This research was funded by Doris Duke Charitable Foundation, Burroughs Wellcome Fund, NIH R21DK080994, Duke Chancellor's pilot project fund, the Roche Foundation for Anemia Research and The Bill and Melinda Gates Foundation. G.L. is supported by Duke's UPGG and the NIH (Grant # 5R01AI090141-03) and K.A.W. by the NSF Graduate Research Fellowship Program.

1: Isolierung von kleinen RNAs, die von P. falciparum Während des IDC <ol><li> Erhalten Malariaparasiten in asexuellen Kultur 29. HINWEIS: Die erforderliche Kulturgröße wird von der gewünschten Anwendung variieren; jedoch eine 10 ml Kultur bei 3-5% Parasitämie und 5% Hämatokrit bietet ausreichend RNA für Echtzeit-PCR (RT-PCR). Die Technik wurde ursprünglich für asynchrone Kulturen optimiert, aber wenn bestimmten Zeitpunkten während des Infektionszyklus gewünscht werden, können Ringstadium-Parasiten von Sorbit Synchronisierung nicht später als 10-12 Stunden nach der Invasion synchronisiert werden. Synchronisierung nach Ablauf eines Zyklus (ca. 48 h) 29 wiederholt werden. </li><li> Pool infizierten Zellen zusammen (ca. 5 x 10 9 RBCs bei 3-5% Parasitämie) und füllen kaltem PBS an die Spitze des Rohres und Zentrifugieren bei 800 xg für 5 min ohne Bremse zu Pellet der roten Blutkörperchen. </li><li> Nach der Zentrifugation, entfernen Sie den Überstand vorsichtig mit Hilfe eines Ansaugpipette, befestigtauf ein Vakuum, da die Erythrozyten-Pellet ist leicht zu entfernen. Nochmals mit kaltem 1x PBS Waschen des Pellets. </li><li> Resuspendieren Zellpellet in kaltem 0,15% Saponin (in 1x PBS) und auf Eis für 30 min. </li><li> Centrifuge Zellen bei 1.500 × g für 12 min bei 4 ° C, zu entfernen Überstand (die dunkel in der Farbe rot sein wird) und Pellet in kaltem PBS. Wiederholen Sie diesen Schritt noch einmal. ANMERKUNG: Um sicherzustellen, dass die vorliegenden mikroRNAs waren reflektierend mikroRNAs innerhalb Parasiten und nicht erythrozytären Kontamination ist eine Anzahl von Parasiten Isolationsbedingungen wurden getestet: 1) Saponin Lyse, 2) Saponin Lyse mit RNaseA Behandlung der Wirtszelle miRNAs und 3 kombiniert ) Methyl-beta-Cyclodextrin-Behandlung, um die Parasiten aus der Wirts Erythrozyten zu entfernen. Alle Behandlungen ergaben ähnliche Ergebnisse. </li><li> Lyse der isolierte Parasiten Pellet mit den empfohlenen 600 &amp; mgr; l Lysepuffer. Dieses Volumen Lysepuffer genügt Kulturen bis zu ~ 30 ml von 2% Hämatokrit und 5% Parasitämie. HINWEIS: Für größere Parasiten Kulturen, kann dieses Volumen erhöht werden. Es ist wichtig, um eine vollständige Lyse der Parasitenpellet durch gründliches Vortexen für mindestens 1 min zu gewährleisten. Auch zur Vereinfachung der Extraktion, die lysierten Proben können in einem 1,7 ml Mikrozentrifugenröhrchen übertragen. </li><li> Mit 60 &amp; mgr; l oder 1/10 Volumen Lysepuffer in Schritt 6 verwendet, Homogenat Additiv (2 M Natriumacetat, pH 4). </li><li> Lassen Proben auf Eis für 10 min. </li><li> Mit 600 &amp; mgr; l oder ein Volumen gleich der Menge Lysepuffer in Schritt 6 zu jeder Probe und Vortex für 1 min zugegeben saurer Phenol choloroform. </li><li> Trennen der wässrigen und organischen Phasen durch Zentrifugation der Proben bei 10000 × g für 5 min. Diese Drehung ist länger als die durch den Bausatz vorgeschlagen, um sicherzustellen, dass alle Hämoglobin / Hämozoins ist in der organischen Phase. </li><li> Sammeln Sie die obere (wässrige) Schicht und überträgt es in ein frisches Röhrchen. Wiederholen Sie die Schritte 9 und 10, wenn die wässrige Phase ist weiß oder (wahrscheinlicher) Braun in der Farbe, die pro schlägttein Verschmutzung. </li><li> Bestimmen das Volumen des resultierenden Überstands mit einer Pipette und fügen 1,25 Volumina 100% Ethanol (~ 800 &amp; mgr; l) und durch Umschütteln 1,7 ml Mikrozentrifugenröhrchen 5 mal. </li><li> Passieren jede Probe durch ein bereitgestellt RNA-bindende Filterpatrone (von denen mehrere verschiedene im Handel erhältlich sind) entweder durch Zentrifugation bei 14.000 × g für 1 min oder durch Verwendung einer Vakuumkammer. </li><li> Waschen Sie die Filterpatrone mit 700 ul der miRNA-Waschpuffer 1 unter Verwendung einer Mikrozentrifuge, Spinning bei 14.000 × g für 1 min. </li><li> Zweimal durch Zentrifugieren bei 14.000 · g für jeweils 1 min Waschen Sie die Filterpatrone mit 500 ul Waschpuffer 2/3. </li><li> Eluieren RNA mit 100 ul DEPC-Wasser, das auf 95 ºC vorgewärmt wurde, in zwei Wäschen von 50 &amp; mgr; l, Zentrifugieren bei 14.000 xg für jeweils 1 min. Messung der Konzentration von RNA durch UV-Absorption bei 260 nm. HINWEIS: Ein RNA-Gel (entweder TBE-Harnstoff-Acrylamid oder denaturierenden Formaldehyd-Agarose-Gel) kann be verwendet, um die Größenverteilung der isolierten RNAs beurteilen. HINWEIS: Diese RNA ist für die Analyse von Mikroarray, RNA-Sequenzierung, Northern Blot und Ribonuklease Protection Assay. </li></ol> 2: Quantifizierung von kleinen RNAs, die von P. falciparum Während des IDC <ol><li> Bestimmen Sie die Konzentration der einzelnen Proben in Schritt 1 getrennt mit UV-Spektrophotometrie bei 260 nm. </li><li> Erzeugen Echtzeit-PCR-Primer für den gewünschten RNA-Spezies. Für miRNA allein haben wir vorgefertigte miRNA qPCR-Assays, während für mRNAs oder Fusions miRNA-mRNA wir entwickelt Primer für SYBR grün. Für die Fusions RNAs, der Vorwärtsprimer war der miRNA-Sequenz selbst (miR-451: AAACCGTTACCATTACTGAGTT), während die Rückseite war eine genspezifische Primer ~ 100 bp stromabwärts von dem miRNA in der mRNA-Sequenz (PKA-R: ATCGAACATGCTGTGAACAT). </li><li> Machen cDNA aus den RNA-Proben unter Verwendung von entweder einer Haarnadelprimer für miRNAs (verwenden 20-40 ng RNA) alleine oder zufälligen Hexameren für mRNA und / oder miRNA-mRNA Fusions Arten (unter Verwendung von 1 &amp; mgr; g RNA). Mischungs RNA und Primer für 5 min bei 65 ° C, dann auf Raumtemperatur abkühlen. Anschließend fügen reverse Transkriptase-Mix (0.5 &amp; mgr; l reverse Transkriptase, 0,5 ul RNase Inhibitor, 1 ul dNTPs (jeweils 2,5 mM), 4 &amp; mgr; l 5x-Puffer, 2 &amp; mgr; l 0,1 M DTT, 1 &amp; mgr; l H 2 O). <ol><li> Führen Proben auf einem Thermocycler zum Aufspüren von entweder SYBR grün oder TaqMan-Sonden. SYBR green quantitative PCR 30 für spezifische Gene wurde als ein 3-Schritt-PCR, 95 ° C für 15 sec, niedrigsten Primerannealing Temperatur minus 5 ° C für 30 s ausgeführt wird, und 68 ° C für 30 Sekunden, für 40 Zyklen unter Verwendung eines Handels SYBR Green Master Mix. miRNA Echtzeit-PCR wurde als eine Zwei-Schritt-PCR für 1 min laufen, 95 ° C für 15 sec und 60 ° C für 40 Zyklen. </li><li> Quantifizierung Assays unter Verwendung des ΔΔCt Verfahren und normalisieren sie entweder gegen Rab GTPase (PF08_0110) oder 18S rRNA 31. </li></ol></li></ol> 3: Einführungvon kleinen RNAs in Malaria-Erregern <ol><li> Pellet 300 ul rote Blutkörperchen pro Transfektion durch Zentrifugation bei 800 × g bei Bremse 1 (250 ul von RBCs etwa 1,5 x 10 9 Zellen, schließlich verwendet werden) in komplettem Malariamittel für 5 min. </li><li> Zweimaliges Waschen der Erythrozyten mit RPMI und resuspendieren in komplettem cytomix (120 mM KCl; 0,15 mM CaCl2; 10 mM K 2 HPO 4 / KH 2 PO 4, pH 7,6; 25 mM HEPES, pH 7,6; 2 mM EGTA, pH 7,6; 5 mM MgCl 2; pH mit KOH nach dem Zentrifugieren bei 800 xg für 5 Minuten bei Bremse 1 eingestellt) bei 50% Hämatokrit. </li><li> Übertragen Sie die Zellen bis zu einer 0,2 cm Elektroporationsküvette. </li><li> In 10 ug oder entsprechenden Betrag, der kundenspezifische synthetische Oligonukleotide an die Küvetten und Resuspendieren der Kulturen. </li><li> Stellen Sie die Elektroporator bis 310 V / 950 &amp; mgr; F und liefern einen Impuls zu jeder Küvette. </li><li> Resuspendieren der 300 ul RBC in der Küvette in vorgewärmten komplette malArie Medien und platten sie in 24-Well-Platten und Inkubieren bei 37 ° C in einem luftdichten Behälter mit Malaria Blutgasgemisch (3% O 2, 5% CO 2). </li><li> Nach 4 Stunden, infizieren transfizierten RBCs mit synchronisierten späte Trophozoiten auf eine ungefähre endgültige Parasitämie von 1%. </li><li> In frisch transfiziert RBCs alle 4-6 Tage, um infizierten Kulturen und bestimmen Sie die% Parasitämie durch FACS mit Jo-Jo-1-Färbung, wie in Abschnitt 4 angegeben. </li></ol> 4: Bestimmung der Erythrozyten-microRNAs Wirkung auf Parasiteninfektion bewerten <ol><li> Nehmen Sie 100 ul der resuspendierten Kultur durch Mikropipette und in ein 1,7 ml Mikrozentrifugenröhrchen. Zweimaliges Waschen mit 1 ml 1 × PBS und zentrifugieren in einer Tischmikrozentrifuge durch Zentrifugation bei 800 × g für 5 min. </li><li> Pellet in 1 ml 0,025% Glutaraldehyd. Proben, 20 min bei RT. HINWEIS: Proben können hier für mehrere Wochen bei 4 ° C gelagert werden. Danach pelletieren die infizierte RBCs durch Zentrifugation bei 800 × g für 5 min. Waschen zweimal mit 1 ml 1x PBS. </li><li> Pellet in 1 ml 0,015% Saponin. Inkubieren bei 4 ° C für 15 min. Pellet infizierter Erythrozyten durch Zentrifugation bei 800 × g für 5 min. Waschen zweimal mit 1 ml 1x PBS. Repeat.4.3. Die Zellen in 1 ml 1 × PBS, enthaltend 1 ul (1,000x) DNA-Farbstoff. </li><li> Bestimmen den Grad der Parasitämie auf einem Durchflusszytometer, bei 488 nM Anregung und ~ 530 nm (FL-1) Emission. </li><li> Zuerst Gate das Durchflusszytometer basierend auf FSC und SSC auf Erythrozyten zu konzentrieren. Dann messen Sie den Grad der Parasitämie (infizierten Erythrozyten) in der gesperrten RBC durch Fluoreszenz in der FL-1-Kanal. HINWEIS: später Parasiten sind 10X mehrere fluoreszierende als früher Parasiten und ~ 100X oben nicht infizierten Erythrozyten. Auch das Sammeln bei niedriger Geschwindigkeit neigt dazu, Rauschen zu reduzieren. Schließlich hat diese Herangehensweise an 3 H-Hypoxanthin Einbau und Giemsa sowohl wie zuvor berichtet 13, sowie alle Techniken gav verglichenE ähnliche Ergebnisse. </li></ol> 5: Biotin-Tagging und Elution von miRNA-mRNA Fusion Produkte <ol><li> Direkt bestellen kundenspezifische synthetische RNA-Oligonukleotide mit Desthiobiotin (DB), die kovalent an das 5&#39;-Ende verbunden sind. </li><li> Transfektion von nicht-infizierten roten Blutkörperchen mit Desthiobiotin konjugierten (DB-) miRNA und unmodifizierten miRNA (negative Kontrolle), wie in Schritt 3 dargestellt. </li><li> Infizieren transfiziert RBCs mit P. falciparum-Parasiten zu einer Start Parasitämie von 0,5% (Schritt 1.1). </li><li> Auszug Parasiten RNA 4 Tage (96 Stunden) später, wie oben in Schritt 1 beschrieben. </li><li> Inkubieren 10 ug Parasiten RNA mit 50 &amp; mgr; l Streptavidin-Kügelchen gepackt, aufgenommen mittels Mikropipette, und drehen sich auf einem Mikrozentrifugenröhrchen Rotator für 1 Stunde bei 4 ° C. </li><li> Pellet die Kügelchen bei 800 · g für 30 Sekunden und Waschen mit 20 mM KCl und 1 / 1.000 RNase Inhibitor. </li><li> Eluieren RNAs aus den Perlen durch Konkurrenz mit 2 mM Biotin und mit 200 &amp; mgr; l RNA-Capture-Elutionspuffer (20 mM KCl, 1/1000 RNase Inhibitor und 2 mM Biotin) bei 4 ° C über Nacht mit Rotation. </li><li> Bestimmen den Grad der Anreicherung angegeben P. falciparum Transkripte mit SYBR green qRT-PCR und microRNA-Anreicherung (positive Kontrolle) durch TaqMan qPCR wie in Schritt 2 angegeben. </li></ol> 6: Polysomen Trennung an die ribosomale Belegung von P. Bestimmen falciparum <ol><li> Platzieren von 5 ml 15% Saccharose-Lösung (400 mM Kaliumacetat, 25 mM Kalium HEPES, pH 7,2, 15 mM Magnesiumacetat, 200 &amp; mgr; M Cycloheximid, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase-Inhibitor und 15% Saccharose ) in einem SW41 Ultrazentrifugenröhrchen (14 x 89 mm). </li><li> Unter Verwendung einer 5 ml Spritze mit 5 ml 50% Saccharose-Lösung (400 mM Kaliumacetat, 25 mM Kalium HEPES, pH 7,2, 15 mM Magnesiumacetat, 200 &amp; mgr; M Cycloheximid, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase Inhibitor, und 50% Saccharose) unterhalb der 15% Saccharose mit einem langen Stahlnadel, dann entfernen Sie die Nadel. </li><li&gt; Verschließen Sie die Oberseite des Gradienten Rohr mit Parafilm, kippen Sie den Schlauch langsam auf die Seite, in einer stabilen Position gegen Wegrollen, so dass es horizontal auf der Tischplatte. Halten des Rohres auf seiner Seite für mindestens 2 Std. Während der Wartezeit, beginnen Sie mit Schritt 6.5. </li><li> Nach 2 Stunden langsam kippen Sie das Rohr wieder aufrecht und übertragen Sie das Rohr auf Eis, so dass sie für mindestens 15 Minuten vor der Probenbeladung (Schritt 14) zu kühlen. </li><li> Sammeln Sie genug Plasmodium infizierte Blutstadium Kultur 100-500 ug Gesamt-RNA, oder ungefähr 100 ml asynchronen Kultur bei 3-5% Parasitämie zu generieren. Hinzuzufügen 1/10 dem Volumen des Kulturmediums, das 10-fach (2 mM) Cycloheximid (CHX) und bei 37 ° C für 10 min. <ol><li> Pellet Kulturen durch Zentrifugation bei 500 g für 7 min mit der Zentrifuge (Bremse 1), dann zweimal waschen mit Raumtemperatur 1x PBS, das 200 uM CHX. Resuspendieren der Parasitenkulturen in 1x PBS, das 200 uM CHX und speichern Sie auf dem Eis. </li></ol></li&gt; <li> Schätzen Sie das Volumen der RBC-Pellet. Hinzufügen Lysepuffer (400 mM Kaliumacetat, 25 mM Kalium HEPES, pH 7,2, 15 mM Magnesiumacetat, 200 &amp; mgr; CHX, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase Inhibitor, 1% (v / v) IGEPAL CA -630, und 0,5% (w / v) DOC) in die RBC-Pellet bis zu einem Endvolumen von 4,25 ml. Inkubieren des Lysats bei 4 ° C für 10 Minuten unter Rotation. </li><li> Transfer des Lysats auf Mikrozentrifugenröhrchen und anschließend zentrifugiert werden die Proben in einer Mikrozentrifuge bei 16.000 × g und 4 ° C für 10 min. </li><li> Vorbereitung Saccharosekissen durch Pipettieren von 1,25 ml kaltem 0,5 M Saccharose-Kissen-Lösung (400 mM Kaliumacetat, 25 mM Kalium HEPES, pH 7,2, 15 mM Magnesiumacetat, 200 &amp; mgr; M Cycloheximid, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase Inhibitor und 0,5 M Saccharose) in einem SW55 Ultrazentrifugenröhrchen (13 x 51 mm). </li><li> Sorgfältig Schicht 3,75 ml Lysatüberstand (aus Schritt 7) auf der Oberseite des Saccharose-Kissen unter Verwendung einer Spritze und kleine (~ 27) Gauge-Nadel. Store die verbleibende Lysat (~ 500 &amp; mgr; l) bei -80 ° C, um die Gesamt-RNA Niveaus zu extrahieren, wie in Abschnitt 1 angegeben. </li><li> Laden der Proben in der Ultrazentrifuge Rotor vorgekühlter bis 4 ° C, das 13,2-ml-Röhrchen aufnehmen kann. Zentrifugieren der Proben bei 366.000 × g und 4 ° C für 146 min. </li><li> Mit einer Pipette den Überstand in ein 15 ml konischen Röhrchen. Lagern Sie den Überstand bei -80 ° C für die RNA-Isolierung von freiem (ungebundenem von Ribosomen) RNAs. </li><li> Resuspendieren Ribosom-Pellet in 500 ul Ribosomen Resuspensionspuffer (400 mM Kaliumacetat, 25 mM Kalium HEPES, pH 7,2, 15 mM Magnesiumacetat, 200 &amp; mgr; M Cycloheximid, 1 mM DTT, 1 mM PMSF, und 40 U / ml RNase-Inhibitor) durch Pipettieren von 5 min. </li><li> Zentrifugieren der Proben in einer Mikrozentrifuge bei 16.000 × g und 4 &#160; ° C für 10 min. </li><li> Während die Gradienten von Schritt 4 auf Eis, entfernen Sie die Parafilm, dann vorsichtig Schicht das Ribosom Suspension oben auf dem Gradienten using eine Spritze und kleine (~ 27) Nadel. </li><li> Legen Sie den Schlauch in ein vorgekühltes Ultrazentrifuge Rotor und Zentrifuge die geladenen Farbverläufe bei 200.000 xg und 4 ° C für 180 min. Wenn der Spin beendet ist, zentrifugiert store Gradienten bei 4 ° C, bis Sie sie auf den Fraktionator zu laden. </li><li> Legen Sie eine leere Ultrazentrifugenröhrchen in die Gradienten Fraktionator (dies kann ein Rohr in einem vorherigen Durchlauf verwendet werden kann), dann mit RNase-freiem Wasser waschen für 5 min bei 100 x 10 Geschwindigkeit. </li><li> Während des Wasch in Schritt 6.16, stellen Sie die Empfindlichkeit des UV-Absorptionsdetektor. Ein guter Ausgangsempfindlichkeit liegt bei 0,2, aber dies möglicherweise in späteren läuft auf der A 254-Signal (die auf Parasiten Nummer usw. auf Basis variiert), je nach eingestellt werden. </li><li> Sobald die Detektorempfindlichkeit eingestellt ist, stellen Sie die Grundliniensignal auf Null, während Wasser durch den Detektor strömt. </li><li> Nach dem Waschen der Fraktionssammler, kehren Sie den Flüssigkeitsstrom, bis die Leitungen leer sind und dann remove, das leere Ultrazentrifugenröhrchen. </li><li> Führen Sie 60% Saccharose-Lösung durch den Fraktionator bis zum Nadelgerät verlässt. </li><li> Legen Sie die Röhrchen mit dem ersten Gradienten an der Spitze der Ladekammer und die Dichtung festziehen, dabei nicht zu fest anziehen. Dann durchstechen die Unterseite des Rohres mit der Nadel. </li><li> Setzen Sie die Flüssigkeitsströmungsgeschwindigkeit von 12,5 x 10 (von der Strömungsgeschwindigkeit Drehknopf auf der Vorderseite der Pumpe gesteuert wird), legen Sie dann den automatischen Fraktionssammler bis 18 sec Fraktionen zu sammeln (~ 330 &amp; mgr; l / Fraktion) in Mikrozentrifugenröhrchen. </li><li> Start vorwärts Fluss der 60% Saccharose-Lösung. </li><li> Wenn der erste Tropfen des Gradienten-Lösung fällt in den Mikrozentrifugenröhrchen, sofort beginnen sowohl die Fraktionssammlung und Live-Mitschnitt der A 254-Signal. </li><li> Nach einem starken Rückgang in der A 254-Signal beobachtet, entsprechend der Schnittstelle zwischen 50% und 60% Saccharose-Lösungen, zu stoppen sowohl die Fluidströmung und A 254 </sub&gt; Aufnahme. </li><li> Bewahren Sie die Gradientenfraktionen bei -80 &#160; ° C für die spätere Verwendung. </li><li> Kehren Sie den Flüssigkeitsstrom bei 100 x 10-fach, bis das 60% Saccharose-Lösung leert sich der Ultrazentrifugenröhrchen. </li><li> Wenn es zusätzliche Gradienten zu fraktionieren, entfernen Sie die leere Ultrazentrifugenröhrchen aus der Ladekammer und starten Sie mit Schritt 6.21. Wenn alle Proben abgeschlossen sind, waschen Sie die Vorrichtung wurde in Schritten 6.16 und 6.19 durchgeführt. </li></ol>

<ol>
	<li>World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> World Malaria Report. , (2014).</li><li>Livincstone, F. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malaria+and+human+polymorphisms.">Malaria and human polymorphisms.</a> Annu Rev Genet. 5, 33-64 (1971).</li><li>Nagel, R. L., Roth, E. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malaria+and+red+cell+genetic+defects.">Malaria and red cell genetic defects.</a> Blood. 74, 1213-1221 (1989).</li><li>Aidoo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+effects+of+the+sickle+cell+gene+against+malaria+morbidity+and+mortality.">Protective effects of the sickle cell gene against malaria morbidity and mortality.</a> Lancet. 359, 1311-1312 (2002).</li><li>Tiffert, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+hydration+state+of+human+red+blood+cells+and+their+susceptibility+to+invasion+by+Plasmodium+falciparum.">The hydration state of human red blood cells and their susceptibility to invasion by Plasmodium falciparum.</a> Blood. 105, 4853-4860 (2005).</li><li>Fairhurst, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Abnormal+display+of+PfEMP-1+on+erythrocytes+carrying+haemoglobin+C+may+protect+against+malaria.">Abnormal display of PfEMP-1 on erythrocytes carrying haemoglobin C may protect against malaria.</a> Nature. 435, 1117-1121 (2005).</li><li>Cyrklaff, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemoglobins+S+and+C+interfere+with+actin+remodeling+in+Plasmodium+falciparum-infected+erythrocytes.">Hemoglobins S and C interfere with actin remodeling in Plasmodium falciparum-infected erythrocytes.</a> Science. 334, 1283-1286 (2011).</li><li>Friedman, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Erythrocytic+mechanism+of+sickle+cell+resistance+to+malaria.">Erythrocytic mechanism of sickle cell resistance to malaria.</a> Proceedings of the National Academy of Sciences of the United States of America. 75, 1994-1997 (1978).</li><li>Pasvol, G., Weatherall, D. J., Wilson, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+mechanism+for+the+protective+effect+of+haemoglobin+S+against+P.+falciparum+malaria.">Cellular mechanism for the protective effect of haemoglobin S against P. falciparum malaria.</a> Nature. 274, 701-703 (1978).</li><li>Lecellier, C. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cellular+microRNA+mediates+antiviral+defense+in+human+cells.">A cellular microRNA mediates antiviral defense in human cells.</a> Science. 308, 557-560 (2005).</li><li>Niu, Q. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+artificial+miroRNAs+in+transgenic+Arabidopsis+thaliana+confers+virus+resistance.">Expression of artificial miroRNAs in transgenic Arabidopsis thaliana confers virus resistance.</a> Nature biotechnology. 24, 1420-1428 (2006).</li><li>Zhao, G., Yu, D., Weiss, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNAs+in+erythropoiesis.">MicroRNAs in erythropoiesis.</a> Curr Opin Hematol. 17, 155-162 (2010).</li><li>Lee, Y. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LIN28B-mediated+expression+of+fetal+hemoglobin+and+production+of+fetal-like+erythrocytes+from+adult+human+erythroblasts+ex+vivo.">LIN28B-mediated expression of fetal hemoglobin and production of fetal-like erythrocytes from adult human erythroblasts ex vivo.</a> Blood. 122, 1034-1041 (2013).</li><li>Sangokoya, C., Doss, J. F., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iron-responsive+miR-485-3p+regulates+cellular+iron+homeostasis+by+targeting+ferroportin.">Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin.</a> PLoS genetics. 9, e1003408 (2013).</li><li>Chen, S. Y., Wang, Y., Telen, M. J., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genomic+analysis+of+erythrocyte+microRNA+expression+in+sickle+cell+diseases.">The genomic analysis of erythrocyte microRNA expression in sickle cell diseases.</a> PLoS ONE. 3, e2360 (2008).</li><li>Sangokoya, C., Telen, M. J., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=microRNA+miR-144+modulates+oxidative+stress+tolerance+and+associates+with+anemia+severity+in+sickle+cell+disease.">microRNA miR-144 modulates oxidative stress tolerance and associates with anemia severity in sickle cell disease.</a> Blood. 116, 4338-4348 (2010).</li><li>Deitsch, K., Driskill, C., Wellems, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+malaria+parasites+by+the+spontaneous+uptake+and+expression+of+DNA+from+human+erythrocytes.">Transformation of malaria parasites by the spontaneous uptake and expression of DNA from human erythrocytes.</a> Nucleic acids research. 29, 850-853 (2001).</li><li>Liang, X. H., Haritan, A., Uliel, S., Michaeli, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=trans+and+cis+splicing+in+trypanosomatids:+mechanism,+factors,+and+regulation.">trans and cis splicing in trypanosomatids: mechanism, factors, and regulation.</a> Eukaryotic cell. 2, 830-840 (2003).</li><li>Baum, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+genetics+and+comparative+genomics+reveal+RNAi+is+not+functional+in+malaria+parasites.">Molecular genetics and comparative genomics reveal RNAi is not functional in malaria parasites.</a> Nucleic acids research. 37, 3788-3798 (2009).</li><li>Hall, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+survey+of+the+Plasmodium+life+cycle+by+genomic,+transcriptomic,+and+proteomic+analyses.">A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses.</a> Science. 307, 82-86 (2005).</li><li>Caro, F., Ahyong, V., Betegon, M., DeRisi, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+regulatory+dynamics+of+translation+in+the+asexual+blood+stages.">Genome-wide regulatory dynamics of translation in the asexual blood stages.</a> eLife. 3, (2014).</li><li>Oehring, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organellar+proteomics+reveals+hundreds+of+novel+nuclear+proteins+in+the+malaria+parasite+Plasmodium+falciparum.">Organellar proteomics reveals hundreds of novel nuclear proteins in the malaria parasite Plasmodium falciparum.</a> Genome biology. 13, R108 (2012).</li><li>Lasonder, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+Plasmodium+falciparum+proteome+by+high-accuracy+mass+spectrometry.">Analysis of the Plasmodium falciparum proteome by high-accuracy mass spectrometry.</a> Nature. 419, 537-542 (2002).</li><li>Bozdech, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcriptome+of+the+intraerythrocytic+developmental+cycle+of+Plasmodium+falciparum.">The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum.</a> PLoS biology. 1, E5 (2003).</li><li>Gardner, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+the+human+malaria+parasite+Plasmodium+falciparum.">Genome sequence of the human malaria parasite Plasmodium falciparum.</a> Nature. 419, 498-511 (2002).</li><li>Zhang, M., Joyce, B. R., Sullivan, W. J., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+control+in+Plasmodium+and+toxoplasma+parasites.">Translational control in Plasmodium and toxoplasma parasites.</a> Eukaryotic cell. 12, 161-167 (2013).</li><li>Lacsina, J. R., LaMonte, G., Nicchitta, C. V., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+profiling+of+the+malaria+parasite+Plasmodium+falciparum.">Polysome profiling of the malaria parasite Plasmodium falciparum.</a> Molecular and biochemical parasitology. 179, 42-62 (2011).</li><li>Bunnik, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+profiling+reveals+translational+control+of+gene+expression+in+the+human+malaria+parasite+Plasmodium+falciparum.">Polysome profiling reveals translational control of gene expression in the human malaria parasite Plasmodium falciparum.</a> Genome biology. 14, R128 (2013).</li><li>LaMonte, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translocation+of+sickle+cell+erythrocyte+microRNAs+into+Plasmodium+falciparum+inhibits+parasite+translation+and+contributes+to+malaria+resistance.">Translocation of sickle cell erythrocyte microRNAs into Plasmodium falciparum inhibits parasite translation and contributes to malaria resistance.</a> Cell host &amp; microbe. 12, 187-199 (2012).</li><li>Lambros, C., Vanderberg, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synchronization+of+Plasmodium+falciparum+erythrocytic+stages+in+culture.">Synchronization of Plasmodium falciparum erythrocytic stages in culture.</a> The Journal of parasitology. 65, 418-420 (1979).</li><li>Bourgeois, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+three+real-time+PCR+methods+with+blood+smears+and+rapid+diagnostic+test+in+Plasmodium+sp.+infection.">Comparison of three real-time PCR methods with blood smears and rapid diagnostic test in Plasmodium sp. infection.</a> Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases. 16, 1305-1311 (2010).</li><li>Abruzzo, L. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Validation+of+oligonucleotide+microarray+data+using+microfluidic+low-density+arrays:+a+new+statistical+method+to+normalize+real-time+RT-PCR+data.">Validation of oligonucleotide microarray data using microfluidic low-density arrays: a new statistical method to normalize real-time RT-PCR data.</a> Biotechniques. 38, 785-792 (2005).</li><li>Sangokoya, C., LaMonte, G., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+microRNAs+of+human+mature+erythrocytes.">Isolation and characterization of microRNAs of human mature erythrocytes.</a> Methods in molecular biology. 667, 193-203 (2010).</li><li>Rathjen, T., Nicol, C., McConkey, G., Dalmay, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+short+RNAs+in+the+malaria+parasite+and+its+red+blood+cell+host.">Analysis of short RNAs in the malaria parasite and its red blood cell host.</a> FEBS Lett. 580, 5185-5188 (2006).</li><li>Xue, X., Zhang, Q., Huang, Y., Feng, L., Pan, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=No+miRNA+were+found+in+Plasmodium+and+the+ones+identified+in+erythrocytes+could+not+be+correlated+with+infection.">No miRNA were found in Plasmodium and the ones identified in erythrocytes could not be correlated with infection.</a> Malar J. 7, 47 (2008).</li></ol>

The authors have no competing financial interests to declare.

HbS ist eine der häufigsten Hämoglobinvarianten in Malaria-endemischen Gebieten, vor allem, weil er Schutz gegen schwere Malaria durch P. verursacht falciparum. Die Techniken erforderlich, um die Rolle des menschlichen MikroRNA in der Genregulation P. charakterisieren falciparum werden in diesem Manuskript beschrieben. Durch Extraktion der Gesamt-RNA in einer solchen Weise, dass alle kleinen RNAs umfassen, und durch Ausführen einer relativ einfachen Parasiten Lyseverfahren waren di...

Malaria, durch apicomplexan Parasiten der Gattung Plasmodium verursacht, ist die häufigste menschliche parasitäre Erkrankung, weltweit zu infizieren rund 200 Millionen Menschen jedes Jahr und verursacht etwa 600.000 Todesfälle 1. Von den fünf Plasmodium-Arten, die Menschen infizieren, die relevant für die menschliche Krankheit sind P. falciparum und P. vivax, die aufgrund ihrer weit verbreiteten Distributionen und Potenzial für schwere Malaria Komplikationen. Der Lebenszyklus des Malaria-Parasiten-Infektion erfordert beider Mücken und Menschen. Wenn eine infizierte Mückenstiche einen Menschen, die Parasiten reisen durch den Blutstrom in die Leber, wo eine erste Runde der Replikation erfolgt. Nach Merozoiten Bruch von der Host-Hepatozyten, infizieren sie in der Nähe von roten Blutzellen, die Einleitung entweder asexuell oder sexueller Replikation. Die asexuelle Phase der Replikation, die 48 Stunden in P. dauert falciparum ist der Schwerpunkt dieser Studie, da es sowohl die Quelle der meisten malArie Symptome und ist leicht in vitro rekapituliert. Während eine Reihe von öffentlichen Gesundheitsinitiativen, einschließlich der Verbesserung der Anti-Malaria-Therapien haben etwas reduziert die Belastung durch Malaria weltweit, die anhaltende Entstehung von arzneimittelresistenten Parasiten stellt ein Problem für Malaria-Kontrolle Anstrengungen. Ein Bereich, der neue Therapieansätze vorschlagen kann, ist die Studie darüber, wie verschiedene genetische Varianten Resistenz gegen Malaria. In malariaendemischen Gebieten, eine Vielzahl von Erythrozyten-Polymorphismen sind durchaus üblich 2,3. Diese Mutationen, mit Sichelzell wobei vielleicht das bekannteste, sind oft mit erheblichen Resistenz gegen den Ausbruch der symptomatischen Malariainfektion 4 verbunden. Die zugrunde liegenden Mechanismen, durch die sie verursachen Erythrozyten an Malaria-Infektion zu widerstehen sind unvollständig verstanden. Parasitierten Erythrozyten mit Hämoglobin-Mutationen sind, gelten verstärkte Phagozytose durch verbesserte zelluläre Steifigkeit und Dehydrierung, diemit verringerten Invasion von P. zugeordnet falciparum 5. HBC Allel betrifft auch Protein-Expression auf der Erythrozytenoberfläche und mit dem Umbau des Zytoskeletts, ferner Hemmung Parasitenentwicklung 6,7. Schließlich P. falciparum wächst schlecht in homozygoter Sichel (HBSS) Erythrozyten 8,9 in vitro, was darauf hindeutet, intrinsische erythrozytären Faktoren Malariaresistenz. Doch während all dieser Mechanismen scheinen eine Rolle zu spielen, sie nicht vollständig erklären die Mechanismen hinter Sichelzelle Resistenz gegen Malaria. Ein möglicher Satz von Erythrozyten-Faktoren, die schlecht verstanden, bleiben die großen Pool von miRNA vorhanden innerhalb von reifen Erythrozyten. MicroRNAs sind kleine nicht-kodierende RNAs, 19-25 nt in der Größe, die Übersetzung und / oder Stabilität der Ziel-mRNAs durch Basenpaarung in der 3&#39;-UTR zu vermitteln. Sie haben bei der Steuerung der Immunantwort von Säugetieren in Verbindung gebracht worden, einschließlich der Unterdrückung of die Virusreplikation 10 und gezeigt wurden, um Resistenz gegen Viren in Pflanzen Sie haben auch gezeigt, dass mehrere Erythrozyten-Prozesse, einschließlich Erythropoese 11,12 und Eisenstoffwechsel 13 regulieren. Frühere Studien identifiziert eine reiche und vielfältige Bevölkerung von Erythrozyten-miRNAs, deren Expression dramatisch in HBSS verändert Erythrozyten 14,15. Da reifen Erythrozyten mangelt aktive Transkription und Translation, bleibt die funktionelle Bedeutung dieser Erythrozyten miRNAs unklar. Als wesentliche Stoffaustausch zwischen der Wirtszelle und P. auftritt falciparum während der intraerythrozytären Entwicklungszyklus (IDC) 16, wurde spekuliert, dass die veränderte miRNA Profil innerhalb HbS Erythrozyten direkt mit zell intrinsische Malaria Festigkeit beizutragen. Diese Studien schließlich zur Entwicklung einer Pipeline führte zu isolieren, zu identifizieren und funktionell untersuchen die Rolle des menschlichen miRNA innerhalb der malaria Parasiten P. falciparum, die ergab, dass diejenigen Host / menschlichen miRNAs letztendlich kovalent Sicherung und dann translational verdrängen Parasiten mRNA-Transkripte 17. Dies war ein Beispiel für den ersten Quer Spezies chimäre Transkripte Transspleiß gebildet und impliziert, dass dieser miRNA-mRNA Fusion könnte in anderen Spezies, einschließlich anderer Parasiten auftreten werden. Alle trypanosome mRNAs Transspleißprodukten mit einer Splice-Leader (SL), um die Trennung der polycistronische Transkripte 18 regulieren. Da P. falciparum fehlt Orthologe für Dicer / Ago 19,20 ist es möglich, dass Erythrozyten-miRNAs entführen ähnliche SL Maschinen in P. falciparum in Zielgenen zu integrieren. Jüngste Studien in P. falciparum haben in der Tat zeigte die Anwesenheit von 5&#39;-Spleißstelle Leader-Sequenzen 21. Diese Studie beschreibt die Verfahren, die zur Entdeckung der menschlichen Parasit miRNA-mRNA Fusionstranskripte geführt, die sowohl transkriptomischen und Übersettionalen Regeltechnik. Die allgemeinen Ziele dieser Methoden sind, um die Auswirkungen von kleinen RNAs in der Genregulation Phänotypen und Übersetzungs Potential von P. untersuchen falciparum Transkripte. Die anfängliche Identifizierung von Menschenparasit chimären Transkripten geltend gemachten Benutzung RNA Analysetechniken, wie beispielsweise Echtzeit-PCR, Transkriptom-Sequenzierung und EST-Bibliothek zu erfassen, die sowohl insgesamt und kleinen RNAs, anstatt mit Hilfe von Techniken, die nur vereinzelt kleine RNAs enthalten. Isolieren aller RNA zusammen in einem großen Pool, anstatt separat, erlaubte die Identifizierung beider transloziert menschlichen kleine RNAs im Parasiten sowie das Vorhandensein dieser kleinen RNA-Sequenzen als Teil einer größeren Sequenz. Dies erforderte dann eine Analyse der Übersetzungszustand dieser Fusions mRNAs, die funktionellen Konsequenzen dieser Fusionen bestimmen. Während umfangreiche Bemühungen auf Charakterisierung des Parasiten Genom eind Transkriptom haben zum Verständnis der Biologie des Parasiten 22-25 hinzugefügt wird, wird weit weniger über die Translationsregulation der mRNA Transkriptom über den Lebenszyklus von P. bekannt falciparum 26. Diese begrenzte Verständnis des Parasiten Proteom hat sowohl Verständnis des Parasiten der Biologie und die Fähigkeit, neue Ziele für die nächste Generation von Anti-Malaria-Therapeutika identifizieren behindert. Diese Lücke im Verständnis der Zellbiologie des Parasiten wurde vor allem aufgrund der Mangel an geeigneten Techniken beibehalten, um Translationsregulation in P. untersuchen falciparum. Ein aktuelles Papier beschrieben die Verwendung von ribosomalen Footprinting von P. falciparum, die globale Übersetzungsstatus 21 zu bestimmen. Eine gut etablierte Messtranslations Potential von Transkripten ist die Anzahl der von Polysomen-Profiling bestimmt zugeordnet Ribosomen. Jedoch, wenn diese Technik auf P. angewendet falciparum &lt;/ em&gt;, ist es nicht in der Lage, die meisten Polysomen erholen und fängt vorwiegend monosomes. In jüngerer Zeit haben mehrere Gruppen 27,28 P. optimiert falciparum Polysom ​​Techniken durch Lyse der Erythrozyten und Parasiten gleichzeitig, um die Polysomen zu bewahren und zu charakterisieren, die ribosomale Belegung und translationalen Potenzial dieser Malaria-Parasiten während ihrer asexuelle Entwicklung in Wirts roten Zellen 28. Zusammen zeigen diese Verfahren, dass die beobachtete Fusion von menschlichen miRNA und Parasiten mRNAs moduliert Parasitenprotein Übersetzung dieser Fusions mRNAs, die unter Verwendung von zuvor beschriebenen Verfahren 27 gezeigt wurde, und ist eine wichtige Determinante der Malaria Widerstand HbAS und HbSS Erythrozyten 17. Diese Methoden sinnvoll in einem System suchen zu identifizieren und funktionell zu erforschen RNA-Splicing Ereignisse sein, ob diese Fusion RNAs sind in P. falciparum oder andere eukaryotische Systeme.

<table><tbody><tr><td>&lt;strong&gt;REAGENTS-All reagents must be RNAse-free.&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Diethyl pyrocarbonate</td><td>Sigma</td><td>D5758</td><td>DEPC</td></tr><tr><td>DEPC-treated water (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>Yoyo-1 DNA fluorescent dye</td><td>Thermo Fisher</td><td></td><td></td></tr><tr><td>Gene Pulser II electroporator</td><td>Bio-Rad</td><td></td><td></td></tr><tr><td>0.2 cm Electroporation cuvettes</td><td></td><td></td><td></td></tr><tr><td>4 M potassium acetate</td><td>Mallinckrodt</td><td>6700</td><td></td></tr><tr><td>2 M potassium HEPES</td><td>Sigma</td><td>H0527</td><td>pH 7.2</td></tr><tr><td>1 M magnesium acetate</td><td>Sigma</td><td>M-2545</td><td></td></tr><tr><td>1 M dithiothreitol</td><td>Research Products International</td><td>D11000</td><td>DTT</td></tr><tr><td>100 mM phenylmethylsulfonate fluoride</td><td>Sigma</td><td>P7626</td><td>PMSF, dissolved in isopropanol</td></tr><tr><td>10% (v/v) Igepal CA-630</td><td>Sigma-Aldrich</td><td>I3021</td><td></td></tr><tr><td>10% (w/v) sodium deoxycholate</td><td>Sigma</td><td>D-6750</td><td>DOC</td></tr><tr><td>Cycloheximide</td><td>Sigma</td><td>C-7698</td><td>CHX</td></tr><tr><td>Sucrose</td><td>Mallinckrodt</td><td>8360-04</td><td></td></tr><tr><td>RNAseOUT (Invitrogen, cat. no. 100000840)</td><td>Invitrogen</td><td>100000840</td><td></td></tr><tr><td>RPMI-1640 w/ L-glutamine</td><td>Cellgro</td><td>10-040-CV</td><td></td></tr><tr><td>10% AlbuMAX I</td><td>Invitrogen</td><td>11020-039</td><td>w/v in sterile water</td></tr><tr><td>Gentamicin</td><td>Gibco</td><td>15750-060</td><td></td></tr><tr><td>HT supplement (100x) (Invitrogen, cat. no. 11067030)</td><td></td><td></td><td></td></tr><tr><td>45% (w/v) sucrose (Sigma, cat no. G8769)</td><td></td><td></td><td></td></tr><tr><td>1 M HEPES buffer (Gibco, cat. no. 15630-080)</td><td></td><td></td><td></td></tr><tr><td>1x phosphate buffered saline (PBS; Cellgro, cat. no. 2109310CV)</td><td></td><td></td><td></td></tr><tr><td>Corning 500 ml vacuum filter flask (VWR, cat. no. 430769)</td><td></td><td></td><td></td></tr><tr><td>Glass slides (VWR, cat. no. 48311-702)</td><td></td><td></td><td></td></tr><tr><td>Giemsa stain (50X) (VWR, cat no. m708-01)</td><td></td><td></td><td></td></tr><tr><td>mirVana miRNA isolation kit (Ambion, ThermoFisher Scientific).</td><td></td><td></td><td></td></tr><tr><td>5&#039; Biotin conjugated mature miRNA (sequence varies by miRNA of interest) (Dharmacon)</td><td></td><td></td><td></td></tr><tr><td>Biotin powder (Sigma-Aldrich)</td><td></td><td></td><td></td></tr><tr><td>1 M Potassium Chloride</td><td></td><td></td><td></td></tr><tr><td>Streptavidin Sepharose High Performance Beads (GE Healthcare)</td><td></td><td></td><td></td></tr><tr><td>Ribosome resuspension buffer (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>Lysis buffer (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>15% (w/v) sucrose gradient solution (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>50% (w/v) sucrose gradient solution (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>0.5 M sucrose cushion (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>60% (w/v) sucrose chase solution (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>Plasmodium cell culture media (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>RNA capture Wash Buffer (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>RNA Elution Buffer (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;REAGENT SETUP&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Solutions&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Plasmodium cell culture media&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>500 ml RPMI-1640 w/ L-glutamine</td><td></td><td></td><td></td></tr><tr><td>0.5 ml gentamicin</td><td></td><td></td><td></td></tr><tr><td>5 ml HT supplement</td><td></td><td></td><td></td></tr><tr><td>2.5 ml 45% glucose</td><td></td><td></td><td></td></tr><tr><td>25 ml 10% AlbuMAX I</td><td></td><td></td><td></td></tr><tr><td>12.5 ml 1 M HEPES</td><td></td><td></td><td></td></tr><tr><td>Sterile filter with 0.2 mm vacuum filter flask.</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Plasmodium cell culture media containing 10x CHX&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Same recipe as Plasmodium cell culture media above, with the addition of:</td><td></td><td></td><td></td></tr><tr><td>2 mM cycloheximide</td><td></td><td></td><td></td></tr><tr><td>Media is prepared as normal, then add CHX to a final concentration of 2 mM and filter.&amp;nbsp;</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;1x PBS containing cycloheximide&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Cycloheximide is added fresh to 1x PBS to a final concentration of 200 mM, and kept at 4 &lt;sup&gt;O&lt;/sup&gt;C until use.</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Ribosome resuspension buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>400 mM potassium acetate</td><td></td><td></td><td></td></tr><tr><td>25 mM potassium HEPES, pH 7.2</td><td></td><td></td><td></td></tr><tr><td>15 mM magnesium acetate</td><td></td><td></td><td></td></tr><tr><td>200 mM cycloheximide (add fresh)</td><td></td><td></td><td></td></tr><tr><td>1 mM DTT (add fresh)</td><td></td><td></td><td></td></tr><tr><td>1 mM PMSF (add fresh)</td><td></td><td></td><td></td></tr><tr><td>40 U/ml RNaseOUT (add fresh)</td><td></td><td></td><td></td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Lysis buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Same recipe as ribosome resuspension buffer above, with the addition of:</td><td></td><td></td><td></td></tr><tr><td>1% (v/v) Igepal CA-630</td><td></td><td></td><td></td></tr><tr><td>0.5% (w/v) DOC</td><td></td><td></td><td></td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Sucrose solutions&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Same recipe as ribosome resuspension buffer above, with the addition of varying amounts of sucrose:</td><td></td><td></td><td></td></tr><tr><td>15% (w/v) sucrose to make 15% sucrose gradient solution</td><td></td><td></td><td></td></tr><tr><td>50% (w/v) sucrose to make 50% sucrose gradient solution</td><td></td><td></td><td></td></tr><tr><td>0.5 M sucrose to make 0.5 M sucrose cushion</td><td></td><td></td><td></td></tr><tr><td>As above, cycloheximide, DTT, PMSF, and RNaseOUT must be added fresh.</td><td></td><td></td><td></td></tr><tr><td>The 60% sucrose chase solution requires only sucrose and water, no other components</td><td></td><td></td><td></td></tr><tr><td>60% (w/v) sucrose in DEPC-treated water to make 60% sucrose chase solution</td><td></td><td></td><td></td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;RNA Capture Wash Buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>20 mM&amp;nbsp; KCl</td><td></td><td></td><td></td></tr><tr><td>5 unit/ml Rnase Out (Invitrogen)</td><td></td><td></td><td></td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;RNA Capture Elution Buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Same recipe as RNA Capture Wash Buffer, with the addition of:</td><td></td><td></td><td></td></tr><tr><td>2 mM Biotin</td><td></td><td></td><td></td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;EQUIPMENT&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>SW55 Ti ultracentrifuge rotor (Beckman, cat. no. 342194)</td><td></td><td></td><td></td></tr><tr><td>SW41 Ti ultracentrifuge rotor (Beckman, cat. no. 331362)</td><td></td><td></td><td></td></tr><tr><td>Ultra-Clear&lt;sup&gt;TM&lt;/sup&gt; &amp;frac12; x 2 in (13 x 51 mm) ultracentrifuge tubes for the SW55 (Beckman, cat. no. 344057)</td><td></td><td></td><td></td></tr><tr><td>Polyallomer 9/16 x 3 &amp;frac12; in (14 x 89 mm) ultracentrifuge tubes for the SW41 (Beckman, cat. no. 331372)</td><td></td><td></td><td></td></tr><tr><td>L8-80M ultracentrifuge (Beckman)</td><td></td><td></td><td></td></tr><tr><td>Steel blunt syringe needle, 4 inch, 16 G (Aldrich, cat. no. Z261378)</td><td></td><td></td><td></td></tr><tr><td>1 ml syringe with 27 G&amp;frac12; needle (Becton Dickinson, cat no. 309623)</td><td></td><td></td><td></td></tr><tr><td>5 ml syringe (Becton Dickinson, cat. no. 309646)</td><td></td><td></td><td></td></tr><tr><td>Parafilm</td><td></td><td></td><td></td></tr><tr><td>Tube rotator, end-over-end</td><td></td><td></td><td></td></tr><tr><td>Microcentrifuge, refrigerated</td><td></td><td></td><td></td></tr><tr><td>Density gradient fractionation system (Teledyne Isco, cat. no. 69-3873-179)</td><td></td><td></td><td></td></tr><tr><td>TracerDAQ (Measurement Computing)</td><td></td><td></td><td></td></tr><tr><td>Eppendorf 5810R centrifuge</td><td></td><td></td><td></td></tr><tr><td>Eppendorf A-4-81 rotor (Eppendorf, cat. no. 022638807)</td><td></td><td></td><td></td></tr></tbody></table>

methods to investigate the regulatory role of small rnas and ribosomal occupancy of plasmodium falciparum

Die genetische Variation für die Sichelzell Allel verantwortlich (HBS) ermöglicht Erythrozyten auf eine Infektion durch den Malaria-Parasiten, P. wider falciparum. Die molekulare Grundlage dieses Widerstands, von dem bekannt ist multifaktoriell, bleibt unvollständig verstanden. Jüngste Studien festgestellt, dass die unterschiedliche Expression von Erythrozyten microRNAs, einmal in Malaria-Parasiten transloziert, wirken sich sowohl auf die Genregulation und Parasitenwachstum. Diese miRNAs wurden später gezeigt, um mRNA-Translation durch Bildung einer chimären RNA-Transkript über 5 &#39;RNA-Fusion mit diskreten Teilmengen von Parasiten mRNAs hemmen. Hierbei sind die Techniken, die verwendet wurden, um die funktionelle Rolle und putative Mechanismus zugrunde liegende Erythrozyten mikroRNAs an der Genregulation und Translations Potential von P. studieren falciparum, einschließlich der Transfektion von modifizierten synthetischen mikroRNAs in Wirts Erythrozyten, werden detailliert beschrieben. Schließlich wird eine Polysomen-Gradientenverfahren verwendet, um das Ausmaß zu bestimmen translation dieser Transkripte. Gemeinsam dürfen diese Techniken uns zu zeigen, dass die fehlregulierte Ebenen der Erythrozyten microRNAs tragen zur Zell intrinsische Malaria Widerstand der Sichel-Erythrozyten.

Globale Profilierung der menschlichen microRNA in P. falciparum Die hier vorgestellten Techniken wurden verwendet, um Mikro-RNAs von Parasiten in einer Vielzahl von Bedingungen zu extrahieren. Eine Sache zu beachten ist, dass RNA-Extraktionen für die nicht infizierten Erythrozyten wurden durchgeführt, wie in 32, die oft als Bezugspunkt für die microRNA Daten sowohl in diesem Artikel und der ursprünglichen Studie 29 vorgestellt serviert angezeigt. Diese frü...

Watch this Scientific Journal Video about Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum at JoVE.com

Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

Human microRNAs translocate from host erythrocytes to Plasmodium falciparum parasites. Here, the techniques used to transfect synthetic microRNAs into host erythrocytes and isolate all RNAs from P. falciparum are described. In addition, this paper will detail a method of polysome isolation in P. falciparum to determine the ribosomal occupancy and translational potential of parasite transcripts.

Methoden, um die regulatorische Rolle kleiner RNAs und Ribosomal Belegung von Untersuchen<em&gt; Plasmodium falciparum</em

The genetic variation responsible for the sickle cell allele (HbS) enables erythrocytes to resist infection by the malaria parasite, P. falciparum. The ...

methods-to-investigate-regulatory-role-small-rnas-ribosomal-occupancy

Research

JoVE Journal

Immunology and Infection

Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

8.8K Aufrufe.  Duke University School of Medicine. Human microRNAs translocate from host erythrocytes to Plasmodium falciparum parasites. Here, the techniques used to transfect synthetic microRNAs into host erythrocytes and isolate all RNAs from P. falciparum are described. In addition, this paper will detail a method of polysome isolation in P. falciparum to determine the ribosomal occupancy and translational potential of parasite transcripts. 

Serie: Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

Novel RNA-Binding Proteins Isolation by the RaPID Methodology

RNA-binding proteins (RBPs) play important roles in every aspect of RNA metabolism and regulation. Their identification is a major challenge in modern biology. Only a few in vitro and in vivo methods enable the identification of RBPs associated with a particular target mRNA. However, their main limitations are the identification of RBPs in a non-cellular environment (in vitro) or the low efficiency isolation of RNA of interest (in vivo). An RNA-binding protein purification and identification (RaPID) methodology was designed to overcome these limitations in yeast and enable efficient isolation of proteins that are associated in vivo. To achieve this, the RNA of interest is tagged with MS2 loops, and co-expressed with a fusion protein of an MS2-binding protein and a streptavidin-binding protein (SBP). Cells are then subjected to crosslinking and lysed, and complexes are isolated through streptavidin beads. The proteins that co-purify with the tagged RNA can then be determined by mass spectrometry. We recently used this protocol to identify novel proteins associated with the ER-associated PMP1 mRNA. Here, we provide a detailed protocol of RaPID, and discuss some of its limitations and advantages.

RNA-protein interactions lie at the heart of many cellular processes. Here, we describe an in vivo method to isolate specific RNA and identify novel proteins that are associated with it. This could shed new light on how RNAs are regulated in the cell.

Neuartige RNA-bindende Proteine ​​Isolation durch die rasche Methodik

RNA-binding proteins (RBPs) play important roles in every aspect of RNA metabolism and regulation. Their identification is a major challenge in modern ...

Forschung

Genetik

Quantitative Immunofluorescence to Measure Global Localized Translation

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and organogenesis, as well as in multiple diseases. Numerous publications have convincingly shown that specific mechanisms tightly regulate mRNA translation. Increased interest in the translation-induced regulation of protein expression has led to the development of novel methods to study and follow de novo protein synthesis in cellulo. However, most of these methods are complex, making them costly and often limiting the number of mRNA targets that can be studied. This manuscript proposes a method that requires only basic reagents and a confocal fluorescence imaging system to measure and visualize the changes in mRNA translation that occur in any cell line under various conditions. This method was recently used to show localized translation in the subcellular structures of adherent cells over a short period of time, thus offering the possibility of visualizing de novo translation for a short period during a variety of biological processes or of validating changes in translational activity in response to specific stimuli.

This manuscript describes a method to visualize and quantify localized translation events in subcellular compartments. The approach proposed in this manuscript requires a basic confocal imaging system and reagents and is rapid and cost-effective.

Quantitative Immunfluoreszenz Maßnahme Global lokalisierte Übersetzung

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and ...

Biochemie

Polysome Profiling in Leishmania, Human Cells and Mouse Testis

Proper protein expression at the right time and in the right amounts is the basis of normal cell function and survival in a fast-changing environment. For a long time, the gene expression studies were dominated by research on the transcriptional level. However, the steady-state levels of mRNAs do not correlate well with protein production, and the translatability of mRNAs varies greatly depending on the conditions. In some organisms, like the parasite Leishmania, the protein expression is regulated mostly at the translational level. Recent studies demonstrated that protein translation dysregulation is associated with cancer, metabolic, neurodegenerative and other human diseases. Polysome profiling is a powerful method to study protein translation regulation. It allows to measure the translational status of individual mRNAs or examine translation on a genome-wide scale. The basis of this technique is the separation of polysomes, ribosomes, their subunits and free mRNAs during centrifugation of a cytoplasmic lysate through a sucrose gradient. Here, we present a universal polysome profiling protocol used on three different models - parasite Leishmania major, cultured human cells and animal tissues. Leishmania cells freely grow in suspension and cultured human cells grow in adherent monolayer, while mouse testis represents an animal tissue sample. Thus, the technique is adapted to all of these sources. The protocol for the analysis of polysomal fractions includes detection of individual mRNA levels by RT-qPCR, proteins by Western blot and analysis of ribosomal RNAs by electrophoresis. The method can be further extended by examination of mRNAs association with the ribosome on a transcriptome level by deep RNA-seq and analysis of ribosome-associated proteins by mass spectroscopy of the fractions. The method can be easily adjusted to other biological models.

Polysome Profiling in Leishmania, Human Cells and Mouse Testis

The overall goal of polysome profiling technique is analysis of translational activity of individual mRNAs or transcriptome mRNAs during protein synthesis. The method is important for studies of protein synthesis regulation, translation activation and repression in health and multiple human diseases.

Polysome Profilerstellung in Leishmaniose, menschliche Zellen und Maus Hoden

Proper protein expression at the right time and in the right amounts is the basis of normal cell function and survival in a fast-changing environment. For ...

An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes

RNA-binding proteins (RBPs) play key roles in the post-transcriptional control of gene expression. Therefore, biochemical characterization of mRNA-protein complexes is essential to understanding mRNA regulation inferred by interacting proteins or non-coding RNAs. Herein, we describe a tandem RNA isolation procedure (TRIP) that enables the purification of endogenously formed mRNA-protein complexes from cellular extracts. The two-step protocol involves the isolation of polyadenylated mRNAs with antisense oligo(dT) beads and subsequent capture of an mRNA of interest with 3&#39;-biotinylated 2&#39;-O-methylated antisense RNA oligonucleotides, which can then be isolated with streptavidin beads. TRIP was used to recover in vivo crosslinked mRNA-ribonucleoprotein (mRNP) complexes from yeast, nematodes and human cells for further RNA and protein analysis. Thus, TRIP is a versatile approach that can be adapted to all types of polyadenylated RNAs across organisms to study the dynamic re-arrangement of mRNPs imposed by intracellular or environmental cues.

A tandem RNA isolation procedure (TRIP) for recovery of endogenously formed mRNA-protein complexes is described. Specifically, RNA-protein complexes are crosslinked in vivo, polyadenylated RNAs are isolated from extracts with oligo(dT) beads, and particular mRNAs are captured with modified RNA antisense oligonucleotides. Proteins bound to mRNAs are detected by immunoblot analysis.

Ein Oligonukleotid-basierte Tandem RNA Isolierung Vorgehensweise eukaryotischen mRNA-Protein-komplexe

RNA-binding proteins (RBPs) play key roles in the post-transcriptional control of gene expression. Therefore, biochemical characterization of mRNA-protein ...

An Assay for Quantifying Protein-RNA Binding in Bacteria

In the initiation step of protein translation, the ribosome binds to the initiation region of the mRNA. Translation initiation can be blocked by binding of an RNA binding protein (RBP) to the initiation region of the mRNA, which interferes with ribosome binding. In the presented method, we utilize this blocking phenomenon to quantify the binding affinity of RBPs to their cognate and non-cognate binding sites. To do this, we insert a test binding site in the initiation region of a reporter mRNA and induce the expression of the test RBP. In the case of RBP-RNA binding, we observed a sigmoidal repression of the reporter expression as a function of RBP concentration. In the case of no-affinity or very low affinity between binding site and RBP, no significant repression was observed. The method is carried out in live bacterial cells, and does not require expensive or sophisticated machinery. It is useful for quantifying and comparing between the binding affinities of different RBPs that are functional in bacteria to a set of designed binding sites. This method may be inappropriate for binding sites with high structural complexity. This is due to the possibility of repression of ribosomal initiation by complex mRNA structure in the absence of RBP, which would result in lower basal reporter gene expression, and thus less-observable reporter repression upon RBP binding.

In this method, we quantify the binding affinity of RNA binding proteins (RBPs) to cognate and non-cognate binding sites using a simple, live, reporter assay in bacterial cells. The assay is based on repression of a reporter gene.

Ein Assay zur Quantifizierung der Protein-RNA-Bindung in Bakterien

In the initiation step of protein translation, the ribosome binds to the initiation region of the mRNA. Translation initiation can be blocked by binding ...

Analysis of Single-cell Gene Transcription by RNA Fluorescent In Situ Hybridization (FISH)

Adhesion of Plasmodium falciparum infected erythrocytes (IE) to human endothelial receptors during malaria infections is mediated by expression of PfEMP1 protein variants encoded by the var genes.
The haploid P. falciparum genome harbors approximately 60 different var genes of which only one has been believed to be transcribed per cell at a time during the blood stage of the infection. How such mutually exclusive regulation of var gene transcription is achieved is unclear, as is the identification of individual var genes or sub-groups of var genes associated with different receptors and the consequence of differential binding on the clinical outcome of P. falciparum infections. Recently, the mutually exclusive transcription paradigm has been called into doubt by transcription assays based on individual P. falciparum transcript identification in single infected erythrocytic cells using RNA fluorescent in situ hybridization (FISH) analysis of var gene transcription by the parasite in individual nuclei of P. falciparum IE1.
Here, we present a detailed protocol for carrying out the RNA-FISH methodology for analysis of var gene transcription in single-nuclei of P. falciparum infected human erythrocytes. The method is based on the use of digoxigenin- and biotin- labeled antisense RNA probes using the TSA Plus Fluorescence Palette System2 (Perkin Elmer), microscopic analyses and freshly selected P. falciparum IE. The in situ hybridization method can be used to monitor transcription and regulation of a variety of genes expressed during the different stages of the P. falciparum life cycle and is adaptable to other malaria parasite species and other organisms and cell types.

Analysis of Single-cell Gene Transcription by RNA Fluorescent In Situ Hybridization FISH

Fluorescent in situ hybridization (FISH) to identify mRNA transcripts in individual cells allows analysis of polygenic activity such as the simultaneous transcription of more than one member of the var multigene family in Plasmodium falciparum infected erythrocytes 1. The technique is adaptable and can be used on different types of genes, cells and organisms.

Analyse von Einzel-Zell-Gene Transkription durch RNA-Fluorescent<em&gt; In Situ</em&gt; Hybridisierung (FISH)

Adhesion of Plasmodium falciparum infected erythrocytes (IE) to human endothelial receptors during malaria infections is mediated by expression of PfEMP1 ...

Biologie

Standard Membrane Feeding Assay for the Detection of Plasmodium falciparum Infection in Anopheles Mosquito Vectors

Malaria remains one of the most devastating diseases worldwide and, to date, the African region is still responsible for 94% of all cases worldwide. This parasitic disease requires a protozoan parasite, an Anopheles mosquito vector, and a vertebrate host. The Anopheles genus comprises more than 500 species, of which 60 are known as vectors of the parasite. The Plasmodium parasite genus consists of 250 species, and 48 of these are involved in disease transmission. Furthermore, the Plasmodium falciparum parasite has contributed toward an estimated 99.7% of malaria cases in sub-Saharan Africa in recent years. 
Gametocytes form part of the sexual stage of the parasite and are ingested by the female mosquito upon feeding on an infected human host. Further development of the parasite within the mosquito is enhanced by favorable environmental conditions in the midgut of the mosquito. Here, the fusion of the female and male gametes takes place, and the motile ookinetes originate. The ookinetes enter the midgut epithelium of the mosquito, and mature ookinetes form oocysts, which, in turn, produce motile sporozoites. These sporozoites migrate to the mosquito's salivary glands and are injected as a mosquito takes a blood meal. 
For drug discovery purposes, mosquitoes were artificially infected with gametocyte-infected blood in the standard membrane feeding assay (SMFA). To detect infection within the mosquito and/or to assess the efficacy of antimalarial compounds, the midguts of the female mosquitoes were removed post infection and were stained with mercurochrome. This method was used to enhance the visual detection of oocysts under the microscope for the accurate determination of oocyst prevalence and intensity.

Standard Membrane Feeding Assay for the Detection of Plasmodium falciparum Infection in Anopheles Mosquito Vectors

The standard membrane feeding assay (SMFA) is regarded as the gold standard for the assessment and identification of potential antimalarial compounds. This artificial feeding system is used to infect mosquitoes to further evaluate the effects of such compounds on the intensity and prevalence of the Plasmodium falciparum parasite.

Standard-Membran-Fütterungstest zum Nachweis von Plasmodium falciparum-Infektionen in Anopheles-Mückenvektoren

Malaria remains one of the most devastating diseases worldwide and, to date, the African region is still responsible for 94% of all cases worldwide. This ...

Immunologie und Infektion

Polysome Fractionation and Analysis of Mammalian Translatomes on a Genome-wide Scale

mRNA translation plays a central role in the regulation of gene expression and represents the most energy consuming process in mammalian cells. Accordingly, dysregulation of mRNA translation is considered to play a major role in a variety of pathological states including cancer. Ribosomes also host chaperones, which facilitate folding of nascent polypeptides, thereby modulating function and stability of newly synthesized polypeptides. In addition, emerging data indicate that ribosomes serve as a platform for a repertoire of signaling molecules, which are implicated in a variety of post-translational modifications of newly synthesized polypeptides as they emerge from the ribosome, and/or components of translational machinery. Herein, a well-established method of ribosome fractionation using sucrose density gradient centrifugation is described. In conjunction with the in-house developed &#8220;anota&#8221; algorithm this method allows direct determination of differential translation of individual mRNAs on a genome-wide scale. Moreover, this versatile protocol can be used for a variety of biochemical studies aiming to dissect the function of ribosome-associated protein complexes, including those that play a central role in folding and degradation of newly synthesized polypeptides.

Ribosomes play a central role in protein synthesis. Polyribosome (polysome) fractionation by sucrose density gradient centrifugation allows direct determination of translation efficiencies of individual mRNAs on a genome-wide scale. In addition, this method can be used for biochemical analysis of ribosome- and polysome-associated factors such as chaperones and signaling molecules.

Polysomprofile Fraktionierung und Analyse von Säuger Translatomes auf einer Genom-weite Skala

mRNA translation plays a central role in the regulation of gene expression and represents the most energy consuming process in mammalian cells. ...

Assessment of Selective mRNA Translation in Mammalian Cells by Polysome Profiling

Regulation of protein synthesis represents a key control point in cellular response to stress. In particular, discreet RNA regulatory elements were shown to allow to selective translation of specific mRNAs, which typically encode for proteins required for a particular stress response. Identification of these mRNAs, as well as the characterization of regulatory mechanisms responsible for selective translation has been at the forefront of molecular biology for some time. Polysome profiling is a cornerstone method in these studies. The goal of polysome profiling is to capture mRNA translation by immobilizing actively translating ribosomes on different transcripts and separate the resulting polyribosomes by ultracentrifugation on a sucrose gradient, thus allowing for a distinction between highly translated transcripts and poorly translated ones. These can then be further characterized by traditional biochemical and molecular biology methods. Importantly, combining polysome profiling with high throughput genomic approaches allows for a large scale analysis of translational regulation.

The ability of cells to adapt to stress is crucial for their survival. Regulation of mRNA translation is one such adaptation strategy, providing for rapid regulation of the proteome. Here, we provide a standardized polysome profiling protocol to identify specific mRNAs that are selectively translated under stress conditions.

Bewertung der Selective mRNA Translation in Säugerzellen durch Polysomen Profilieren

Regulation of protein synthesis represents a key control point in cellular response to stress. In particular, discreet RNA regulatory elements were shown ...

An Easy Method for Plant Polysome Profiling

Translation of mRNA to protein is a fundamental and highly regulated biological process. Polysome profiling is considered as a gold standard for the analysis of translational regulation. The method described here is an easy and economical way for fractionating polysomes from various plant tissues. A sucrose gradient is made without the need for a gradient maker by sequentially freezing each layer. Cytosolic extracts are then prepared in a buffer containing cycloheximide and chloramphenicol to immobilize the cytosolic and chloroplastic ribosomes to mRNA and are loaded onto the sucrose gradient. After centrifugation, six fractions are directly collected from the bottom to the top of the gradient, without piercing the ultracentrifugation tube. During collection, the absorbance at 260 nm is read continuously to generate a polysome profile that gives a snapshot of global translational activity. Fractions are then pooled to prepare three different mRNA populations: the polysomes, mRNAs bound to several ribosomes; the monosomes, mRNAs bound to one ribosome; and mRNAs that are not bound to ribosomes. mRNAs are then extracted. This protocol has been validated for different plants and tissues including Arabidopsis thaliana seedlings and adult plants, Nicotiana benthamiana, Solanum lycopersicum, and Oryza sativa leaves.

This protocol describes an easy method to extract and fractionate transcripts from plant tissues on the basis of the number of bound ribosomes. It allows a global estimate of translation activity and the determination of the translational status of specific mRNAs.

Eine einfache Methode für Pflanzen Polysomen Profilieren

Translation of mRNA to protein is a fundamental and highly regulated biological process. Polysome profiling is considered as a gold standard for the ...

Methoden, um die regulatorische Rolle kleiner RNAs und Ribosomal Belegung von Untersuchen

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video

Neuartige RNA-bindende Proteine Isolation durch die rasche Methodik

Quantitative Immunfluoreszenz Maßnahme Global lokalisierte Übersetzung

Polysome Profilerstellung in Leishmaniose, menschliche Zellen und Maus Hoden

Ein Oligonukleotid-basierte Tandem RNA Isolierung Vorgehensweise eukaryotischen mRNA-Protein-komplexe

Ein Assay zur Quantifizierung der Protein-RNA-Bindung in Bakterien

Analyse von Einzel-Zell-Gene Transkription durch RNA-Fluorescent

Standard-Membran-Fütterungstest zum Nachweis von Plasmodium falciparum-Infektionen in Anopheles-Mückenvektoren

Polysomprofile Fraktionierung und Analyse von Säuger Translatomes auf einer Genom-weite Skala

Bewertung der Selective mRNA Translation in Säugerzellen durch Polysomen Profilieren

Eine einfache Methode für Pflanzen Polysomen Profilieren

Methoden, um die regulatorische Rolle kleiner RNAs und Ribosomal Belegung von Untersuchen

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video

Neuartige RNA-bindende Proteine ​​Isolation durch die rasche Methodik

Quantitative Immunfluoreszenz Maßnahme Global lokalisierte Übersetzung

Polysome Profilerstellung in Leishmaniose, menschliche Zellen und Maus Hoden

Ein Oligonukleotid-basierte Tandem RNA Isolierung Vorgehensweise eukaryotischen mRNA-Protein-komplexe

Ein Assay zur Quantifizierung der Protein-RNA-Bindung in Bakterien

Analyse von Einzel-Zell-Gene Transkription durch RNA-Fluorescent

Standard-Membran-Fütterungstest zum Nachweis von Plasmodium falciparum-Infektionen in Anopheles-Mückenvektoren

Polysomprofile Fraktionierung und Analyse von Säuger Translatomes auf einer Genom-weite Skala

Bewertung der Selective mRNA Translation in Säugerzellen durch Polysomen Profilieren

Eine einfache Methode für Pflanzen Polysomen Profilieren

Neuartige RNA-bindende Proteine Isolation durch die rasche Methodik