. G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overcoming+codon+bias:+A+method+for+high-level+over-expression+of+Plasmodium.+and+other+AT-rich+parasite+genes+in+Escherichia+coli.">Overcoming codon bias: A method for high-level over-expression of Plasmodium. and other AT-rich parasite genes in Escherichia coli.</a> Int J Parasitol. 30 (2), 113-118 (2000).</li><li>Birkholtz, L. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterologous+expression+of+plasmodial+proteins+for+structural+studies+and+functional+annotation.">Heterologous expression of plasmodial proteins for structural studies and functional annotation.</a> Malar. J. 7, 197 (2008).</li><li>Doolan, D. L., Mu, Y., Unal, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Profiling+humoral+immune+responses+to+P.+falciparum.+infection+with+protein+microarrays.">Profiling humoral immune responses to P. falciparum. infection with protein microarrays.</a> Proteomics. 8 (22), 4680-4694 (2008).</li><li>Endo, Y., Sawasaki, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-free+expression+systems+for+eukaryotic+protein+production.">Cell-free expression systems for eukaryotic protein production.</a> Curr. Opin. Biotechnol. 17 (4), 373-380 (2006).</li><li>Fern&#225;ndez-Robledo, J. A., Vasta, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+recombinant+proteins+from+protozoan+parasites.">Production of recombinant proteins from protozoan parasites.</a> Trends Parasitol. 26 (5), 244-254 (2010).</li><li>Gowda, D. C., Davidson, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+glycosylation+in+the+malaria+parasite.">Protein glycosylation in the malaria parasite.</a> Parasitol. Today. 15 (4), 147-152 (1999).</li><li>Goshima, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+protein+factory+for+converting+the+transcriptome+into+an+in+vitro-expressed+proteome.">Human protein factory for converting the transcriptome into an in vitro-expressed proteome.</a> Nat. Methods. 5, 1011-1017 (2008).</li><li>Hinnebusch, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Mechanism and regulation of initiator methionyl-tRNA binding to ribosomes. 5, 185-243 (2000).</li><li>Hino, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficiency+of+cell-free+protein+synthesis+based+on+a+crude+cell+extract+from+Escherichia+coli.,+wheat+germ,+and+rabbit+reticulocytes.">Efficiency of cell-free protein synthesis based on a crude cell extract from Escherichia coli., wheat germ, and rabbit reticulocytes.</a> Journal of Biotechnology. 133 (2), 183-189 (2008).</li><li>Le Roch, K. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+gene+function+by+expression+profiling+of+the+malaria+parasite+life+cycle.">Discovery of gene function by expression profiling of the malaria parasite life cycle.</a> Science. 301 (5639), 1503-1508 (2003).</li><li>Makrides, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strategies+for+achieving+high-level+expression+of+genes+in+Escherichia+coli.">Strategies for achieving high-level expression of genes in Escherichia coli.</a> Microbiol. Rev. 60 (3), 512-538 (1996).</li><li>Mehlin, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterologous+expression+of+proteins+from+Plasmodium+falciparum.:+results+from+1000+genes.">Heterologous expression of proteins from Plasmodium falciparum.: results from 1000 genes.</a> Mol. Biochem. Parasitol. 148 (2), 144-160 (2006).</li><li>Mikami, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+human+cell-derived+in+vitro+coupled+transcription/translation+system+optimized+for+production+of+recombinant+proteins.">A human cell-derived in vitro coupled transcription/translation system optimized for production of recombinant proteins.</a> Protein Expr. Purif. 62 (2), 190-198 (2008).</li><li>Sam-Yellowe, T. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteome+analysis+of+rhoptry:+Enriched+isolated+from+Plasmodium.+merozoites.">Proteome analysis of rhoptry: Enriched isolated from Plasmodium. merozoites.</a> Journal of Proteome Research. 3 (5), 995-1001 (2004).</li><li>Sam-Yellowe, T. Y., Fujioka, H., Aikawa, M., Hall, T., Drazbar, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasmodium+falciparum.+protein+located+in+Maurer&#8217;s+clefts+underneath+knobs+and+protein+localization+in+association+with+Rhop-3+and+SERA+in+the+intracellular+network+of+infected+erythrocytes.">Plasmodium falciparum. protein located in Maurer&#8217;s clefts underneath knobs and protein localization in association with Rhop-3 and SERA in the intracellular network of infected erythrocytes.</a> Parasitol Res. 87 (3), 173-185 (2001).</li><li>Sam-Yellowe, T. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Plasmodium.+gene+family+encoding+Maurer&#8217;s+cleft+membrane+proteins:+Structural+properties+and+expression+profiling.">A Plasmodium. gene family encoding Maurer&#8217;s cleft membrane proteins: Structural properties and expression profiling.</a> Genome Res. 14 (6), 1052-1059 (2004).</li><li>Sam-Yellowe, T. Y., Banks, T. L., Fujioka, H., Drazba, J. A., Yadav, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasmodium+yoelii.:+Novel+rhoptry+proteins+identified+within+the+body+of+merozoite+rhoptries+in+rodent+Plasmodium+malaria.">Plasmodium yoelii.: Novel rhoptry proteins identified within the body of merozoite rhoptries in rodent Plasmodium malaria.</a> Exp Parasitol. 120 (1), 113-117 (2008).</li><li>Sam-Yellowe, T. Y., Rio, D., Fujioka, H., Aikawa, M., Yang, J. C., Yakubu, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+merozoite+rhoptries,+identification+of+novel+rhoptry+associated+proteins+from+P.+yoelii.,+P.+chabaudi.,+P.+berghei.+and+conserved+interspecies+reactivity+of+organelles+and+proteins+with+P.+falciparum.+rhoptry-specific+antibodies.">Isolation of merozoite rhoptries, identification of novel rhoptry associated proteins from P. yoelii., P. chabaudi., P. berghei. and conserved interspecies reactivity of organelles and proteins with P. falciparum. rhoptry-specific antibodies.</a> Exp Parasitol. 89 (3), 271-284 (1998).</li><li>Sam-Yellowe, T. Y., Fujioka, H., Masamichi, A., Messineo, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasmodium+falciparum.+rhoptry+proteins+of+140/130/110kd+(Rhop-H)+are+located+in+an+electron+lucent+compartment+in+the+neck+of+the+rhoptries.">Plasmodium falciparum. rhoptry proteins of 140/130/110kd (Rhop-H) are located in an electron lucent compartment in the neck of the rhoptries.</a> J Euk Microbial. 42 (3), 224-231 (1995).</li><li>Sam-Yellowe, T. Y., Hishashi, F., Masamichi, A., Messineo, D. G., Leash, A. M., Hall, T., Drazba, J. A., Ndengele, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+Organization+and+cross+linking+analysis+of+the+Plasmodium+falciparum+erythrocyte+binding+proteins+Rhop-H+and+SERA.">Molecular Organization and cross linking analysis of the Plasmodium falciparum erythrocyte binding proteins Rhop-H and SERA.</a> J Protozool. Res. 10 (3), 128-154 (2000).</li><li>Sam-Yellowe, T. Y., Shio, H., Perkins, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Secretion+of+Plasmodium+falciparum.+rhoptry+protein+into+plasma+membrane+of+host+erythrocytes.">Secretion of Plasmodium falciparum. rhoptry protein into plasma membrane of host erythrocytes.</a> J Cell Biol. 106 (5), 1507-1513 (1988).</li><li>Sundaresh, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+humoral+immune+responses+in+protein+microarrays+using+DNA+microarray+data+analysis+techniques.">Identification of humoral immune responses in protein microarrays using DNA microarray data analysis techniques.</a> Bioinformatics. 22 (14), 1760-1766 (2006).</li><li>Terpe, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overview+of+bacterial+expression+systems+for+heterologous+protein+production:+from+molecular+and+biochemical+fundamentals+to+commercial+systems.">Overview of bacterial expression systems for heterologous protein production: from molecular and biochemical fundamentals to commercial systems.</a> Appl. Microbiol. Biotechnol. 72 (2), 211-222 (2006).</li><li>Trager, W., Jensen, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+malaria+parasites+in+continuous+culture.">Human malaria parasites in continuous culture.</a> Science. 193 (4254), 673-675 (1976).</li><li>Tsarukyanova, I., Drazba, J. A., Fujioka, H., Yadav, S., Sam-Yellowe, T. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteins+of+the+Plasmodium+falciparum.+two+transmembrane+Maurer&#8217;s+cleft+protein+family,+PfMC-2TM+and+the+130+kDa+Maurer&#8217;s+cleft+protein+define+different+domains+of+the+infected+erythrocyte+intramembranous+network.">Proteins of the Plasmodium falciparum. two transmembrane Maurer&#8217;s cleft protein family, PfMC-2TM and the 130 kDa Maurer&#8217;s cleft protein define different domains of the infected erythrocyte intramembranous network.</a> Parasitol Res. 104 (4), 875-891 (2009).</li><li>Tsuboi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wheat+germ+cell-free+system-based+production+of+malaria+proteins+for+discovery+of+novel+vaccine+candidates.">Wheat germ cell-free system-based production of malaria proteins for discovery of novel vaccine candidates.</a> Infect. Immun. 76 (4), 1702-1708 (2008).</li><li>Tsuboi, T., Takeo, S., Sawasaki, T., Torii, M., Endo, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+approach+to+the+production+of+vaccines+against+the+malaria+parasite.">An efficient approach to the production of vaccines against the malaria parasite.</a> Methods in Mol. Biol. 607, 73-83 (2010).</li><li>Wang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+versatile+protein+microarray+platform+enabling+antibody+profiling+against+denatured+proteins.">A versatile protein microarray platform enabling antibody profiling against denatured proteins.</a> Proteomics Clin. Appl. 7 (5-6), 378-383 (2013).</li><li>Wang, T., Fujioka, H., Drazba, J. A., Sam-Yellowe, T. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rhop-3+protein+conservation+among+Plasmodium.">Rhop-3 protein conservation among Plasmodium.</a> species and induced protection against lethal. 99 (3), 238-252 (2006).</li><li>Yadavalli, R., Ledger, C., Sam Yellowe, T. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+human+cell+free+expression+for+synthesis+of+malaria+proteins.">In vitro human cell free expression for synthesis of malaria proteins.</a> Parasitol Res. 111 (6), 2461-2465 (2012).</li><li>Machida, K., Masutan, M., Imataka, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+Synthesis+in+vitro.:+Cell-Free+Systems+Derived+from+Human+Cells.">Protein Synthesis in vitro.: Cell-Free Systems Derived from Human Cells.</a> Intech. , (2012).</li><li>Bradford, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+and+sensitive+method+for+the+quantification+of+microgram+quantities+of+protein+utilizing+the+principle+of+protein-dye+binding.">A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding.</a> Anal Biochem. 72, 248-254 (1976).</li></ol>

We do not have any competing financial interests in this study.

Die wichtigsten Schritte zur erfolgreichen Expression von Proteinen unter Verwendung von zweistufigen in vitro menschliche Zelle frei Expressionssystem und Reinigung sind: 1) eine erfolgreiche Amplifikation und Klonierung von Genen in pT7CFE-ChiS Plasmidvektor; 2) Transkription RNA bei 30 o C; 3) Übersetzung von Protein bei 30 ° C in Gegenwart von RNAse-Inhibitor; 4) Entwicklung der Affinität basiert Reinigungsprotokoll mit Harzkügelchen mit Ni und 5 beschichtet) Analyse der Ergebnisse auf Western-Blot unter Verwendung von polyklonalen und monoklonalen Antikörpern. Die wichtigsten Schritte zur erfolgreichen Expression von Proteinen unter Verwendung von einem Schritt IVT gekoppelten Protein-Translation-Systems sind: 1) eine erfolgreiche Amplifikation und Klonierung von Genen in pT7CFE-ChiS Plasmidvektor; 2) Transkription und Translation der Proteine ​​bei 30 ° C; 3) Entwicklung der Affinität basiert Reinigungsprotokoll mit Harzkügelchen mit Ni und 4 beschichtet) Analyse der Ergebnisse auf Western-Blot unter Verwendung von polyklonalen und monoklonalen Antikörpern. Stromly, zellfreie Expressionssysteme sind für die Expression von rekombinanten Malaria-Proteine ​​verwendet. Die kritischen Merkmale der zellfreie Expressionssysteme, um Malaria-Proteine ​​zu exprimieren ist die Fähigkeit, AT-reiche Gene entschlüsseln, ein Mangel an lang translationale Pause, erfolgreiche Expression von wiederholten Aminosäuresequenzen, mangelnde Glykosylierung Mechanismen und die Fähigkeit der Plasmide, um Gen-Trunkierung steuern. In dieser Studie wurde die Verwendung eines Zwei-Schritt in vitro menschliche Zelle frei Expressionssystem 32 und ein Ein-Schritt-IVT gekoppelt Übersetzungssysteme für die Expression von P. zeigen wir, falciparum Gen Orthologe von P. yoelii Merozoiten rhoptry Gene wie in Tabelle 1 gezeigt. Ein Reinigungsprotokoll wurde entwickelt und zum Reinigen von Mikrovolumina von rekombinanten Proteinen aus 1-Punkt- oder 2-Schritt in vitro menschliche Zelle freie Expressionssysteme erhalten optimiert. 4 P. falciparum Genen PF3D7_0114100 eine Trans hydrophobes Protein, ein vorhergesagtes hypothetischen ARM WiederholungsProtein PF3D7_1361800 und ein hydrophiles Protein PF3D7_0925900, wurden unter Verwendung einer 2-Schritt-und 1-Schritt in vitro menschliche Zelle freie Expressionssystem exprimiert. Gereinigtes Proteinausbeuten wurden bestimmt. Das Protein pFMC-2TM wurde in diesen Studien eingeschlossen, da es ein integrales Membranprotein mit zwei Transmembrandomänen, und wir waren daran interessiert festzustellen, ob die in vitro-Expressionssystem kann vollständig das Transmembranprotein exprimieren und ermöglichen eine einfache Reinigung. Der Schlüsselunterschied in den beiden einen Schritt und Zwei-Schritt-Expressionssystemen ist, dass die Zwei-Schritt-Expressionssystem ist ein mRNA-abhängiges System, in dem eine stabile mRNA transkribiert und zu der Translationsreaktion. Dagegen ist die einen Schritt in vitro gekoppelten Transkriptions / Übersetzungssystem beinhaltet eine kontinuierliche Zufuhr von Transkription und mRNA, gefolgt von dem Co-Translation von Protein während der Reaktion. Sowohl 1-Schritt-IVT-Transkription / Translation gekoppelt expression System und 2-Schritt in vitro menschliche Zelle frei Expressionssystems wurden für die Expression der hochmolekularen Proteinen getestet. Beide Systeme waren in exprimieren niedermolekulare rekombinante Proteine ​​erfolgreich. In der 1-Schritt-Expressionssystem wurde Antikörper Kreuzreaktivität mit Proteinen in der Übersetzungsreaktionsgemisch beobachtet. Die spezifischen Proteine ​​überqueren Reaktion mit den Antikörpern sind unbekannt und müssen weitere Untersuchungen. Expression der hochmolekularen Proteine ​​erfolgreich war sowohl mit dem 1-Schritt-und 2-Schritt-Systeme. Eine Reinigungsprotokoll wurde zur Reinigung von Mikrovolumina von rekombinanten Proteinen unterschiedlicher Löslichkeitseigenschaften entwickelt ausgedrückt unter Verwendung von sowohl 1-Schritt und 2-Schritt in vitro menschliche Zelle freie Expressionssysteme. Proteine ​​wurden erfolgreich gereinigt und die erhaltene Ausbeute betrug 3,5 ug pro 25 ul bei Expression unter Verwendung von 2-Schritt in vitro-Proteintranslationssystem, und 1,5 &amp; mgr; g pro 25 &amp; mgr; l, wenn sie mit dem 1-Schritt-übersetzte IVT-Protein-Expressionssystem. Expression von Proteinen mit niedrigem Molekulargewicht reicht von 18 kDa bis 37 kDa ist reproduzierbar und geradlinig. , Führt jedoch Ausdruck mit hohem Molekulargewicht in Protein Verkürzungen. Aufgrund der für die klonierte DNA erhaltenen Mikrovolumina wurde die PCR-Amplifikation verwendet werden, um klonierte Produkte zu verifizieren. Mögliche Hindernisse für die Expression von hochmolekularen Proteinen unter Verwendung von zellfreien Expressionssystemen konnte konstant Phosphorylierung eIF2 alpha-Untereinheit ist aufgrund der hohen Konzentration von ATP in der Reaktion. Dies beeinträchtigt die Translationsinitiation in dem System, die während der Synthese von großen Proteinen in zellfreien Expressionssystemen 10 möglicherweise beeinflußt die Verlängerung der Proteinsynthese. Das hier beschriebene Protokoll wird von Optimierungsbedingungen für die Expression von Proteinen unbeeinflusst. Weder die Gen-Codons noch der Plasmid enthielten, wurden zur Expression von Proteinen optimiert und Proteinrückfaltung nicht erforderlich war. Dieses System drückt proteins in 3 h und die Reinigung des Proteins kann in 2 h erhalten werden, die eine weitere nachfolgende Anwendungen wie Verarbeitung des rekombinanten Proteins für die Immunisierung oder Peptidsequenzierung. Mehrere rekombinante Proteine ​​können mit dem HeLa-Zell-freie System ausgedrückt werden, unter Verwendung von Microarray-Formate für Immunseren Screening und Identifizierung von möglichen Impfstoffkandidaten Moleküle. Darüber hinaus können potenziell immunogene Proteine ​​durch die Bildschirme identifiziert und ausgewählt werden, Proteine, die durch die Aufstockung der Ausdruck erhalten.

Malariaforschung, Expression von immunogenen Proteinen unter Verwendung von prokaryotischen oder eukaryotischen Systemen auf Zellbasis bleibt eine Herausforderung. Die AT Reichtum des Plasmodium Genom und unbekannte posttranslationale Mechanismen 14,7, auf die Schwierigkeiten bei der Beschaffung richtig gefaltet und immunogene Proteine ​​zur Antikörperproduktion und Impfstoffstudien assoziiert beitragen. Prokaryontischen Systemen wie Escherichia coli für die rekombinante Proteinexpression verwendet. Prokaryotische Systeme sind kostengünstig, effektiv, erzeugen hohe Ausbeuten an rekombinantem Protein und mehrere Klonierungsvektoren. Host E. coli-Zellen sind leicht zu transformieren und Zellen schnell wachsen. Jedoch haben prokaryotischen Systemen Einschränkungen wie der Mangel an Aminosäure-Substitution, eine posttranslationale Modifikation, Verschmutzungsgefahr heterogene Produkte und Akkumulation von rekombinanten Proteinen in Einschlusskörpern 24. In einemStudie Mehlin et al. (2006) wurden 1000 offenen Leserahmen (ORF) ausgedrückt. Etwa 7% der exprimierten Proteine ​​waren löslich 14. Die beobachtete Unlöslichkeit ist aufgrund der vorgespannten Natur der Gene und der hohen Frequenz von Codons, die idealerweise durch die AT-reiche Plasmodium Genom 14 verwendet. Eine alternative Strategie zur Überwindung dieses Problems wurde durch die Verwendung von Plasmiden oder Wirtszellen, tRNAs, die seltenen Codons oder Codons, die Frequenzen 3 entsprechen erkennen entwickelt. Selbst nach der Durchführung dieser Optimierungen werden sehr kleine Teile von Proteinen als lösliche, aktive und immunogenen 14 ausgedrückt. Die zellfreie Expressionssysteme enthalten sämtliche zur Transkription und Translation notwendigen Komponenten wie Ribosomen, Initiationsfaktoren, Elongationsfaktoren (Übersetzungen Faktoren), tRNA und Aminoacyl-tRNA-Synthetasen. Beide Transkription und Translation Reaktionen werden in einem einstufigen Verfahren 11,29 gekoppelt. Die transcription Reaktion in einem Röhrchen durchgeführt werden, bevor entsprechende Menge an mRNA mit Translationsmaschinerie in einem anderen Rohr 11,29 inkubiert. Obwohl diese Verfahren in Plasmodium sp. Protein Expression erfolgreich sind, ein großer Nachteil ist die Länge der Zeit für die Proteinexpression, die etwa 22 Stunden 29 ist. Darüber hinaus ist die hohen Kosten der Versorgung für die Aufnahme in den Protokollen 29, die arbeitsintensiven Vorbereitungen des Zelllysats und Inkonsistenzen in der Komponente Zubereitungen, stellen diese Systeme unerreichbar. Das Hauptaugenmerk der Forscher für die Entwicklung einer zellfreien Expressionssystem ist abhängig von Faktoren wie schnelle genetische Veränderung, schnelle Erträge mit hohen Konzentrationen und geradlinig Lysat Vorbereitungen 1. Eukaryontischen Systemen wie Hefe, Säugerzelllinien, Baculovirus-Expressionssystem vermittelt, Tetrahymena thermophilia, Dictyostelium discoideum und parasitären Expressionssysteme such wie Leishmania wurden für die rekombinante Proteinexpression 7 verwendet. Eukaryotische Systeme teilen phylogenetische Verwandtschaft und damit Eigenschaften wie Glykosylierung, Acylierung, Disulfid-Bindungsbildung, Chaperon-Wechselwirkung, Proteolyse und subzellulären Kompartimentierung teilen auch. Proteinsekretion Veranstaltungen in Eukaryoten zu verhindern Anhäufung und verringert die Toxizität für Expressionssysteme 13. Die Verwendung von Hefe-Systemen wird bevorzugt, da sie für die Proteinexpression in großem Maßstab und zur Erzielung hoher Ausbeuten 4 sind. Zwei P. falciparum Proteine ​​PFCP-29 und Pvs25 wurden unter Verwendung des Hefe-System 4 erzeugt. , Ein großer Nachteil bei der Synthese der meisten der Proteine ​​wurde jedoch unregelmäßige N und O-Glykosylierungsmuster, unsachgemäße Falten und Abschneiden von Proteinen aus ihrer nativen Form 4. Die Verwendung von Säugetierzellen für die Synthese von rekombinanten Proteinen ist arbeitsintensiv und es ist Expensive zu stabilen rekombinanten Zelllinien 4 aufrecht zu erhalten. Daher wurden Säugerzellen für die Analyse von Protein-Signalisierung, Protein-Interaktionen und Parasit-Wirt-Wechselwirkungen beschränkt und auch für das Testen von DNA-Impfstoffen 4. Die menschliche DNA und mRNA in vitro-Proteinexpression zellfreies System ist hierin ein HeLa-Zell-abgeleitete Säugetier-basiertes System, das Proteine ​​in 3 h ausdrückt. Proteine ​​exprimiert Verwendung pT7CFE1-ChiS Expressionsvektor haben einen C-terminalen Tag erleichtert Identifizierung und Reinigung. Die HeLa basiertes System mit Translationsinitiationsfaktoren und einem Übersetzungsregler ergänzt, wodurch die Effizienz des Übersetzungssystems zu verbessern. Proteine ​​können schnell umgesetzt werden, abgeschirmt, überprüft und für den Einsatz in verschiedenen immunologischen und Strukturanwendungen 15 verarbeitet. Eukaryotischen zellfreie Expressionssysteme wie Weizenkeime und Kaninchen-Retikulozyten sind zur Zeit für die Expression von var verwendetious eukaryotischen Proteinen einschließlich Plasmodium Proteine ​​11,29. Zusätzlich E. coli basiert zellfreie Systeme sind auch für eukaryotische Proteinexpression. 11 verwendeten Tabelle 1 fasst verschiedene zellfreie Expressionssysteme durch Vergleichen von Merkmalen der Systeme sowie die Leichtigkeit der Verwendung der Systeme für die Proteinexpression. Der menschliche zellfreien System im Vergleich zu den anderen hat die Fähigkeit, Pfosten und co-translationale Modifikationen durchzuführen und ist weniger teuer. Codon-Optimierung ist möglich, und alle Reaktionen in 3 Stunden durchgeführt werden. Die HeLa-System ist eine ideale Übersetzungssystem für die Proteinsynthese in der Laborumgebung. Ein Hauptvorteil der menschlichen Zelle freie Expressionssysteme gegenüber anderen zellfreien Systemen ist die Verfügbarkeit von mehreren verschiedenen Zelllinien aus verschiedenen Organen und Geweben abgeleitet ist. Mehrere Sorten von zellfreien Systemen können in Abhängigkeit von der Zelllinie ausgebildet sein. Der Extrakts aus Säugerzellen haben einen höheren Wirkungsgrad, große Proteine ​​zu synthetisieren als andere zellfreie Expressionssysteme. Diese zellfreie Expressionssysteme können auch in diagnostischen und Proteincharakterisierung Anwendungen wie Mikro-Arrays 30 verwendet werden. Die beliebten HeLa-Zelllinien werden am häufigsten verwendet, um die Durchführung der Expression von Proteinen, 33. Das endoplasmatische Retikulum in den HeLa-Zelllinien unterentwickelt, was zu einer Abwesenheit von posttranslationalen Glykosylierung Modifikation Aktivität 33. Allerdings ist dieses System glaubten für Plasmodium Proteinsynthese als vorteilhaft, als Plasmodium fehlt auch Glykosylierung Übersetzungs- Änderung 29. Der HeLa-Zell-freien Transkriptions-Translations-Protokoll ist einfach auszuführen, preisgünstig und Proteine ​​können in 90 min ausgedrückt werden, bereit für die Reinigung und Downstream Applikationen.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Two-step in vitro human cell free expression system</td>
			<td>Thermo fischer</td>
			<td>88856</td>
			<td>Discontinued. Always store at -80oC. Do not thaw in warm water</td>
		</tr>
		<tr>
			<td>One-step in vitro coupled translation system</td>
			<td>Thermo fischer</td>
			<td>88860</td>
			<td>Always store at -80oC. Do not thaw in warm water</td>
		</tr>
		<tr>
			<td>ProBond Purification system</td>
			<td>Invitrogen</td>
			<td>K850-01</td>
			<td>Store at room temperature</td>
		</tr>
		<tr>
			<td>Probond Nickel-Chelating Resin</td>
			<td>Invitrogen</td>
			<td>R801-01</td>
			<td>Store at 4oC.</td>
		</tr>
		<tr>
			<td>&#160;A+ Human Blood</td>
			<td>Interstate Blood Bank</td>
			<td></td>
			<td>Store at 4oC.</td>
		</tr>
	</tbody>
</table>

hela based cell free expression systems for expression of plasmodium rhoptry proteins

Malaria verursacht erhebliche globale Morbidität und Mortalität. Keine Routine-Impfstoff ist derzeit verfügbar. Einer der wichtigsten Gründe für die mangelnde eines Impfstoffes ist die Herausforderung der Identifizierung geeigneter Impfstoffkandidaten. Malariaproteine ​​exprimiert mit prokaryotischen und eukaryotischen Zellen basierenden Expressionssystemen schlecht glycosyliert allgemeinen unlöslich und unterliegen falsche Faltung führt zu verringerten Immunogenizität. Die Weizenkeime, Kaninchenretikulocytlysat und Escherichia coli Lysat zellfreie Expressionssysteme sind derzeit für die Expression des Malaria-Proteine ​​verwendet. Jedoch ist die Länge des Expressionszeit und unsachgemäße Glykosylierung von Proteinen immer noch eine Herausforderung. Wir zeigen die Expression von Plasmodium Proteinen in vitro unter Verwendung von HeLa-Zelle basierend freie Expressionssysteme, die als &quot;in vitro menschliche Zelle freie Expressionssysteme&quot;. Die 2 HeLa anhand zellfreie Expressionssysteme transkribieren mRNA in 75 min und 3 ul transcribed mRNA reicht aus, um Proteine ​​in 90 min zu übersetzen. Die 1-Schritt-Expressionssystem ist eine Transkription und Translation gekoppelt Expressionssystem; die Transkription und Co-Übersetzung erfolgt in 3 Stunden. Das Verfahren kann auch für 6 Stunden, indem zusätzliche Energie erweitert werden. In der 2-Schritt-Expressionssystem wird mRNA transkribiert erste und dann in die Übersetzung Mischung für die Proteinexpression zugegeben. Wir beschreiben, wie die Malaria-Proteine ​​zu exprimieren; eine hydrophobe PF3D7_0114100 Maurers Cleft - 2 Transmembran (PFMC-2TM) Protein, ein hydrophiles PF3D7_0925900 Protein und ein Gürteltier wiederholt mit Protein PF3D7_1361800, mit der HeLa anhand zellfreien Expressionssystem. Die Proteine ​​werden in Mikrovolumina unter Verwendung 2-Schritt und 1-step-Ausdruck Strategien ausgedrückt. Ein Affinitätsreinigungsverfahren zur Reinigung von 25 ul exprimierten Proteine ​​unter Verwendung des in vitro menschliche Zelle frei Expressionssystem wird ebenfalls beschrieben. Proteinausbeute durch Bradford-Assay bestimmt und die zum Ausdruckund gereinigte Proteine ​​durch Western-Blot-Analyse bestätigt werden. Exprimierten rekombinanten Proteine ​​können für Impfungen, Immunoassays und Proteinsequenzierung verwendet werden.

Validierung der exprimierten rekombinanten Proteine ​​durch Reaktivität mit spezifischen Antikörpern ist ein wichtiger erster Schritt bei der Bestätigung der korrekten Faltung der exprimierten Proteine. Rekombinanten Malaria-Proteine ​​wurden mit dem einen Schritt und zwei Schritt in vitro menschliche Zelle frei Expressionssystemen exprimiert. Die rekombinanten Proteine ​​werden gereinigt Ni-Chelat-Affinitäts-Verfahren. Dann verwendeten wir Antiseren gegen ganze Merozoiten Rhoptrien in Western-Blotting von SDS-PAGE getrennt rekombinanten Proteinen. 1 zeigt PCR amplifiziert Genfragmente PY17X_1139200, PY17X_1402200, PY17X_1366000, PY17X_0830000 und PF3D7_1436300 in einem 1% Agarosegel. DNA-Banden wurden ausgeschnitten und die DNA durch Einfrieren in der DNA-Extraktion Spin-Säule gereinigt. Malaria-Gene erfolgreich amplifiziert aus genomischer DNA (in Tabelle 2 gezeigt) wurden in den pT7CFE-ChiS Expressionsvektor kloniert. Re-Amplifikation der Gene aus dem recombinant Plasmide zeigte die Anwesenheit der klonierten Genfragmente in dem Vektor. Das Flussdiagramm von Expressionssystemen für die Proteintranslation verwendet wird in Abbildung 2 dargestellt. 2A und 2B zeigt eine schrittweise Prozedur der 2-Schritt in vitro menschliche Zelle freie Expressionssystem und dem 1-Schritt-IVT-Übersetzungssystem gekoppelt. Erfolgreiche Expression von Proteinen unter Verwendung von Plasmodium in vitro menschliche Zelle freie Expressionssysteme wurde von rhoptry spezifischen Kaninchen-Antiseren bestätigt. Wie in 3A dargestellt ist, wurden die rekombinanten Proteine ​​durch rhoptry spezifischen Kaninchen-Antiserum # 676 erfasst. Wie zuvor gezeigt, exprimierten rekombinanten Proteine ​​nicht durch Antiseren gegen parasitophoren Vakuole Proteine ​​aus P. anerkannt falciparum und P. yoelii die Spezifität Kaninchenantiseren 676 gegen die exprimierten Proteine ​​32. Normales Kaninchenserum (NRS) nicht mit rekombinanten Proteinen reagierenübersetzt mit 2-Stufen-in-vitro-Zell kostenlos Expressionssystem von Mensch und 1-Schritt-IVT gekoppelt Übersetzungssystem (3B). Die erfolgreiche Expression von Plasmodium rekombinanten Proteine ​​wurde durch verschiedene Techniken wie In-Gel-Histidin-Färbung und Nickel-HRP Färbung 32 bestätigt. Exprimierten Proteine ​​wurden durch Affinitätsreinigungssystem gereinigt. Die Reinigung wird in Batch-Verfahren durchgeführt (keine Spalten verwendet). Die Technik wird durch Veränderung der Konzentration von Imidazol von 60 mm bis 100 mm optimiert. Die optimale Konzentration für die Elution ist 250 mM. 4 zeigt erfolgreiche Reinigung des translatierten Proteine ​​aus 25 ul translatierten Proteinprodukte. 4A zeigt erfolgreiche Reinigung von Maurer Spalt Transmembranprotein 18. 4B zeigt erfolgreiche Reinigung von PF3D7_0925900, P. falciparum Ortholog von Plasmodium yoelii Gen PY17X_0830000 einhypothetisches Protein 32. 4C zeigt erfolgreiche Reinigung des Gürteltier-Wiederholungen enthält Protein PY17X_1139200, ein hypothetisches Protein unter Verwendung von Ni-Harzkügelchen und 100 mM Imidazol in 1x Elutionspuffer. Die Ausbeute an Protein nach Reinigung beträgt 3,5 ug / 25 ul. <img alt="Abbildung 1" src="/files/ftp_upload/52772/52772fig1.jpg" /> Abbildung 1. Die Amplifikation von P. falciparum und P. yoelii Gene. 1% Agarosegel, das Ethidiumbromid PCR-Produkte von Genfragmenten der PFc14_0344, PF3D7_0925900, PF3D7_1361800, PY07482 und PFA0680cw aus P. amplifizierte falciparum genomischer DNA. <img alt="Figur 2" src="/files/ftp_upload/52772/52772fig2highres.jpg" width="700" /> Abbildung 2 Flussdiagramm von HeLa-bas<html> ed zellfreien Expressionssystem. Schematische Darstellung der beiden 2-Stufen und 1-Schritt in vitro menschliche Zelle freie Expressionssysteme. <a href="https://www.jove.com/files/ftp_upload/52772/52772fig2highres.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 3" src="/files/ftp_upload/52772/52772fig3highres.jpg" width="650" /> Abbildung 3. Immunoblotting Bestätigung der Proteinexpression. Western Blot-Analyse des exprimierten rekombinanten Proteinen unter Verwendung von ganzen rhoptry spezifischen Kaninchen-Antiserum # 676 und normales Kaninchenserum. (A) Reaktivität von Antiseren 676 mit exprimierten rekombinanten Proteine. (B) normalem Kaninchenserum nicht mit der exprimierten rekombinanten Proteine ​​reagieren. Parasitophoren Vakuole Protein nicht mit rekombinanten Proteinen 32 reagieren.hres.jpg &quot;target =&quot; _ blank &quot;&gt; Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen. <img alt="Figur 4" src="/files/ftp_upload/52772/52772fig4highres.jpg" width="700" /> Figur 4. Reinigung von Proteinen aus Mikrovolumina Translationsprodukt. Reinigung des exprimierten rekombinanten Proteinen unter Verwendung von Nickel-Chelatharzes Affinitätsverfahren. Exprimierten Proteine ​​(Übersetzung) (A) PF3D7_0114100, (B) PY17X_0830000 und (C) PY17X_1139200 Proteine ​​wurden mit Nickel inkubiert - Chelatharze mit Nickel- chelatbildenden Harz in Abwesenheit von Imidazol in Bindungspuffer und Reinigungspuffer gereinigt. Nach der Inkubation wurden die Perlen zentrifugiert, ungebundenen Proteine ​​wurden getrennt, und die Perlen zweimal mit Waschpuffer gewaschen. Gebundenen rekombinanten Proteine ​​wurden eluiert, zweimal durch Waschen der Kügelchen folgt. Übersetzt Proteine, Waschanlagen, Eluaten und Perlenwurden in Elektrophorese-Probenpuffer solubilisiert. Imidazol im Wash (20 mM Imidazol) und Elution (100 mM Imidazol) Puffer verwendet. Antiseren # 676 erfolgreich erkannt exprimiert und gereinigte rekombinante Proteine. Normales Kaninchenserum nicht mit exprimierten Proteine ​​als zeigen in 3B zu reagieren. <a href="https://www.jove.com/files/ftp_upload/52772/52772fig4highres.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a> <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Eigenschaften </td><td> Menschenzellfreien Expressionssystem </td><td> Weizenkeimzelle frei Expressionssystem </td><td> Kaninchen-Retikulozyten-Expressionssystem </td><td> E.coli-Lysat-Protein-Expressionssystem </td></tr><tr><td> Zeit </td><td> Geschehen Transkription und Translation in 3 Stunden </td><td> Transkription für 6 Stunden und Übersetzung für 10 - 20 h </td><td> RNA zu isolieren Übersetzung erfolgt 90 min </td><td> Done in 1 h </td></tr><tr><td> Geeigneten Vektor </td><td> T7 Vektor kann </td><td> SP6-Vektor </td><td> T7 verwendet werden </td><td> T7 verwendet werden </td></tr><tr><td> Geeigneten Maßstab </td><td> Geeignet für die Laborsynthese </td><td> Wird für die Proteinsynthese im großen Maßstab </td><td> Geeignet für Labor und Immunisierungsstudien </td><td> Geeignet für Labor und Immunisierungsstudien </td></tr><tr><td> Extrakt </td><td> HeLa zellfreien Extrakten </td><td> Embryo Weizenextrakten </td><td> Retikulozyten-Zellextrakten </td><td> E. coli Zelllysat Extrakten </td></tr><tr><td> Änderung </td><td> Co-translationale und posttranslationale Modifikation </td><td> Posttranslationale Modifikation </td><td> Co-translationale Modifikation </td><td> Posttranslationale Modifikation </td></tr><tr><td> Größe des Proteins übersetzt </td><td> 8 KDa und 250 KDa </td><td> 220 KDa </td><td> 250 KDa </td> &lt;td&gt; 200 kDa </td></tr><tr><td> Codon-Optimierung </td><td> Fest </td><td> Fest </td><td> Lose </td><td> Fest </td></tr><tr><td> Disulfid-Bindungsbildung </td><td> Ja </td><td> Ja </td><td> Nein </td><td> Ja </td></tr><tr><td> Ausbeute </td><td> Geringe Ausbeute </td><td> Hohe Ausbeute </td><td> Low Yield </td><td> Sehr hoher Ausbeute </td></tr><tr><td> Kosten </td><td> $ 130,00 für 10 Reaktionen </td><td> $ 173,00 für 10 Reaktionen </td><td> $ 136,00 für 5 Reaktionen </td><td> $ 159,00 für 8 Reaktionen </td></tr><tr><td> Die Proteinkonzentration </td><td> 3 bis 5 &amp; mgr; g pro Reaktion </td><td> 100 &amp; mgr; g / ml </td><td> 100 &amp; mgr; g / ml </td><td> 500 &amp; mgr; g / ml </td></tr><tr><td> Referenzen </td><td> 32, 30 </td><td> 7, 28, 29 </td><td> 7 </td><td> 7, 24, 25 </td></tr></tbody></table> Tabelle 1. Zellfreie Expressionssysteme in Malaria-Forschung. Vergleich von Zellfreie Expressionssysteme derzeit in Malaria-Forschung eingesetzt. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td fo:width="25mm"> Gene ID </td><td fo:width="25mm"> Ortholog ID </td><td> Protein </td><td> Primer-Sequenz für die PCR </td></tr><tr><td rowspan="2"> PF3D7_1436300 </td><td rowspan="2"></td><td rowspan="2"> Translocon Komponente </td><td> CTCGAGAATAATAACAATCATAATAATAAG </td></tr><tr><td> GAATTCATTATCATCAGGTTTAGCTAATTTTC </td></tr><tr><td rowspan="2"> PF3D7_0114100 </td><td rowspan="2"></td><td rowspan="2"> PFMC-2TM Maurers Spalte Protein </td><td> GGATCCATGTTAGGTCAAAAAAACACAAATA </td></tr><tr><td> CTCGAGTGTTATTTGCTTTTTGTTTTGAAAA </td></tr><tr><td rowspan="2"> PY17X_0830000 </td><td rowspan="2"> PF3D7_0925900 </td><td rowspan="2"> Hypothetisches Protein </td><td> GGATCCATGAAATTTTTTAATATTCTCGCA </td></tr><tr><td> CTCGAGTCCTTGGACAACATATATACT60; </td></tr><tr><td rowspan="2"> PY17X_1139200 </td><td rowspan="2"> PF3D7_1361800 </td><td rowspan="2"> Hypothetisches Protein </td><td> GGATCCATGGGGTGCGACCCTGGGGTCAGCA </td></tr><tr><td> CTCGAGGCTCTTCAGATACTAAGCTACTAAT </td></tr></tbody></table> Tabelle 2. rhoptry Gene in der Studie. Primers verschiedener Gene in dieser Untersuchung 19 ausgedrückt. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Name des Materials </td><td> Unternehmen </td><td> Katalog-Nummer </td><td> Beschreibung </td></tr><tr><td> 2-Stufen-in vitro menschliche Zelle frei Expressionssystem 32 </td><td> Thermo Fisher </td><td> 88.856 </td><td> Nicht mehr. Speichern Sie immer bei -80 ° C. Sie in warmem Wasser auftauen nicht. </td></tr><tr><td> 1-Schritt-in vitro-Translationssystem gekoppelt </td><td> Thermo Fisher </td><td> 88.860 </td><td> Speichern Sie immer bei -80 ° C. Th nichtaw in warmem Wasser. </td></tr></tbody></table> Tabelle 3. Hela anhand zellfreie Expressionssysteme. Kits für die Expression von Proteinen verwendet.

Watch this Scientific Journal Video about HeLa Based Cell Free Expression Systems for Expression of Plasmodium Rhoptry Proteins at JoVE.com

HeLa Based Cell Free Expression Systems for Expression of Plasmodium Rhoptry Proteins

Expression des Malaria-Proteinen in zellbasierten Systemen bleibt eine Herausforderung. Wir zeigen zwei Schritt und einen Schritt IVT (in vitro-Translation) zellfreie Expressionssysteme zur Expression von rekombinanten Malaria-rhoptry Proteine ​​aus HeLa-Zellen. Wir verwenden eine Ni-Harz Affinität Kläranlage, die rhoptry Proteine ​​zu reinigen.

Basierend HeLa Zellfreie Expressionssysteme zur Expression von<em&gt; Plasmodium</em&gt; Rhoptry Proteine

Malaria causes significant global morbidity and mortality. No routine vaccine is currently available. One of the major reasons for lack of a vaccine is ...

hela-based-cell-free-expression-systems-for-expression-plasmodium

Universidad San Sebastian

Research

JoVE Journal

Biology

HeLa Based Cell Free Expression Systems for Expression of Plasmodium Rhoptry Proteins

12.0K Aufrufe.  Cleveland State University.  Expression des Malaria-Proteinen in zellbasierten Systemen bleibt eine Herausforderung. Wir zeigen zwei Schritt und einen Schritt IVT (in vitro-Translation) zellfreie Expressionssysteme zur Expression von rekombinanten Malaria-rhoptry Proteine ​​aus HeLa-Zellen. Wir verwenden eine Ni-Harz Affinität Kläranlage, die rhoptry Proteine ​​zu reinigen. 

Serie: HeLa Based Cell Free Expression Systems for Expression of Plasmodium Rhoptry Proteins

The Preparation of Primary Hematopoietic Cell Cultures From Murine Bone Marrow for Electroporation

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser MXcell  electroporation system and Gene Pulser  electroporation buffer were specifically developed to transfect nucleic acids into mammalian cells and difficult-to-transfect cells, such as primary and stem cells.This video demonstrates how to establish primary hematopoietic cell cultures from murine bone marrow, and then prepare them for electroporation in the MXcell system. We begin by isolating femur and tibia. Bone marrow from both femur and tibia are then harvested and cultures are established. Cultured bone marrow cells are then transfected and analyzed.

This procedure describes how to establish primary hematopoietic cell cultures from murine bone marrow and is followed by transfection using the Gene Pulser MXCell electroporation system.

Die Herstellung von primären hämatopoetischen Zellkulturen aus Knochenmark der Maus für die Elektroporation

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser ...

Forschung

Biologie

Staining of Proteins in Gels with Coomassie G-250 without Organic Solvent and Acetic Acid

In classical protein staining protocols using Coomassie Brilliant Blue (CBB), solutions with high contents of toxic and flammable organic solvents (Methanol, Ethanol or 2-Propanol) and acetic acid are used for fixation, staining and destaining of proteins in a gel after SDS-PAGE. To speed up the procedure, heating the staining solution in the microwave oven for a short time is frequently used. This usually results in evaporation of toxic or hazardous Methanol, Ethanol or 2-Propanol and a strong smell of acetic acid in the lab which should be avoided due to safety considerations. In a protocol originally published in two patent applications by E.M. Wondrak (US2001046709 (A1), US6319720 (B1)), an alternative composition of the staining solution is described in which no organic solvent or acid is used. The CBB is dissolved in bidistilled water (60-80mg of CBB G-250 per liter) and 35 mM HCl is added as the only other compound in the staining solution. The CBB staning of the gel is done after SDS-PAGE and thorough washing of the gel in bidistilled water. By heating the gel during the washing and staining steps, the process can be finished faster and no toxic or hazardous compunds are evaporating. The staining of proteins occurs already within 1 minute after heating the gel in staining solution and is fully developed after 15-30 min with a slightly blue background that is destained completely by prolonged washing of the stained gel in bidistilled water, without affecting the stained protein bands.

A short protocol for protein staining with Coomassie Brilliant Blue (CBB) G-250 in polyacrylamide gels is described without using organic solvents or acetic acid as in the classical staining procedures with CBB.

Färbung von Proteinen in Gelen mit Coomassie G-250 ohne organische Lösungsmittel und Essigsäure

In classical protein staining protocols using Coomassie Brilliant Blue (CBB), solutions with high contents of toxic and flammable organic solvents ...

Spinal Cord Electrophysiology

The neonatal mouse spinal cord is a model for studying the development of neural circuitries and locomotor movement. We demonstrate the spinal cord dissection and preparation of recording bath artificial cerebrospinal fluid used for locomotor studies. Once dissected, the spinal cord ventral nerve roots can be attached to a recording electrode to record the electrophysiologic signals of the central pattern generating circuitry within the lumbar cord.

A demonstration of the isolation of neonatal mouse spinal cord for electrophysiologic studies.

Spinal Cord Elektrophysiologie

The neonatal mouse spinal cord is a model for studying the development of neural circuitries and locomotor movement. We demonstrate the spinal cord ...

Using the Gene Pulser MXcell Electroporation System to Transfect Primary Cells with High Efficiency

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser MXcell electroporation system and Gene Pulser electroporation buffer (Bio-Rad) were specifically developed to easily transfect nucleic acids into mammalian cells and difficult-to-transfect cells, such as primary and stem cells. We will demonstrate how to perform a simple experiment to quickly identify the best electroporation conditions. We will demonstrate how to run several samples through a range of electroporation conditions so that an experiment can be conducted at the same time as optimization is performed. We will also show how optimal conditions identified using 96-well electroporation plates can be used with standard electroporation cuvettes, facilitating the switch from electroporation plates to electroporation cuvettes while maintaining the same electroporation efficiency. In the video, we will also discuss some of the key factors that can lead to the success or failure of electroporation experiments.

This procedure shows how to use the Gene Pulser MXcell electroporation system to rapidly and easily identify the best electroporation conditions for mouse embryonic fibroblasts (MEFs) or other primary cells. Considerations for troubleshooting are also discussed in the associated video.

Mit dem Gene Pulser MXcell Elektroporation System zur Primary Cells mit hohem Wirkungsgrad zu transfizieren

Using an Automated Cell Counter to Simplify Gene Expression Studies: siRNA Knockdown of IL-4 Dependent Gene Expression in Namalwa Cells

The use of siRNA mediated gene knockdown is continuing to be an important tool in studies of gene expression.  siRNA studies are being conducted not only to study the effects of downregulating single genes, but also to interrogate signaling pathways and other complex interaction networks.  These pathway analyses require both the use of relevant cellular models and methods that cause less perturbation to the cellular physiology.  Electroporation is increasingly being used as an effective way to introduce siRNA and other nucleic acids into difficult to transfect cell lines and primary cells without altering the signaling pathway under investigation. There are multiple critical steps to a successful siRNA experiment, and there are ways to simplify the work while improving the data quality at several experimental stages.  To help you get started with your siRNA mediated gene knockdown project, we will demonstrate how to perform a pathway study complete from collecting and counting the cells prior to electroporation through post transfection real-time PCR gene expression analysis.  The following study investigates the role of the transcriptional activator STAT6 in IL-4 dependent gene expression of CCL17 in a Burkitt lymphoma cell line (Namalwa).  The techniques demonstrated are useful for a wide range of siRNA-based experiments on both adherent and suspension cells.  We will also show how to streamline cell counting with the TC10 automated cell counter, how to electroporate multiple samples simultaneously using the MXcell electroporation system, and how to simultaneously assess RNA quality and quantity with the Experion automated electrophoresis system.

This procedure describes a quick and easy workflow to introduce siRNA into difficult to transfect cell lines and follow gene expression by real-time PCR. Use of an automated cell counter, multi-well electroporation plate, and automated electrophoresis station provide quick and reliable results without the need for expensive robotic handling.

Verwendung eines automatisierten Cell Counter zu Genexpressionsstudien Simplify: siRNA Knockdown von IL-4 abhängige Genexpression in Namalwalzellen

The use of siRNA mediated gene knockdown is continuing to be an important tool in studies of gene expression.  siRNA studies are being conducted not only ...

Assessment of GFP Expression and Viability Using the Tali Image-Based Cytometer

Single-cell and population information are commonly obtained either by flow cytometry or fluorescence microscopy. However, these two methods provide different information. Flow cytometry gives quantitative multi-parametric information about physical characteristics and staining or expression, but doesn't allow for visualization. Stand-alone fluorescence microscopy provides visual data, but doesn't allow for straightforward quantitative measurements1.
Image-based cytometry bridges the gap between these two methods, enabling the quick visualization and simultaneous quantitative analysis of thousands of cells in heterogeneous populations2. Here, we present a method for performing cell viability and green fluorescent protein (GFP) expression assays using the Tali Image-Based Cytometer3. The Tali instrument is a 3-channel (bright field, green fluorescence, red fluorescence) benchtop assay platform that offers several advantages over flow cytometry and fluorescence microscopy. The Tali cytometer is less expensive, takes up less bench space, requires less maintenance, and the work flow has been simplified so that the operation and analysis is much simpler and quicker. The Tali cytometer is capable of performing a range of suspension cell-based assays, including GFP and red fluorescent protein (RFP) expression, apoptosis4-6 and cell viability analysis with propidium iodide (PI)7-11.
Here, we demonstrate the use of the Tali instrument in performing a cell viability assay in cells expressing GFP. GFP-transduced cells are stained using the Tali Viability Kit - Dead Cell Red. The cells are then pipetted into a Tali Cellular Analysis Slide and loaded into the cytometer. Bright field, red fluorescence and green fluorescence images are captured and analyzed using assay specific algorithms. Histograms are then generated to display cell size, PI fluorescence intensity, and GFP fluorescence intensity. These parameters can then be thresholded to home in on a specific cell population.
A side-by side comparison of the Tali Image-Based Cytometer and traditional flow cytometry demonstrates that the two methods provide comparable data regarding cell viability and protein expression. However, the Tali instrument provides additional visual information about the cell population that cannot be obtained using a flow cytometer.

This protocol describes how to perform cell viability and fluorescence expression assays using the Tali Image-Based Cytometer.

Beurteilung der GFP Expression und Lebensfähigkeit Mit der Tali Image-Based Cytometer

Single-cell and population information are commonly obtained either by flow cytometry or fluorescence microscopy. However, these two methods provide ...

Small-scale Nuclear Extracts for Functional Assays of Gene-expression Machineries

A great deal of progress in understanding gene expression has been made using in vitro systems. For most studies, functional assays are carried out using extracts that are prepared in bulk from 10-50 or more liters of cells grown in suspension. However, these large-scale preparations are not amenable to rapidly testing in vitro effects that result from a variety of in vivo cellular treatments or conditions. This journal video article shows a method for preparing functional small-scale nuclear extracts, using HeLa cells as an example. This method is carried out using as few as three 150 mm plates of cells grown as adherent monolayers. To illustrate the efficiency of the small-scale extracts, we show that they are as active as bulk nuclear extracts for coupled RNA Polymerase II transcription/splicing reactions. To demonstrate the utility of the extract protocol, we show that splicing is abolished in extracts prepared from HeLa cells treated with the splicing inhibitor drug E7107. The small-scale protocol should be generally applicable to any process or cell type that can be investigated in vitro using cellular extracts. These include patient cells that are only available in limited quantities or cells exposed to numerous agents such as drugs, DNA damaging agents, RNAi, or transfection, which require the use of small cell populations. In addition, small amounts of freshly grown cells are convenient and/or required for some applications.

A protocol for preparation of robust, small-scale HeLa nuclear extracts is described. This protocol is valuable for assays that require use of small populations of cells, such as cells treated with drugs or RNAi. The method should be applicable to a wide variety of gene expression assays and other cell types, including patient cells.

Small-scale Kernextrakten für funktionelle Assays von Gen-Expression Machineries

A great deal of progress in understanding gene expression has been made using in vitro systems.  For most studies, functional assays are carried out using ...

Efficient Agroinfiltration of Plants for High-level Transient Expression of Recombinant Proteins

Mammalian cell culture is the major platform for commercial production of human vaccines and therapeutic proteins. However, it cannot meet the increasing worldwide demand for pharmaceuticals due to its limited scalability and high cost. Plants have shown to be one of the most promising alternative pharmaceutical production platforms that are robust, scalable, low-cost and safe. The recent development of virus-based vectors has allowed rapid and high-level transient expression of recombinant proteins in plants. To further optimize the utility of the transient expression system, we demonstrate a simple, efficient and scalable methodology to introduce target-gene containing Agrobacterium into plant tissue in this study. Our results indicate that agroinfiltration with both syringe and vacuum methods have resulted in the efficient introduction of Agrobacterium into leaves and robust production of two fluorescent proteins; GFP and DsRed. Furthermore, we demonstrate the unique advantages offered by both methods. Syringe infiltration is simple and does not need expensive equipment. It also allows the flexibility to either infiltrate the entire leave with one target gene, or to introduce genes of multiple targets on one leaf. Thus, it can be used for laboratory scale expression of recombinant proteins as well as for comparing different proteins or vectors for yield or expression kinetics. The simplicity of syringe infiltration also suggests its utility in high school and college education for the subject of biotechnology. In contrast, vacuum infiltration is more robust and can be scaled-up for commercial manufacture of pharmaceutical proteins. It also offers the advantage of being able to agroinfiltrate plant species that are not amenable for syringe infiltration such as lettuce and Arabidopsis. Overall, the combination of syringe and vacuum agroinfiltration provides researchers and educators a simple, efficient, and robust methodology for transient protein expression. It will greatly facilitate the development of pharmaceutical proteins and promote science education.

Plants offer a novel system for the production of pharmaceutical proteins on a commercial scale that is more scalable, cost-efficient and safe than current expression paradigms. In this study, we report a simple and convenient, yet scalable approach to introduce target-gene containing Agrobacterium tumefaciens into plants for protein transient expression.

Effiziente Agroinfiltration von Pflanzen für High-Level-Transient Expression von rekombinanten Proteinen

Mammalian cell culture is the major platform for commercial production of human vaccines and therapeutic proteins. However, it cannot meet the increasing ...

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for expressing proteins and genetic circuits in a controlled manner as well as for providing a prototyping environment for synthetic biology.2,3 To achieve the latter goal, cell-free expression systems that preserve endogenous Escherichia coli transcription-translation mechanisms are able to more accurately reflect in vivo cellular dynamics than those based on T7 RNA polymerase transcription. We describe the preparation and execution of an efficient endogenous E. coli based transcription-translation (TX-TL) cell-free expression system that can produce equivalent amounts of protein as T7-based systems at a 98% cost reduction to similar commercial systems.4,5 The preparation of buffers and crude cell extract are described, as well as the execution of a three tube TX-TL reaction. The entire protocol takes five days to prepare and yields enough material for up to 3000 single reactions in one preparation. Once prepared, each reaction takes under 8 hr from setup to data collection and analysis. Mechanisms of regulation and transcription exogenous to E. coli, such as lac/tet repressors and T7 RNA polymerase, can be supplemented.6 Endogenous properties, such as mRNA and DNA degradation rates, can also be adjusted.7 The TX-TL cell-free expression system has been demonstrated for large-scale circuit assembly, exploring biological phenomena, and expression of proteins under both T7- and endogenous promoters.6,8 Accompanying mathematical models are available.9,10 The resulting system has unique applications in synthetic biology as a prototyping environment, or "TX-TL biomolecular breadboard."

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

This five-day protocol outlines all steps, equipment, and supplemental software necessary for creating and running an efficient endogenous Escherichia coli based TX-TL cell-free expression system from scratch. With reagents, the protocol takes 8 hours or less to setup a reaction, collect, and process data.

Protokolle für die Implementierung einer<em&gt; Escherichia coli</em&gt; Basierend TX-TL Zellfreie Expression System für Synthetische Biologie

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for ...

Analysis of Global RNA Synthesis at the Single Cell Level following Hypoxia

Hypoxia or lowering of the oxygen availability is involved in many physiological and pathological processes. At the molecular level, cells initiate a particular transcriptional program in order to mount an appropriate and coordinated cellular response. The cell possesses several oxygen sensor enzymes that require molecular oxygen as cofactor for their activity. These range from prolyl-hydroxylases to histone demethylases. The majority of studies analyzing cellular responses to hypoxia are based on cellular populations and average studies, and as such single cell analysis of hypoxic cells are seldom performed. Here we describe a method of analysis of global RNA synthesis at the single cell level in hypoxia by using Click-iT RNA imaging kits in an oxygen controlled workstation, followed by microscopy analysis and quantification.&nbsp; Using cancer cells exposed to hypoxia for different lengths of time, RNA is labeled and measured in each cell. This analysis allows the visualization of temporal and cell-to-cell changes in global RNA synthesis following hypoxic stress.

We describe a technique for analysis of global RNA synthesis in hypoxia using imaging. Click-chemistry labeling of RNA has not previously been performed under hypoxia and allows visualization of global RNA changes at the single cell level. This approach complements the existing averaged RNA techniques, allowing direct visualization of cell-to-cell changes in global RNA synthesis.

Analyse der globalen RNA-Synthese auf der Einzelzellebene folgende Hypoxie

Hypoxia or lowering of the oxygen availability is involved in many physiological and pathological processes. At the molecular level, cells initiate a ...