This research was funded by Doris Duke Charitable Foundation, Burroughs Wellcome Fund, NIH R21DK080994, Duke Chancellor's pilot project fund, the Roche Foundation for Anemia Research and The Bill and Melinda Gates Foundation. G.L. is supported by Duke's UPGG and the NIH (Grant # 5R01AI090141-03) and K.A.W. by the NSF Graduate Research Fellowship Program.

1: Isolierung von kleinen RNAs, die von P. falciparum Während des IDC <ol><li> Erhalten Malariaparasiten in asexuellen Kultur 29. HINWEIS: Die erforderliche Kulturgröße wird von der gewünschten Anwendung variieren; jedoch eine 10 ml Kultur bei 3-5% Parasitämie und 5% Hämatokrit bietet ausreichend RNA für Echtzeit-PCR (RT-PCR). Die Technik wurde ursprünglich für asynchrone Kulturen optimiert, aber wenn bestimmten Zeitpunkten während des Infektionszyklus gewünscht werden, können Ringstadium-Parasiten von Sorbit Synchronisierung nicht später als 10-12 Stunden nach der Invasion synchronisiert werden. Synchronisierung nach Ablauf eines Zyklus (ca. 48 h) 29 wiederholt werden. </li><li> Pool infizierten Zellen zusammen (ca. 5 x 10 9 RBCs bei 3-5% Parasitämie) und füllen kaltem PBS an die Spitze des Rohres und Zentrifugieren bei 800 xg für 5 min ohne Bremse zu Pellet der roten Blutkörperchen. </li><li> Nach der Zentrifugation, entfernen Sie den Überstand vorsichtig mit Hilfe eines Ansaugpipette, befestigtauf ein Vakuum, da die Erythrozyten-Pellet ist leicht zu entfernen. Nochmals mit kaltem 1x PBS Waschen des Pellets. </li><li> Resuspendieren Zellpellet in kaltem 0,15% Saponin (in 1x PBS) und auf Eis für 30 min. </li><li> Centrifuge Zellen bei 1.500 × g für 12 min bei 4 ° C, zu entfernen Überstand (die dunkel in der Farbe rot sein wird) und Pellet in kaltem PBS. Wiederholen Sie diesen Schritt noch einmal. ANMERKUNG: Um sicherzustellen, dass die vorliegenden mikroRNAs waren reflektierend mikroRNAs innerhalb Parasiten und nicht erythrozytären Kontamination ist eine Anzahl von Parasiten Isolationsbedingungen wurden getestet: 1) Saponin Lyse, 2) Saponin Lyse mit RNaseA Behandlung der Wirtszelle miRNAs und 3 kombiniert ) Methyl-beta-Cyclodextrin-Behandlung, um die Parasiten aus der Wirts Erythrozyten zu entfernen. Alle Behandlungen ergaben ähnliche Ergebnisse. </li><li> Lyse der isolierte Parasiten Pellet mit den empfohlenen 600 &amp; mgr; l Lysepuffer. Dieses Volumen Lysepuffer genügt Kulturen bis zu ~ 30 ml von 2% Hämatokrit und 5% Parasitämie. HINWEIS: Für größere Parasiten Kulturen, kann dieses Volumen erhöht werden. Es ist wichtig, um eine vollständige Lyse der Parasitenpellet durch gründliches Vortexen für mindestens 1 min zu gewährleisten. Auch zur Vereinfachung der Extraktion, die lysierten Proben können in einem 1,7 ml Mikrozentrifugenröhrchen übertragen. </li><li> Mit 60 &amp; mgr; l oder 1/10 Volumen Lysepuffer in Schritt 6 verwendet, Homogenat Additiv (2 M Natriumacetat, pH 4). </li><li> Lassen Proben auf Eis für 10 min. </li><li> Mit 600 &amp; mgr; l oder ein Volumen gleich der Menge Lysepuffer in Schritt 6 zu jeder Probe und Vortex für 1 min zugegeben saurer Phenol choloroform. </li><li> Trennen der wässrigen und organischen Phasen durch Zentrifugation der Proben bei 10000 × g für 5 min. Diese Drehung ist länger als die durch den Bausatz vorgeschlagen, um sicherzustellen, dass alle Hämoglobin / Hämozoins ist in der organischen Phase. </li><li> Sammeln Sie die obere (wässrige) Schicht und überträgt es in ein frisches Röhrchen. Wiederholen Sie die Schritte 9 und 10, wenn die wässrige Phase ist weiß oder (wahrscheinlicher) Braun in der Farbe, die pro schlägttein Verschmutzung. </li><li> Bestimmen das Volumen des resultierenden Überstands mit einer Pipette und fügen 1,25 Volumina 100% Ethanol (~ 800 &amp; mgr; l) und durch Umschütteln 1,7 ml Mikrozentrifugenröhrchen 5 mal. </li><li> Passieren jede Probe durch ein bereitgestellt RNA-bindende Filterpatrone (von denen mehrere verschiedene im Handel erhältlich sind) entweder durch Zentrifugation bei 14.000 × g für 1 min oder durch Verwendung einer Vakuumkammer. </li><li> Waschen Sie die Filterpatrone mit 700 ul der miRNA-Waschpuffer 1 unter Verwendung einer Mikrozentrifuge, Spinning bei 14.000 × g für 1 min. </li><li> Zweimal durch Zentrifugieren bei 14.000 · g für jeweils 1 min Waschen Sie die Filterpatrone mit 500 ul Waschpuffer 2/3. </li><li> Eluieren RNA mit 100 ul DEPC-Wasser, das auf 95 ºC vorgewärmt wurde, in zwei Wäschen von 50 &amp; mgr; l, Zentrifugieren bei 14.000 xg für jeweils 1 min. Messung der Konzentration von RNA durch UV-Absorption bei 260 nm. HINWEIS: Ein RNA-Gel (entweder TBE-Harnstoff-Acrylamid oder denaturierenden Formaldehyd-Agarose-Gel) kann be verwendet, um die Größenverteilung der isolierten RNAs beurteilen. HINWEIS: Diese RNA ist für die Analyse von Mikroarray, RNA-Sequenzierung, Northern Blot und Ribonuklease Protection Assay. </li></ol> 2: Quantifizierung von kleinen RNAs, die von P. falciparum Während des IDC <ol><li> Bestimmen Sie die Konzentration der einzelnen Proben in Schritt 1 getrennt mit UV-Spektrophotometrie bei 260 nm. </li><li> Erzeugen Echtzeit-PCR-Primer für den gewünschten RNA-Spezies. Für miRNA allein haben wir vorgefertigte miRNA qPCR-Assays, während für mRNAs oder Fusions miRNA-mRNA wir entwickelt Primer für SYBR grün. Für die Fusions RNAs, der Vorwärtsprimer war der miRNA-Sequenz selbst (miR-451: AAACCGTTACCATTACTGAGTT), während die Rückseite war eine genspezifische Primer ~ 100 bp stromabwärts von dem miRNA in der mRNA-Sequenz (PKA-R: ATCGAACATGCTGTGAACAT). </li><li> Machen cDNA aus den RNA-Proben unter Verwendung von entweder einer Haarnadelprimer für miRNAs (verwenden 20-40 ng RNA) alleine oder zufälligen Hexameren für mRNA und / oder miRNA-mRNA Fusions Arten (unter Verwendung von 1 &amp; mgr; g RNA). Mischungs RNA und Primer für 5 min bei 65 ° C, dann auf Raumtemperatur abkühlen. Anschließend fügen reverse Transkriptase-Mix (0.5 &amp; mgr; l reverse Transkriptase, 0,5 ul RNase Inhibitor, 1 ul dNTPs (jeweils 2,5 mM), 4 &amp; mgr; l 5x-Puffer, 2 &amp; mgr; l 0,1 M DTT, 1 &amp; mgr; l H 2 O). <ol><li> Führen Proben auf einem Thermocycler zum Aufspüren von entweder SYBR grün oder TaqMan-Sonden. SYBR green quantitative PCR 30 für spezifische Gene wurde als ein 3-Schritt-PCR, 95 ° C für 15 sec, niedrigsten Primerannealing Temperatur minus 5 ° C für 30 s ausgeführt wird, und 68 ° C für 30 Sekunden, für 40 Zyklen unter Verwendung eines Handels SYBR Green Master Mix. miRNA Echtzeit-PCR wurde als eine Zwei-Schritt-PCR für 1 min laufen, 95 ° C für 15 sec und 60 ° C für 40 Zyklen. </li><li> Quantifizierung Assays unter Verwendung des ΔΔCt Verfahren und normalisieren sie entweder gegen Rab GTPase (PF08_0110) oder 18S rRNA 31. </li></ol></li></ol> 3: Einführungvon kleinen RNAs in Malaria-Erregern <ol><li> Pellet 300 ul rote Blutkörperchen pro Transfektion durch Zentrifugation bei 800 × g bei Bremse 1 (250 ul von RBCs etwa 1,5 x 10 9 Zellen, schließlich verwendet werden) in komplettem Malariamittel für 5 min. </li><li> Zweimaliges Waschen der Erythrozyten mit RPMI und resuspendieren in komplettem cytomix (120 mM KCl; 0,15 mM CaCl2; 10 mM K 2 HPO 4 / KH 2 PO 4, pH 7,6; 25 mM HEPES, pH 7,6; 2 mM EGTA, pH 7,6; 5 mM MgCl 2; pH mit KOH nach dem Zentrifugieren bei 800 xg für 5 Minuten bei Bremse 1 eingestellt) bei 50% Hämatokrit. </li><li> Übertragen Sie die Zellen bis zu einer 0,2 cm Elektroporationsküvette. </li><li> In 10 ug oder entsprechenden Betrag, der kundenspezifische synthetische Oligonukleotide an die Küvetten und Resuspendieren der Kulturen. </li><li> Stellen Sie die Elektroporator bis 310 V / 950 &amp; mgr; F und liefern einen Impuls zu jeder Küvette. </li><li> Resuspendieren der 300 ul RBC in der Küvette in vorgewärmten komplette malArie Medien und platten sie in 24-Well-Platten und Inkubieren bei 37 ° C in einem luftdichten Behälter mit Malaria Blutgasgemisch (3% O 2, 5% CO 2). </li><li> Nach 4 Stunden, infizieren transfizierten RBCs mit synchronisierten späte Trophozoiten auf eine ungefähre endgültige Parasitämie von 1%. </li><li> In frisch transfiziert RBCs alle 4-6 Tage, um infizierten Kulturen und bestimmen Sie die% Parasitämie durch FACS mit Jo-Jo-1-Färbung, wie in Abschnitt 4 angegeben. </li></ol> 4: Bestimmung der Erythrozyten-microRNAs Wirkung auf Parasiteninfektion bewerten <ol><li> Nehmen Sie 100 ul der resuspendierten Kultur durch Mikropipette und in ein 1,7 ml Mikrozentrifugenröhrchen. Zweimaliges Waschen mit 1 ml 1 × PBS und zentrifugieren in einer Tischmikrozentrifuge durch Zentrifugation bei 800 × g für 5 min. </li><li> Pellet in 1 ml 0,025% Glutaraldehyd. Proben, 20 min bei RT. HINWEIS: Proben können hier für mehrere Wochen bei 4 ° C gelagert werden. Danach pelletieren die infizierte RBCs durch Zentrifugation bei 800 × g für 5 min. Waschen zweimal mit 1 ml 1x PBS. </li><li> Pellet in 1 ml 0,015% Saponin. Inkubieren bei 4 ° C für 15 min. Pellet infizierter Erythrozyten durch Zentrifugation bei 800 × g für 5 min. Waschen zweimal mit 1 ml 1x PBS. Repeat.4.3. Die Zellen in 1 ml 1 × PBS, enthaltend 1 ul (1,000x) DNA-Farbstoff. </li><li> Bestimmen den Grad der Parasitämie auf einem Durchflusszytometer, bei 488 nM Anregung und ~ 530 nm (FL-1) Emission. </li><li> Zuerst Gate das Durchflusszytometer basierend auf FSC und SSC auf Erythrozyten zu konzentrieren. Dann messen Sie den Grad der Parasitämie (infizierten Erythrozyten) in der gesperrten RBC durch Fluoreszenz in der FL-1-Kanal. HINWEIS: später Parasiten sind 10X mehrere fluoreszierende als früher Parasiten und ~ 100X oben nicht infizierten Erythrozyten. Auch das Sammeln bei niedriger Geschwindigkeit neigt dazu, Rauschen zu reduzieren. Schließlich hat diese Herangehensweise an 3 H-Hypoxanthin Einbau und Giemsa sowohl wie zuvor berichtet 13, sowie alle Techniken gav verglichenE ähnliche Ergebnisse. </li></ol> 5: Biotin-Tagging und Elution von miRNA-mRNA Fusion Produkte <ol><li> Direkt bestellen kundenspezifische synthetische RNA-Oligonukleotide mit Desthiobiotin (DB), die kovalent an das 5&#39;-Ende verbunden sind. </li><li> Transfektion von nicht-infizierten roten Blutkörperchen mit Desthiobiotin konjugierten (DB-) miRNA und unmodifizierten miRNA (negative Kontrolle), wie in Schritt 3 dargestellt. </li><li> Infizieren transfiziert RBCs mit P. falciparum-Parasiten zu einer Start Parasitämie von 0,5% (Schritt 1.1). </li><li> Auszug Parasiten RNA 4 Tage (96 Stunden) später, wie oben in Schritt 1 beschrieben. </li><li> Inkubieren 10 ug Parasiten RNA mit 50 &amp; mgr; l Streptavidin-Kügelchen gepackt, aufgenommen mittels Mikropipette, und drehen sich auf einem Mikrozentrifugenröhrchen Rotator für 1 Stunde bei 4 ° C. </li><li> Pellet die Kügelchen bei 800 · g für 30 Sekunden und Waschen mit 20 mM KCl und 1 / 1.000 RNase Inhibitor. </li><li> Eluieren RNAs aus den Perlen durch Konkurrenz mit 2 mM Biotin und mit 200 &amp; mgr; l RNA-Capture-Elutionspuffer (20 mM KCl, 1/1000 RNase Inhibitor und 2 mM Biotin) bei 4 ° C über Nacht mit Rotation. </li><li> Bestimmen den Grad der Anreicherung angegeben P. falciparum Transkripte mit SYBR green qRT-PCR und microRNA-Anreicherung (positive Kontrolle) durch TaqMan qPCR wie in Schritt 2 angegeben. </li></ol> 6: Polysomen Trennung an die ribosomale Belegung von P. Bestimmen falciparum <ol><li> Platzieren von 5 ml 15% Saccharose-Lösung (400 mM Kaliumacetat, 25 mM Kalium HEPES, pH 7,2, 15 mM Magnesiumacetat, 200 &amp; mgr; M Cycloheximid, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase-Inhibitor und 15% Saccharose ) in einem SW41 Ultrazentrifugenröhrchen (14 x 89 mm). </li><li> Unter Verwendung einer 5 ml Spritze mit 5 ml 50% Saccharose-Lösung (400 mM Kaliumacetat, 25 mM Kalium HEPES, pH 7,2, 15 mM Magnesiumacetat, 200 &amp; mgr; M Cycloheximid, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase Inhibitor, und 50% Saccharose) unterhalb der 15% Saccharose mit einem langen Stahlnadel, dann entfernen Sie die Nadel. </li><li&gt; Verschließen Sie die Oberseite des Gradienten Rohr mit Parafilm, kippen Sie den Schlauch langsam auf die Seite, in einer stabilen Position gegen Wegrollen, so dass es horizontal auf der Tischplatte. Halten des Rohres auf seiner Seite für mindestens 2 Std. Während der Wartezeit, beginnen Sie mit Schritt 6.5. </li><li> Nach 2 Stunden langsam kippen Sie das Rohr wieder aufrecht und übertragen Sie das Rohr auf Eis, so dass sie für mindestens 15 Minuten vor der Probenbeladung (Schritt 14) zu kühlen. </li><li> Sammeln Sie genug Plasmodium infizierte Blutstadium Kultur 100-500 ug Gesamt-RNA, oder ungefähr 100 ml asynchronen Kultur bei 3-5% Parasitämie zu generieren. Hinzuzufügen 1/10 dem Volumen des Kulturmediums, das 10-fach (2 mM) Cycloheximid (CHX) und bei 37 ° C für 10 min. <ol><li> Pellet Kulturen durch Zentrifugation bei 500 g für 7 min mit der Zentrifuge (Bremse 1), dann zweimal waschen mit Raumtemperatur 1x PBS, das 200 uM CHX. Resuspendieren der Parasitenkulturen in 1x PBS, das 200 uM CHX und speichern Sie auf dem Eis. </li></ol></li&gt; <li> Schätzen Sie das Volumen der RBC-Pellet. Hinzufügen Lysepuffer (400 mM Kaliumacetat, 25 mM Kalium HEPES, pH 7,2, 15 mM Magnesiumacetat, 200 &amp; mgr; CHX, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase Inhibitor, 1% (v / v) IGEPAL CA -630, und 0,5% (w / v) DOC) in die RBC-Pellet bis zu einem Endvolumen von 4,25 ml. Inkubieren des Lysats bei 4 ° C für 10 Minuten unter Rotation. </li><li> Transfer des Lysats auf Mikrozentrifugenröhrchen und anschließend zentrifugiert werden die Proben in einer Mikrozentrifuge bei 16.000 × g und 4 ° C für 10 min. </li><li> Vorbereitung Saccharosekissen durch Pipettieren von 1,25 ml kaltem 0,5 M Saccharose-Kissen-Lösung (400 mM Kaliumacetat, 25 mM Kalium HEPES, pH 7,2, 15 mM Magnesiumacetat, 200 &amp; mgr; M Cycloheximid, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase Inhibitor und 0,5 M Saccharose) in einem SW55 Ultrazentrifugenröhrchen (13 x 51 mm). </li><li> Sorgfältig Schicht 3,75 ml Lysatüberstand (aus Schritt 7) auf der Oberseite des Saccharose-Kissen unter Verwendung einer Spritze und kleine (~ 27) Gauge-Nadel. Store die verbleibende Lysat (~ 500 &amp; mgr; l) bei -80 ° C, um die Gesamt-RNA Niveaus zu extrahieren, wie in Abschnitt 1 angegeben. </li><li> Laden der Proben in der Ultrazentrifuge Rotor vorgekühlter bis 4 ° C, das 13,2-ml-Röhrchen aufnehmen kann. Zentrifugieren der Proben bei 366.000 × g und 4 ° C für 146 min. </li><li> Mit einer Pipette den Überstand in ein 15 ml konischen Röhrchen. Lagern Sie den Überstand bei -80 ° C für die RNA-Isolierung von freiem (ungebundenem von Ribosomen) RNAs. </li><li> Resuspendieren Ribosom-Pellet in 500 ul Ribosomen Resuspensionspuffer (400 mM Kaliumacetat, 25 mM Kalium HEPES, pH 7,2, 15 mM Magnesiumacetat, 200 &amp; mgr; M Cycloheximid, 1 mM DTT, 1 mM PMSF, und 40 U / ml RNase-Inhibitor) durch Pipettieren von 5 min. </li><li> Zentrifugieren der Proben in einer Mikrozentrifuge bei 16.000 × g und 4 &#160; ° C für 10 min. </li><li> Während die Gradienten von Schritt 4 auf Eis, entfernen Sie die Parafilm, dann vorsichtig Schicht das Ribosom Suspension oben auf dem Gradienten using eine Spritze und kleine (~ 27) Nadel. </li><li> Legen Sie den Schlauch in ein vorgekühltes Ultrazentrifuge Rotor und Zentrifuge die geladenen Farbverläufe bei 200.000 xg und 4 ° C für 180 min. Wenn der Spin beendet ist, zentrifugiert store Gradienten bei 4 ° C, bis Sie sie auf den Fraktionator zu laden. </li><li> Legen Sie eine leere Ultrazentrifugenröhrchen in die Gradienten Fraktionator (dies kann ein Rohr in einem vorherigen Durchlauf verwendet werden kann), dann mit RNase-freiem Wasser waschen für 5 min bei 100 x 10 Geschwindigkeit. </li><li> Während des Wasch in Schritt 6.16, stellen Sie die Empfindlichkeit des UV-Absorptionsdetektor. Ein guter Ausgangsempfindlichkeit liegt bei 0,2, aber dies möglicherweise in späteren läuft auf der A 254-Signal (die auf Parasiten Nummer usw. auf Basis variiert), je nach eingestellt werden. </li><li> Sobald die Detektorempfindlichkeit eingestellt ist, stellen Sie die Grundliniensignal auf Null, während Wasser durch den Detektor strömt. </li><li> Nach dem Waschen der Fraktionssammler, kehren Sie den Flüssigkeitsstrom, bis die Leitungen leer sind und dann remove, das leere Ultrazentrifugenröhrchen. </li><li> Führen Sie 60% Saccharose-Lösung durch den Fraktionator bis zum Nadelgerät verlässt. </li><li> Legen Sie die Röhrchen mit dem ersten Gradienten an der Spitze der Ladekammer und die Dichtung festziehen, dabei nicht zu fest anziehen. Dann durchstechen die Unterseite des Rohres mit der Nadel. </li><li> Setzen Sie die Flüssigkeitsströmungsgeschwindigkeit von 12,5 x 10 (von der Strömungsgeschwindigkeit Drehknopf auf der Vorderseite der Pumpe gesteuert wird), legen Sie dann den automatischen Fraktionssammler bis 18 sec Fraktionen zu sammeln (~ 330 &amp; mgr; l / Fraktion) in Mikrozentrifugenröhrchen. </li><li> Start vorwärts Fluss der 60% Saccharose-Lösung. </li><li> Wenn der erste Tropfen des Gradienten-Lösung fällt in den Mikrozentrifugenröhrchen, sofort beginnen sowohl die Fraktionssammlung und Live-Mitschnitt der A 254-Signal. </li><li> Nach einem starken Rückgang in der A 254-Signal beobachtet, entsprechend der Schnittstelle zwischen 50% und 60% Saccharose-Lösungen, zu stoppen sowohl die Fluidströmung und A 254 </sub&gt; Aufnahme. </li><li> Bewahren Sie die Gradientenfraktionen bei -80 &#160; ° C für die spätere Verwendung. </li><li> Kehren Sie den Flüssigkeitsstrom bei 100 x 10-fach, bis das 60% Saccharose-Lösung leert sich der Ultrazentrifugenröhrchen. </li><li> Wenn es zusätzliche Gradienten zu fraktionieren, entfernen Sie die leere Ultrazentrifugenröhrchen aus der Ladekammer und starten Sie mit Schritt 6.21. Wenn alle Proben abgeschlossen sind, waschen Sie die Vorrichtung wurde in Schritten 6.16 und 6.19 durchgeführt. </li></ol>

<ol>
	<li>World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> World Malaria Report. , (2014).</li><li>Livincstone, F. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malaria+and+human+polymorphisms.">Malaria and human polymorphisms.</a> Annu Rev Genet. 5, 33-64 (1971).</li><li>Nagel, R. L., Roth, E. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malaria+and+red+cell+genetic+defects.">Malaria and red cell genetic defects.</a> Blood. 74, 1213-1221 (1989).</li><li>Aidoo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+effects+of+the+sickle+cell+gene+against+malaria+morbidity+and+mortality.">Protective effects of the sickle cell gene against malaria morbidity and mortality.</a> Lancet. 359, 1311-1312 (2002).</li><li>Tiffert, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+hydration+state+of+human+red+blood+cells+and+their+susceptibility+to+invasion+by+Plasmodium+falciparum.">The hydration state of human red blood cells and their susceptibility to invasion by Plasmodium falciparum.</a> Blood. 105, 4853-4860 (2005).</li><li>Fairhurst, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Abnormal+display+of+PfEMP-1+on+erythrocytes+carrying+haemoglobin+C+may+protect+against+malaria.">Abnormal display of PfEMP-1 on erythrocytes carrying haemoglobin C may protect against malaria.</a> Nature. 435, 1117-1121 (2005).</li><li>Cyrklaff, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemoglobins+S+and+C+interfere+with+actin+remodeling+in+Plasmodium+falciparum-infected+erythrocytes.">Hemoglobins S and C interfere with actin remodeling in Plasmodium falciparum-infected erythrocytes.</a> Science. 334, 1283-1286 (2011).</li><li>Friedman, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Erythrocytic+mechanism+of+sickle+cell+resistance+to+malaria.">Erythrocytic mechanism of sickle cell resistance to malaria.</a> Proceedings of the National Academy of Sciences of the United States of America. 75, 1994-1997 (1978).</li><li>Pasvol, G., Weatherall, D. J., Wilson, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+mechanism+for+the+protective+effect+of+haemoglobin+S+against+P.+falciparum+malaria.">Cellular mechanism for the protective effect of haemoglobin S against P. falciparum malaria.</a> Nature. 274, 701-703 (1978).</li><li>Lecellier, C. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cellular+microRNA+mediates+antiviral+defense+in+human+cells.">A cellular microRNA mediates antiviral defense in human cells.</a> Science. 308, 557-560 (2005).</li><li>Niu, Q. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+artificial+miroRNAs+in+transgenic+Arabidopsis+thaliana+confers+virus+resistance.">Expression of artificial miroRNAs in transgenic Arabidopsis thaliana confers virus resistance.</a> Nature biotechnology. 24, 1420-1428 (2006).</li><li>Zhao, G., Yu, D., Weiss, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNAs+in+erythropoiesis.">MicroRNAs in erythropoiesis.</a> Curr Opin Hematol. 17, 155-162 (2010).</li><li>Lee, Y. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LIN28B-mediated+expression+of+fetal+hemoglobin+and+production+of+fetal-like+erythrocytes+from+adult+human+erythroblasts+ex+vivo.">LIN28B-mediated expression of fetal hemoglobin and production of fetal-like erythrocytes from adult human erythroblasts ex vivo.</a> Blood. 122, 1034-1041 (2013).</li><li>Sangokoya, C., Doss, J. F., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iron-responsive+miR-485-3p+regulates+cellular+iron+homeostasis+by+targeting+ferroportin.">Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin.</a> PLoS genetics. 9, e1003408 (2013).</li><li>Chen, S. Y., Wang, Y., Telen, M. J., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genomic+analysis+of+erythrocyte+microRNA+expression+in+sickle+cell+diseases.">The genomic analysis of erythrocyte microRNA expression in sickle cell diseases.</a> PLoS ONE. 3, e2360 (2008).</li><li>Sangokoya, C., Telen, M. J., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=microRNA+miR-144+modulates+oxidative+stress+tolerance+and+associates+with+anemia+severity+in+sickle+cell+disease.">microRNA miR-144 modulates oxidative stress tolerance and associates with anemia severity in sickle cell disease.</a> Blood. 116, 4338-4348 (2010).</li><li>Deitsch, K., Driskill, C., Wellems, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+malaria+parasites+by+the+spontaneous+uptake+and+expression+of+DNA+from+human+erythrocytes.">Transformation of malaria parasites by the spontaneous uptake and expression of DNA from human erythrocytes.</a> Nucleic acids research. 29, 850-853 (2001).</li><li>Liang, X. H., Haritan, A., Uliel, S., Michaeli, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=trans+and+cis+splicing+in+trypanosomatids:+mechanism,+factors,+and+regulation.">trans and cis splicing in trypanosomatids: mechanism, factors, and regulation.</a> Eukaryotic cell. 2, 830-840 (2003).</li><li>Baum, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+genetics+and+comparative+genomics+reveal+RNAi+is+not+functional+in+malaria+parasites.">Molecular genetics and comparative genomics reveal RNAi is not functional in malaria parasites.</a> Nucleic acids research. 37, 3788-3798 (2009).</li><li>Hall, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+survey+of+the+Plasmodium+life+cycle+by+genomic,+transcriptomic,+and+proteomic+analyses.">A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses.</a> Science. 307, 82-86 (2005).</li><li>Caro, F., Ahyong, V., Betegon, M., DeRisi, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+regulatory+dynamics+of+translation+in+the+asexual+blood+stages.">Genome-wide regulatory dynamics of translation in the asexual blood stages.</a> eLife. 3, (2014).</li><li>Oehring, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organellar+proteomics+reveals+hundreds+of+novel+nuclear+proteins+in+the+malaria+parasite+Plasmodium+falciparum.">Organellar proteomics reveals hundreds of novel nuclear proteins in the malaria parasite Plasmodium falciparum.</a> Genome biology. 13, R108 (2012).</li><li>Lasonder, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+Plasmodium+falciparum+proteome+by+high-accuracy+mass+spectrometry.">Analysis of the Plasmodium falciparum proteome by high-accuracy mass spectrometry.</a> Nature. 419, 537-542 (2002).</li><li>Bozdech, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcriptome+of+the+intraerythrocytic+developmental+cycle+of+Plasmodium+falciparum.">The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum.</a> PLoS biology. 1, E5 (2003).</li><li>Gardner, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+the+human+malaria+parasite+Plasmodium+falciparum.">Genome sequence of the human malaria parasite Plasmodium falciparum.</a> Nature. 419, 498-511 (2002).</li><li>Zhang, M., Joyce, B. R., Sullivan, W. J., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+control+in+Plasmodium+and+toxoplasma+parasites.">Translational control in Plasmodium and toxoplasma parasites.</a> Eukaryotic cell. 12, 161-167 (2013).</li><li>Lacsina, J. R., LaMonte, G., Nicchitta, C. V., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+profiling+of+the+malaria+parasite+Plasmodium+falciparum.">Polysome profiling of the malaria parasite Plasmodium falciparum.</a> Molecular and biochemical parasitology. 179, 42-62 (2011).</li><li>Bunnik, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+profiling+reveals+translational+control+of+gene+expression+in+the+human+malaria+parasite+Plasmodium+falciparum.">Polysome profiling reveals translational control of gene expression in the human malaria parasite Plasmodium falciparum.</a> Genome biology. 14, R128 (2013).</li><li>LaMonte, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translocation+of+sickle+cell+erythrocyte+microRNAs+into+Plasmodium+falciparum+inhibits+parasite+translation+and+contributes+to+malaria+resistance.">Translocation of sickle cell erythrocyte microRNAs into Plasmodium falciparum inhibits parasite translation and contributes to malaria resistance.</a> Cell host &amp; microbe. 12, 187-199 (2012).</li><li>Lambros, C., Vanderberg, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synchronization+of+Plasmodium+falciparum+erythrocytic+stages+in+culture.">Synchronization of Plasmodium falciparum erythrocytic stages in culture.</a> The Journal of parasitology. 65, 418-420 (1979).</li><li>Bourgeois, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+three+real-time+PCR+methods+with+blood+smears+and+rapid+diagnostic+test+in+Plasmodium+sp.+infection.">Comparison of three real-time PCR methods with blood smears and rapid diagnostic test in Plasmodium sp. infection.</a> Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases. 16, 1305-1311 (2010).</li><li>Abruzzo, L. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Validation+of+oligonucleotide+microarray+data+using+microfluidic+low-density+arrays:+a+new+statistical+method+to+normalize+real-time+RT-PCR+data.">Validation of oligonucleotide microarray data using microfluidic low-density arrays: a new statistical method to normalize real-time RT-PCR data.</a> Biotechniques. 38, 785-792 (2005).</li><li>Sangokoya, C., LaMonte, G., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+microRNAs+of+human+mature+erythrocytes.">Isolation and characterization of microRNAs of human mature erythrocytes.</a> Methods in molecular biology. 667, 193-203 (2010).</li><li>Rathjen, T., Nicol, C., McConkey, G., Dalmay, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+short+RNAs+in+the+malaria+parasite+and+its+red+blood+cell+host.">Analysis of short RNAs in the malaria parasite and its red blood cell host.</a> FEBS Lett. 580, 5185-5188 (2006).</li><li>Xue, X., Zhang, Q., Huang, Y., Feng, L., Pan, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=No+miRNA+were+found+in+Plasmodium+and+the+ones+identified+in+erythrocytes+could+not+be+correlated+with+infection.">No miRNA were found in Plasmodium and the ones identified in erythrocytes could not be correlated with infection.</a> Malar J. 7, 47 (2008).</li></ol>

The authors have no competing financial interests to declare.

HbS ist eine der häufigsten Hämoglobinvarianten in Malaria-endemischen Gebieten, vor allem, weil er Schutz gegen schwere Malaria durch P. verursacht falciparum. Die Techniken erforderlich, um die Rolle des menschlichen MikroRNA in der Genregulation P. charakterisieren falciparum werden in diesem Manuskript beschrieben. Durch Extraktion der Gesamt-RNA in einer solchen Weise, dass alle kleinen RNAs umfassen, und durch Ausführen einer relativ einfachen Parasiten Lyseverfahren waren di...

Malaria, durch apicomplexan Parasiten der Gattung Plasmodium verursacht, ist die häufigste menschliche parasitäre Erkrankung, weltweit zu infizieren rund 200 Millionen Menschen jedes Jahr und verursacht etwa 600.000 Todesfälle 1. Von den fünf Plasmodium-Arten, die Menschen infizieren, die relevant für die menschliche Krankheit sind P. falciparum und P. vivax, die aufgrund ihrer weit verbreiteten Distributionen und Potenzial für schwere Malaria Komplikationen. Der Lebenszyklus des Malaria-Parasiten-Infektion erfordert beider Mücken und Menschen. Wenn eine infizierte Mückenstiche einen Menschen, die Parasiten reisen durch den Blutstrom in die Leber, wo eine erste Runde der Replikation erfolgt. Nach Merozoiten Bruch von der Host-Hepatozyten, infizieren sie in der Nähe von roten Blutzellen, die Einleitung entweder asexuell oder sexueller Replikation. Die asexuelle Phase der Replikation, die 48 Stunden in P. dauert falciparum ist der Schwerpunkt dieser Studie, da es sowohl die Quelle der meisten malArie Symptome und ist leicht in vitro rekapituliert. Während eine Reihe von öffentlichen Gesundheitsinitiativen, einschließlich der Verbesserung der Anti-Malaria-Therapien haben etwas reduziert die Belastung durch Malaria weltweit, die anhaltende Entstehung von arzneimittelresistenten Parasiten stellt ein Problem für Malaria-Kontrolle Anstrengungen. Ein Bereich, der neue Therapieansätze vorschlagen kann, ist die Studie darüber, wie verschiedene genetische Varianten Resistenz gegen Malaria. In malariaendemischen Gebieten, eine Vielzahl von Erythrozyten-Polymorphismen sind durchaus üblich 2,3. Diese Mutationen, mit Sichelzell wobei vielleicht das bekannteste, sind oft mit erheblichen Resistenz gegen den Ausbruch der symptomatischen Malariainfektion 4 verbunden. Die zugrunde liegenden Mechanismen, durch die sie verursachen Erythrozyten an Malaria-Infektion zu widerstehen sind unvollständig verstanden. Parasitierten Erythrozyten mit Hämoglobin-Mutationen sind, gelten verstärkte Phagozytose durch verbesserte zelluläre Steifigkeit und Dehydrierung, diemit verringerten Invasion von P. zugeordnet falciparum 5. HBC Allel betrifft auch Protein-Expression auf der Erythrozytenoberfläche und mit dem Umbau des Zytoskeletts, ferner Hemmung Parasitenentwicklung 6,7. Schließlich P. falciparum wächst schlecht in homozygoter Sichel (HBSS) Erythrozyten 8,9 in vitro, was darauf hindeutet, intrinsische erythrozytären Faktoren Malariaresistenz. Doch während all dieser Mechanismen scheinen eine Rolle zu spielen, sie nicht vollständig erklären die Mechanismen hinter Sichelzelle Resistenz gegen Malaria. Ein möglicher Satz von Erythrozyten-Faktoren, die schlecht verstanden, bleiben die großen Pool von miRNA vorhanden innerhalb von reifen Erythrozyten. MicroRNAs sind kleine nicht-kodierende RNAs, 19-25 nt in der Größe, die Übersetzung und / oder Stabilität der Ziel-mRNAs durch Basenpaarung in der 3&#39;-UTR zu vermitteln. Sie haben bei der Steuerung der Immunantwort von Säugetieren in Verbindung gebracht worden, einschließlich der Unterdrückung of die Virusreplikation 10 und gezeigt wurden, um Resistenz gegen Viren in Pflanzen Sie haben auch gezeigt, dass mehrere Erythrozyten-Prozesse, einschließlich Erythropoese 11,12 und Eisenstoffwechsel 13 regulieren. Frühere Studien identifiziert eine reiche und vielfältige Bevölkerung von Erythrozyten-miRNAs, deren Expression dramatisch in HBSS verändert Erythrozyten 14,15. Da reifen Erythrozyten mangelt aktive Transkription und Translation, bleibt die funktionelle Bedeutung dieser Erythrozyten miRNAs unklar. Als wesentliche Stoffaustausch zwischen der Wirtszelle und P. auftritt falciparum während der intraerythrozytären Entwicklungszyklus (IDC) 16, wurde spekuliert, dass die veränderte miRNA Profil innerhalb HbS Erythrozyten direkt mit zell intrinsische Malaria Festigkeit beizutragen. Diese Studien schließlich zur Entwicklung einer Pipeline führte zu isolieren, zu identifizieren und funktionell untersuchen die Rolle des menschlichen miRNA innerhalb der malaria Parasiten P. falciparum, die ergab, dass diejenigen Host / menschlichen miRNAs letztendlich kovalent Sicherung und dann translational verdrängen Parasiten mRNA-Transkripte 17. Dies war ein Beispiel für den ersten Quer Spezies chimäre Transkripte Transspleiß gebildet und impliziert, dass dieser miRNA-mRNA Fusion könnte in anderen Spezies, einschließlich anderer Parasiten auftreten werden. Alle trypanosome mRNAs Transspleißprodukten mit einer Splice-Leader (SL), um die Trennung der polycistronische Transkripte 18 regulieren. Da P. falciparum fehlt Orthologe für Dicer / Ago 19,20 ist es möglich, dass Erythrozyten-miRNAs entführen ähnliche SL Maschinen in P. falciparum in Zielgenen zu integrieren. Jüngste Studien in P. falciparum haben in der Tat zeigte die Anwesenheit von 5&#39;-Spleißstelle Leader-Sequenzen 21. Diese Studie beschreibt die Verfahren, die zur Entdeckung der menschlichen Parasit miRNA-mRNA Fusionstranskripte geführt, die sowohl transkriptomischen und Übersettionalen Regeltechnik. Die allgemeinen Ziele dieser Methoden sind, um die Auswirkungen von kleinen RNAs in der Genregulation Phänotypen und Übersetzungs Potential von P. untersuchen falciparum Transkripte. Die anfängliche Identifizierung von Menschenparasit chimären Transkripten geltend gemachten Benutzung RNA Analysetechniken, wie beispielsweise Echtzeit-PCR, Transkriptom-Sequenzierung und EST-Bibliothek zu erfassen, die sowohl insgesamt und kleinen RNAs, anstatt mit Hilfe von Techniken, die nur vereinzelt kleine RNAs enthalten. Isolieren aller RNA zusammen in einem großen Pool, anstatt separat, erlaubte die Identifizierung beider transloziert menschlichen kleine RNAs im Parasiten sowie das Vorhandensein dieser kleinen RNA-Sequenzen als Teil einer größeren Sequenz. Dies erforderte dann eine Analyse der Übersetzungszustand dieser Fusions mRNAs, die funktionellen Konsequenzen dieser Fusionen bestimmen. Während umfangreiche Bemühungen auf Charakterisierung des Parasiten Genom eind Transkriptom haben zum Verständnis der Biologie des Parasiten 22-25 hinzugefügt wird, wird weit weniger über die Translationsregulation der mRNA Transkriptom über den Lebenszyklus von P. bekannt falciparum 26. Diese begrenzte Verständnis des Parasiten Proteom hat sowohl Verständnis des Parasiten der Biologie und die Fähigkeit, neue Ziele für die nächste Generation von Anti-Malaria-Therapeutika identifizieren behindert. Diese Lücke im Verständnis der Zellbiologie des Parasiten wurde vor allem aufgrund der Mangel an geeigneten Techniken beibehalten, um Translationsregulation in P. untersuchen falciparum. Ein aktuelles Papier beschrieben die Verwendung von ribosomalen Footprinting von P. falciparum, die globale Übersetzungsstatus 21 zu bestimmen. Eine gut etablierte Messtranslations Potential von Transkripten ist die Anzahl der von Polysomen-Profiling bestimmt zugeordnet Ribosomen. Jedoch, wenn diese Technik auf P. angewendet falciparum &lt;/ em&gt;, ist es nicht in der Lage, die meisten Polysomen erholen und fängt vorwiegend monosomes. In jüngerer Zeit haben mehrere Gruppen 27,28 P. optimiert falciparum Polysom ​​Techniken durch Lyse der Erythrozyten und Parasiten gleichzeitig, um die Polysomen zu bewahren und zu charakterisieren, die ribosomale Belegung und translationalen Potenzial dieser Malaria-Parasiten während ihrer asexuelle Entwicklung in Wirts roten Zellen 28. Zusammen zeigen diese Verfahren, dass die beobachtete Fusion von menschlichen miRNA und Parasiten mRNAs moduliert Parasitenprotein Übersetzung dieser Fusions mRNAs, die unter Verwendung von zuvor beschriebenen Verfahren 27 gezeigt wurde, und ist eine wichtige Determinante der Malaria Widerstand HbAS und HbSS Erythrozyten 17. Diese Methoden sinnvoll in einem System suchen zu identifizieren und funktionell zu erforschen RNA-Splicing Ereignisse sein, ob diese Fusion RNAs sind in P. falciparum oder andere eukaryotische Systeme.

<table border="0" cellpadding="0" cellspacing="0" width="651">
	<tbody>
		<tr height="28">
			<td height="28" style="height:28px;width:651px;">REAGENTS-All reagents must be RNAse-free.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Diethyl pyrocarbonate (DEPC; Sigma, cat. no. D5758)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DEPC-treated water (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Yoyo-1 DNA fluorescent dye (Thermo Fisher)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Gene Pulser II (or comparible) electroporator (Bio-Rad)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.2 cm Electroporation cuvettes</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">4 M potassium acetate (Mallinckrodt, cat. no. 6700)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2 M potassium HEPES (pH 7.2; Sigma, cat. no. H0527)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 M magnesium acetate (Sigma, cat. no. M-2545)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 M dithiothreitol (DTT; Research Products International, cat. no. D11000)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">100 mM phenylmethylsulfonate fluoride (PMSF; dissolved in isopropanol; Sigma, cat. no. P7626)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10% (v/v) Igepal CA-630 (Sigma-Aldrich, cat. no. I3021)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10% (w/v) sodium deoxycholate (DOC; Sigma, cat. no. D-6750)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Cycloheximide (CHX; Sigma, cat. no. C-7698)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sucrose (Mallinckrodt, cat. no. 8360-04)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNAseOUT (Invitrogen, cat. no. 100000840)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RPMI-1640 w/ L-glutamine (Cellgro, cat. no. 10-040-CV)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10% AlbuMAX I (w/v in sterile water) (Invitrogen, cat. no. 11020-039)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Gentamicin (Gibco, cat. no. 15750-060))</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HT supplement (100x) (Invitrogen, cat. no. 11067030)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">45% (w/v) sucrose (Sigma, cat no. G8769)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 M HEPES buffer (Gibco, cat. no. 15630-080)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1x phosphate buffered saline (PBS; Cellgro, cat. no. 2109310CV)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Corning 500 ml vacuum filter flask (VWR, cat. no. 430769)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Glass slides (VWR, cat. no. 48311-702)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Giemsa stain (50X) (VWR, cat no. m708-01)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">mirVana miRNA isolation kit (Ambion, ThermoFisher Scientific).</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5&#39; Biotin conjugated mature miRNA (sequence varies by miRNA of interest) (Dharmacon)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Biotin powder (Sigma-Aldrich)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1M Potassium Chloride</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Streptavidin Sepharose High Performance Beads (GE Healthcare)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ribosome resuspension buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Lysis buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">15% (w/v) sucrose gradient solution (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">50% (w/v) sucrose gradient solution (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5 M sucrose cushion (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">60% (w/v) sucrose chase solution (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Plasmodium cell culture media (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA capture Wash Buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA Elution Buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="28">
			<td height="28" style="height:28px;">REAGENT SETUP</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Solutions</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Plasmodium cell culture media</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">500 ml RPMI-1640 w/ L-glutamine</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5 ml gentamicin</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5 ml HT supplement</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2.5 ml 45% glucose</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">25 ml 10% AlbuMAX I</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">12.5 ml 1 M HEPES</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sterile filter with 0.2 mm vacuum filter flask.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Plasmodium cell culture media containing 10x CHX</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as Plasmodium cell culture media above, with the addition of:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2 mM cycloheximide</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Media is prepared as normal, then add CHX to a final concentration of 2 mM and filter.&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1x PBS containing cycloheximide</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;">Cycloheximide is added fresh to 1x PBS to a final concentration of 200 mM, and kept at 4 OC until use.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ribosome resuspension buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">400 mM potassium acetate</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">25 mM potassium HEPES, pH 7.2</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">15 mM magnesium acetate</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">200 mM cycloheximide (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 mM DTT (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 mM PMSF (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">40 U/ml RNaseOUT (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Lysis buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as ribosome resuspension buffer above, with the addition of:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1% (v/v) Igepal CA-630</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5% (w/v) DOC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sucrose solutions</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as ribosome resuspension buffer above, with the addition of varying amounts of sucrose:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">15% (w/v) sucrose to make 15% sucrose gradient solution</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">50% (w/v) sucrose to make 50% sucrose gradient solution</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5 M sucrose to make 0.5 M sucrose cushion</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">As above, cycloheximide, DTT, PMSF, and RNaseOUT must be added fresh.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">The 60% sucrose chase solution requires only sucrose and water, no other components</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">60% (w/v) sucrose in DEPC-treated water to make 60% sucrose chase solution</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA Capture Wash Buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">20mM&#160; KCl</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5unit/ml Rnase Out (Invitrogen)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA Capture Elution Buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as RNA Capture Wash Buffer, with the addition of:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2mM Biotin</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="28">
			<td height="28" style="height:28px;">EQUIPMENT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SW55 Ti ultracentrifuge rotor (Beckman, cat. no. 342194)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SW41 Ti ultracentrifuge rotor (Beckman, cat. no. 331362)</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;">Ultra-ClearTM &#189; x 2 in (13 x 51 mm) ultracentrifuge tubes for the SW55 (Beckman, cat. no. 344057)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Polyallomer 9/16 x 3 &#189; in (14 x 89 mm) ultracentrifuge tubes for the SW41 (Beckman, cat. no. 331372)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">L8-80M ultracentrifuge (Beckman)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Steel blunt syringe needle, 4 inch, 16G (Aldrich, cat. no. Z261378)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 ml syringe with 27G&#189; needle (Becton Dickinson, cat no. 309623)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5 ml syringe (Becton Dickinson, cat. no. 309646)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Parafilm</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Tube rotator, end-over-end</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Microcentrifuge, refrigerated</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Density gradient fractionation system (Teledyne Isco, cat. no. 69-3873-179)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">TracerDAQ (Measurement Computing)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Eppendorf 5810R centrifuge</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Eppendorf A-4-81 rotor (Eppendorf, cat. no. 022638807)</td>
		</tr>
	</tbody>
</table>

methods to investigate the regulatory role of small rnas and ribosomal occupancy of plasmodium falciparum

Die genetische Variation für die Sichelzell Allel verantwortlich (HBS) ermöglicht Erythrozyten auf eine Infektion durch den Malaria-Parasiten, P. wider falciparum. Die molekulare Grundlage dieses Widerstands, von dem bekannt ist multifaktoriell, bleibt unvollständig verstanden. Jüngste Studien festgestellt, dass die unterschiedliche Expression von Erythrozyten microRNAs, einmal in Malaria-Parasiten transloziert, wirken sich sowohl auf die Genregulation und Parasitenwachstum. Diese miRNAs wurden später gezeigt, um mRNA-Translation durch Bildung einer chimären RNA-Transkript über 5 &#39;RNA-Fusion mit diskreten Teilmengen von Parasiten mRNAs hemmen. Hierbei sind die Techniken, die verwendet wurden, um die funktionelle Rolle und putative Mechanismus zugrunde liegende Erythrozyten mikroRNAs an der Genregulation und Translations Potential von P. studieren falciparum, einschließlich der Transfektion von modifizierten synthetischen mikroRNAs in Wirts Erythrozyten, werden detailliert beschrieben. Schließlich wird eine Polysomen-Gradientenverfahren verwendet, um das Ausmaß zu bestimmen translation dieser Transkripte. Gemeinsam dürfen diese Techniken uns zu zeigen, dass die fehlregulierte Ebenen der Erythrozyten microRNAs tragen zur Zell intrinsische Malaria Widerstand der Sichel-Erythrozyten.

Globale Profilierung der menschlichen microRNA in P. falciparum Die hier vorgestellten Techniken wurden verwendet, um Mikro-RNAs von Parasiten in einer Vielzahl von Bedingungen zu extrahieren. Eine Sache zu beachten ist, dass RNA-Extraktionen für die nicht infizierten Erythrozyten wurden durchgeführt, wie in 32, die oft als Bezugspunkt für die microRNA Daten sowohl in diesem Artikel und der ursprünglichen Studie 29 vorgestellt serviert angezeigt. Diese frü...

Watch this Scientific Journal Video about Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum at JoVE.com

Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

Human microRNAs translocate from host erythrocytes to Plasmodium falciparum parasites. Here, the techniques used to transfect synthetic microRNAs into host erythrocytes and isolate all RNAs from P. falciparum are described. In addition, this paper will detail a method of polysome isolation in P. falciparum to determine the ribosomal occupancy and translational potential of parasite transcripts.

Methoden, um die regulatorische Rolle kleiner RNAs und Ribosomal Belegung von Untersuchen<em&gt; Plasmodium falciparum</em

The genetic variation responsible for the sickle cell allele (HbS) enables erythrocytes to resist infection by the malaria parasite, P. falciparum. The ...

methods-to-investigate-regulatory-role-small-rnas-ribosomal-occupancy

Research

JoVE Journal

Immunology and Infection

Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

8.8K Aufrufe.  Duke University School of Medicine. Human microRNAs translocate from host erythrocytes to Plasmodium falciparum parasites. Here, the techniques used to transfect synthetic microRNAs into host erythrocytes and isolate all RNAs from P. falciparum are described. In addition, this paper will detail a method of polysome isolation in P. falciparum to determine the ribosomal occupancy and translational potential of parasite transcripts. 

Serie: Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

Selection of Plasmodium falciparum Parasites for Cytoadhesion to Human Brain Endothelial Cells

Most human malaria deaths are caused by blood-stage Plasmodium falciparum parasites. Cerebral malaria, the most life-threatening complication of the disease, is characterised by an accumulation of Plasmodium falciparum infected red blood cells (iRBC) at pigmented trophozoite stage in the microvasculature of the brain2-4. This microvessel obstruction (sequestration) leads to acidosis, hypoxia and harmful inflammatory cytokines (reviewed in 5). Sequestration is also found in most microvascular tissues of the human body2, 3. The mechanism by which iRBC attach to the blood vessel walls is still poorly understood.
The immortalized Human Brain microvascular Endothelial Cell line (HBEC-5i) has been used as an in vitro model of the blood-brain barrier6. However, Plasmodium falciparum iRBC attach only poorly to HBEC-5i in vitro, unlike the dense sequestration that occurs in cerebral malaria cases. We therefore developed a panning assay to select (enrich) various P. falciparum strains for adhesion to HBEC-5i in order to obtain populations of high-binding parasites, more representative of what occurs in vivo.
A sample of a parasite culture (mixture of iRBC and uninfected RBC) at the pigmented trophozoite stage is washed and incubated on a layer of HBEC-5i grown on a Petri dish. After incubation, the dish is gently washed free from uRBC and unbound iRBC. Fresh uRBC are added to the few iRBC attached to HBEC-5i and incubated overnight. As schizont stage parasites burst, merozoites reinvade RBC and these ring stage parasites are harvested the following day. Parasites are cultured until enough material is obtained (typically 2 to 4 weeks) and a new round of selection can be performed. Depending on the P. falciparum strain, 4 to 7 rounds of selection are needed in order to get a population where most parasites bind to HBEC-5i. The binding phenotype is progressively lost after a few weeks, indicating a switch in variant surface antigen gene expression, thus regular selection on HBEC-5i is required to maintain the phenotype.
In summary, we developed a selection assay rendering P. falciparum parasites a more "cerebral malaria adhesive" phenotype. We were able to select 3 out of 4 P. falciparum strains on HBEC-5i. This assay has also successfully been used to select parasites for binding to human dermal and pulmonary endothelial cells. Importantly, this method can be used to select tissue-specific parasite populations in order to identify candidate parasite ligands for binding to brain endothelium. Moreover, this assay can be used to screen for putative anti-sequestration drugs7.

Selection of Plasmodium falciparum Parasites for Cytoadhesion to Human Brain Endothelial Cells

An in vitro model for cerebral malaria sequestration is described1. Plasmodium falciparum infected red blood cells are selected for binding to immortalized human brain microvascular endothelial cells. The selected parasites show a distinct phenotype. The selection process can be applied using various P. falciparum strains and endothelial cell lines.

Auswahl der Plasmodium falciparum Parasiten für Cytoadhesion zu Human Brain Endothelial Cells

Most human malaria deaths are caused by blood-stage Plasmodium falciparum parasites. Cerebral malaria, the most life-threatening complication of the ...

Forschung

Immunologie und Infektion

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. 1A-C), females of the genus Leptopilina (Fig. 1D, 1F, 1G) and Ganaspis (Fig. 1E) attack the larval stages. We use these parasites to study the molecular basis of a biological arms race. Parasitic wasps have tremendous value as biocontrol agents. Most of them carry virulence and other factors that modify host physiology and immunity. Analysis of Drosophila wasps is providing insights into how species-specific interactions shape the genetic structures of natural communities. These studies also serve as a model for understanding the hosts' immune physiology and how coordinated immune reactions are thwarted by this class of parasites.
The larval/pupal cuticle serves as the first line of defense. The wasp ovipositor is a sharp needle-like structure that efficiently delivers eggs into the host hemocoel. Oviposition is followed by a wound healing reaction at the cuticle (Fig. 1C, arrowheads). Some wasps can insert two or more eggs into the same host, although the development of only one egg succeeds. Supernumerary eggs or developing larvae are eliminated by a process that is not yet understood. These wasps are therefore referred to as solitary parasitoids.
Depending on the fly strain and the wasp species, the wasp egg has one of two fates. It is either encapsulated, so that its development is blocked (host emerges; Fig. 2 left); or the wasp egg hatches, develops, molts, and grows into an adult (wasp emerges; Fig. 2 right). L. heterotoma is one of the best-studied species of Drosophila parasitic wasps. It is a "generalist," which means that it can utilize most Drosophila species as hosts1. L. heterotoma and L. victoriae are sister species and they produce virus-like particles that actively interfere with the encapsulation response2. Unlike L. heterotoma, L. boulardi is a specialist parasite and the range of Drosophila species it utilizes is relatively limited1. Strains of L. boulardi also produce virus-like particles3 although they differ significantly in their ability to succeed on D. melanogaster1. Some of these L. boulardi strains are difficult to grow on D. melanogaster1 as the fly host frequently succeeds in encapsulating their eggs. Thus, it is important to have the knowledge of both partners in specific experimental protocols.
In addition to barrier tissues (cuticle, gut and trachea), Drosophila larvae have systemic cellular and humoral immune responses that arise from functions of blood cells and the fat body, respectively. Oviposition by L. boulardi activates both immune arms1,4. Blood cells are found in circulation, in sessile populations under the segmented cuticle, and in the lymph gland. The lymph gland is a small hematopoietic organ on the dorsal side of the larva. Clusters of hematopoietic cells, called lobes, are arranged segmentally in pairs along the dorsal vessel that runs along the anterior-posterior axis of the animal (Fig. 3A). The fat body is a large multifunctional organ (Fig. 3B). It secretes antimicrobial peptides in response to microbial and metazoan infections.
Wasp infection activates immune signaling (Fig. 4)4. At the cellular level, it triggers division and differentiation of blood cells. In self defense, aggregates and capsules develop in the hemocoel of infected animals (Fig. 5)5,6. Activated blood cells migrate toward the wasp egg (or wasp larva) and begin to form a capsule around it (Fig. 5A-F). Some blood cells aggregate to form nodules (Fig. 5G-H). Careful analysis reveals that wasp infection induces the anterior-most lymph gland lobes to disperse at their peripheries (Fig. 6C, D).
We present representative data with Toll signal transduction pathway components Dorsal and Sp&auml;tzle (Figs. 4,5,7), and its target Drosomycin (Fig. 6), to illustrate how specific changes in the lymph gland and hemocoel can be studied after wasp infection. The dissection protocols described here also yield the wasp eggs (or developing stages of wasps) from the host hemolymph (Fig. 8).

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Parasitoid (parasitic) wasps constitute a major class of natural enemies of many insects including Drosophila melanogaster. We will introduce the techniques to propagate these parasites in Drosophila spp. and demonstrate how to analyze their effects on immune tissues of Drosophila larvae.

Eine Einführung in die parasitischen Wespen<em&gt; Drosophila</em&gt; Und die antiparasitäre Immune Response

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. ...

Two Methods of Heterokaryon Formation to Discover HCV Restriction Factors

Hepatitis C virus (HCV) is a hepatotropic virus with a host-range restricted to humans and chimpanzees. Although HCV RNA replication has been observed in human non-hepatic and murine cell lines, the efficiency was very low and required long-term selection procedures using HCV replicon constructs expressing dominant antibiotic-selectable markers1-5. HCV in vitro research is therefore limited to human hepatoma cell lines permissive for virus entry and completion of the viral life cycle. Due to HCVs narrow species tropism, there is no immunocompetent small animal model available that sustains the complete HCV replication cycle 6-8. Inefficient replication of HCV in non-human cells e.g. of mouse origin is likely due to lack of genetic incompatibility of essential host dependency factors and/or expression of restriction factors.
We investigated whether HCV propagation is suppressed by dominant restriction factors in either human cell lines derived from non-hepatic tissues or in mouse liver cell lines. To this end, we developed two independent conditional trans-complementation methods relying on somatic cell fusion. In both cases, completion of the viral replication cycle is only possible in the heterokaryons. Consequently, successful trans-complementation, which is determined by measuring de novo production of infectious viral progeny, indicates absence of dominant restrictions.
Specifically, subgenomic HCV replicons carrying a luciferase transgene were transfected into highly permissive human hepatoma cells (Huh-7.5 cells). Subsequently, these cells were co-cultured and fused to various human and murine cells expressing HCV structural proteins core, envelope 1 and 2 (E1, E2) and accessory proteins p7 and NS2. Provided that cell fusion was initiated by treatment with polyethylene-glycol (PEG), the culture released infectious viral particles which infected na&iuml;ve cells in a receptor-dependent fashion.
To assess the influence of dominant restrictions on the complete viral life cycle including cell entry, RNA translation, replication and virus assembly, we took advantage of a human liver cell line (Huh-7 Lunet N cells 9) which lacks endogenous expression of CD81, an essential entry factor of HCV. In the absence of ectopically expressed CD81, these cells are essentially refractory to HCV infection 10 . Importantly, when co-cultured and fused with cells that express human CD81 but lack at least another crucial cell entry factor (i.e. SR-BI, CLDN1, OCLN), only the resulting heterokaryons display the complete set of HCV entry factors requisite for infection. Therefore, to analyze if dominant restriction factors suppress completion of the HCV replication cycle, we fused Lunet N cells with various cells from human and mouse origin which fulfill the above mentioned criteria. When co-cultured cells were transfected with a highly fusogenic viral envelope protein mutant of the prototype foamy virus (PFV11) and subsequently challenged with infectious HCV particles (HCVcc), de novo production of infectious virus was observed. This indicates that HCV successfully completed its replication cycle in heterokaryons thus ruling out expression of dominant restriction factors in these cell lines. These novel conditional trans-complementation methods will be useful to screen a large panel of cell lines and primary cells for expression of HCV-specific dominant restriction factors.

We describe two methods for conditional trans-complementation of hepatitis C virus (HCV) assembly and the completion of the full viral life cycle, which rely on heterokaryon formation. These techniques are suitable to screen for cell lines that express dominant restriction factors, which preclude production of infectious HCV progeny.

Zwei Methoden der Heterokaryon Formation zu entdecken HCV Restriktionsfaktoren

Hepatitis C virus (HCV) is a hepatotropic virus with a host-range restricted to humans and chimpanzees. Although HCV RNA replication has been observed in ...

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

Plasmodium falciparum, the causative agent of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important health problems worldwide, being responsible for a total of 4 million deaths annually1. Due to their extensive overlap in developing regions, especially Sub-Saharan Africa, co-infections with malaria and HIV-1 are common, but the interplay between the two diseases is poorly understood. Epidemiological reports have suggested that malarial infection transiently enhances HIV-1 replication and increases HIV-1 viral load in co-infected individuals2,3. Because this viremia stays high for several weeks after treatment with antimalarials, this phenomenon could have an impact on disease progression and transmission.
The cellular immunological mechanisms behind these observations have been studied only scarcely. The few in vitro studies investigating the impact of malaria on HIV-1 have demonstrated that exposure to soluble malarial antigens can increase HIV-1 infection and reactivation in immune cells. However, these studies used whole cell extracts of P. falciparum schizont stage parasites and peripheral blood mononuclear cells (PBMC), making it hard to decipher which malarial component(s) was responsible for the observed effects and what the target host cells were4,5. Recent work has demonstrated that exposure of immature monocyte-derived dendritic cells to the malarial pigment hemozoin increased their ability to transfer HIV-1 to CD4+ T cells6,7, but that it decreased HIV-1 infection of macrophages8. To shed light on this complex process, a systematic analysis of the interactions between the malaria parasite and HIV-1 in different relevant human primary cell populations is critically needed.
Several techniques for investigating the impact of HIV-1 on the phagocytosis of micro-organisms and the effect of such pathogens on HIV-1 replication have been described. We here present a method to investigate the effects of P. falciparum-infected erythrocytes on the replication of HIV-1 in human primary monocyte-derived macrophages. The impact of parasite exposure on HIV-1 transcriptional/translational events is monitored by using single cycle pseudotyped viruses in which a luciferase reporter gene has replaced the Env gene while the effect on the quantity of virus released by the infected macrophages is determined by measuring the HIV-1 capsid protein p24 by ELISA in cell supernatants.

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

We have developed an in vitro malaria-HIV-1 co-infection model to study the impact of Plasmodium falciparum on the HIV-1 replicative cycle in human primary monocyte-derived macrophages. This versatile system can easily be adapted to other primary cell types susceptible to HIV-1 infection.

Ein<em&gt; In-vitro-</em&gt; Co-Infektion Modell zum Studium<em&gt; Plasmodium falciparum</em&gt; HIV-1-Wechselwirkungen in primären menschlichen Monozyten abgeleitete Immunzellen

Plasmodium falciparum, the causative agent  of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important ...

A Simple Protocol for Platelet-mediated Clumping of Plasmodium falciparum-infected Erythrocytes in a Resource Poor Setting

P. falciparum causes the majority of severe malarial infections. The pathophysiological mechanisms underlying cerebral malaria (CM) are not fully understood and several hypotheses have been put forward, including mechanical obstruction of microvessels by P. falciparum-parasitized red blood cells (pRBC). Indeed, during the intra-erythrocytic stage of its life cycle, P. falciparum has the unique ability to modify the surface of the infected erythrocyte by exporting surface antigens with varying adhesive properties onto the RBC membrane. This allows the sequestration of pRBC in multiple tissues and organs by adhesion to endothelial cells lining the microvasculature of post-capillary venules 1. By doing so, the mature forms of the parasite avoid splenic clearance of the deformed infected erythrocytes 2 and restrict their environment to a more favorable low oxygen pressure 3. As a consequence of this sequestration, it is only immature asexual parasites and gametocytes that can be detected in peripheral blood.
Cytoadherence and sequestration of mature pRBC to the numerous host receptors expressed on microvascular beds occurs in severe and uncomplicated disease. However, several lines of evidence suggest that only specific adhesive phenotypes are likely to be associated with severe pathological outcomes of malaria. One example of such specific host-parasite interactions has been demonstrated in vitro, where the ability of intercellular adhesion molecule-1 to support binding of pRBC with particular adhesive properties has been linked to development of cerebral malaria 4,5. The placenta has also been recognized as a site of preferential pRBC accumulation in malaria-infected pregnant women, with chondrotin sulphate A expressed on syncytiotrophoblasts that line the placental intervillous space as the main receptor 6. Rosetting of pRBC to uninfected erythrocytes via the complement receptor 1 (CD35)7,8 has also been associated with severe disease 9.
One of the most recently described P. falciparum cytoadherence phenotypes is the ability of the pRBC to form platelet-mediated clumps in vitro. The formation of such pRBC clumps requires CD36, a glycoprotein expressed on the surface of platelets. Another human receptor, gC1qR/HABP1/p32, expressed on diverse cell types including endothelial cells and platelets, has also been shown to facilitate pRBC adhesion on platelets to form clumps 10. Whether clumping occurs in vivo remains unclear, but it may account for the significant accumulation of platelets described in brain microvasculature of Malawian children who died from CM 11. In addition, the ability of clinical isolate cultures to clump in vitro was directly linked to the severity of disease in Malawian 12 and Mozambican patients 13, (although not in Malian 14).
With several aspects of the pRBC clumping phenotype poorly characterized, current studies on this subject have not followed a standardized procedure. This is an important issue because of the known high variability inherent in the assay 15. Here, we present a method for in vitro platelet-mediated clumping of P. falciparum with hopes that it will provide a platform for a consistent method for other groups and raise awareness of the limitations in investigating this phenotype in future studies. Being based in Malawi, we provide a protocol specifically designed for a limited resource setting, with the advantage that freshly collected clinical isolates can be examined for phenotype without need for cryopreservation.

A Simple Protocol for Platelet-mediated Clumping of Plasmodium falciparum-infected Erythrocytes in a Resource Poor Setting

This method investigates the platelet-mediated clumping phenotype of Plasmodium falciparum-infected erythrocytes (pRBC) in clinical isolates. This is performed by isolating and co-incubating platelet-rich plasma and a suspension of pRBC.

Ein einfaches Protokoll für Thrombozyten-vermittelte Verklumpung<em&gt; Plasmodium falciparum</em&gt;-Infizierten Erythrozyten in einer Ressource Schlechte Einstellung

P. falciparum causes the majority of severe malarial infections. The pathophysiological mechanisms underlying cerebral malaria (CM) are not fully ...

Isolation and Analysis of Brain-sequestered Leukocytes from Plasmodium berghei ANKA-infected Mice

We describe a method for isolation and characterization of adherent inflammatory cells from brain blood vessels of P. berghei ANKA-infected mice. Infection of susceptible mouse-strains with this parasite strain results in the induction of experimental cerebral malaria, a neurologic syndrome that recapitulates certain important aspects of Plasmodium falciparum-mediated severe malaria in humans 1,2 . Mature forms of blood-stage malaria express parasitic proteins on the surface of the infected erythrocyte, which allows them to bind to vascular endothelial cells. This process induces obstructions in blood flow, resulting in hypoxia and haemorrhages 3 and also stimulates the recruitment of inflammatory leukocytes to the site of parasite sequestration.
Unlike other infections, i.e neutrotopic viruses4-6, both malaria-parasitized red blood cells (pRBC) as well as associated inflammatory leukocytes remain sequestered within blood vessels rather than infiltrating the brain parenchyma. Thus to avoid contamination of sequestered leukocytes with non-inflammatory circulating cells, extensive intracardial perfusion of infected-mice prior to organ extraction and tissue processing is required in this procedure to remove the blood compartment. After perfusion, brains are harvested and dissected in small pieces. The tissue structure is further disrupted by enzymatic treatment with Collagenase D and DNAse I. The resulting brain homogenate is then centrifuged on a Percoll gradient that allows separation of brain-sequestered leukocytes (BSL) from myelin and other tissue debris. Isolated cells are then washed, counted using a hemocytometer and stained with fluorescent antibodies for subsequent analysis by flow cytometry.
This procedure allows comprehensive phenotypic characterization of inflammatory leukocytes migrating to the brain in response to various stimuli, including stroke as well as viral or parasitic infections. The method also provides a useful tool for assessment of novel anti-inflammatory treatments in pre-clinical animal models.

Isolation and Analysis of Brain-sequestered Leukocytes from Plasmodium berghei ANKA-infected Mice

A method for isolation of adherent inflammatory leukocytes from brain blood vessels of Plasmodium berghei ANKA-infected mice is described. The method allows quantification as well as phenotypic characterization of isolated leukocytes after staining with fluorescent antibodies and subsequent analysis by flow cytometry.

Isolierung und Analyse von Brain-sequestered Leukozyten aus<em&gt; Plasmodium berghei</em&gt; ANKA-infizierte Mäuse

We describe a method for isolation and  characterization of adherent inflammatory cells from brain blood vessels of P. berghei ANKA-infected mice. ...

Separation of Plasmodium falciparum Late Stage-infected Erythrocytes by Magnetic Means

Unlike other Plasmodium species, P. falciparum can be cultured in the lab, which facilitates its study 1. While the parasitemia achieved can reach the &asymp;40% limit, the investigator usually keeps the percentage at around 10%. In many cases it is necessary to isolate the parasite-containing red blood cells (RBCs) from the uninfected ones, to enrich the culture and proceed with a given experiment. 
When P. falciparum infects the erythrocyte, the parasite degrades and feeds from haemoglobin 2, 3. However, the parasite must deal with a very toxic iron-containing haem moiety 4, 5. The parasite eludes its toxicity by transforming the haem into an inert crystal polymer called haemozoin 6, 7. This iron-containing molecule is stored in its food vacuole and the metal in it has an oxidative state which differs from the one in haem 8. The ferric state of iron in the haemozoin confers on it a paramagnetic property absent in uninfected erythrocytes. As the invading parasite reaches maturity, the content of haemozoin also increases 9, which bestows even more paramagnetism on the latest stages of P. falciparum inside the erythrocyte.
Based on this paramagnetic property, the latest stages of P. falciparum infected-red blood cells can be separated by passing the culture through a column containing magnetic beads. These beads become magnetic when the columns containing them are placed on a magnet holder. Infected RBCs, due to their paramagnetism, will then be trapped inside the column, while the flow-through will contain, for the most part, uninfected erythrocytes and those containing early stages of the parasite.
Here, we describe the methodology to enrich the population of late stage parasites with magnetic columns, which maintains good parasite viability 10. After performing this procedure, the unattached culture can be returned to an incubator to allow the remaining parasites to continue growing.

Separation of Plasmodium falciparum Late Stage-infected Erythrocytes by Magnetic Means

The paramagnetic properties of hemozoin are used to isolate late stages of Plasmodium falciparum-infected red blood cells growing in culture. The method is simple and fast and does not affect the subsequent invasive capabilities of the parasites.

Trennung<em&gt; Plasmodium falciparum</em&gt; Late Stage-infizierten Erythrozyten durch magnetische Mittel

Unlike other Plasmodium species, P. falciparum can be cultured in the lab, which facilitates its study 1. While the parasitemia achieved can reach the ...

High Yield Purification of Plasmodium falciparum Merozoites For Use in Opsonizing Antibody Assays

Plasmodium falciparum merozoite antigens are under development as potential malaria vaccines. One aspect of immunity against malaria is the removal of free merozoites from the blood by phagocytic cells. However assessing the functional efficacy of merozoite specific opsonizing antibodies is challenging due to the short half-life of merozoites and the variability of primary phagocytic cells. Described in detail herein is a method for generating viable merozoites using the E64 protease inhibitor, and an assay of merozoite opsonin-dependent phagocytosis using the pro-monocytic cell line THP-1. E64 prevents schizont rupture while allowing the development of merozoites which are released by filtration of treated schizonts. &#160;Ethidium bromide labelled merozoites are opsonized with human plasma samples and added to THP-1 cells. Phagocytosis is assessed by a standardized high throughput protocol. Viable merozoites are a valuable resource for assessing numerous aspects of P. falciparum biology, including assessment of immune function. Antibody levels measured by this assay are associated with clinical immunity to malaria in naturally exposed individuals. The assay may also be of use for assessing vaccine induced antibodies. &#160;

High Yield Purification of Plasmodium falciparum Merozoites For Use in Opsonizing Antibody Assays

Measuring antibody function is key to understanding immunity to Plasmodium falciparum malaria. This method describes the purification of viable merozoites, and measurement of opsonization-dependent phagocytosis by flow cytometry.

High Yield Reinigung von<em&gt; Plasmodium falciparum</em&gt; Merozoiten Zur Verwendung in opsonierende Antikörper-Assays

Plasmodium falciparum merozoite antigens are under development as potential malaria vaccines. One aspect of immunity against malaria is the removal of ...

Development of Stem Cell-derived Antigen-specific Regulatory T Cells Against Autoimmunity

Autoimmune diseases arise due to the loss of immunological self-tolerance. Regulatory T cells (Tregs) are important mediators of immunologic self-tolerance. Tregs represent about 5 - 10% of the mature CD4+ T cell subpopulation in mice and humans, with about 1 - 2% of those Tregs circulating in the peripheral blood. Induced pluripotent stem cells (iPSCs) can be differentiated into functional Tregs, which have a potential to be used for cell-based therapies of autoimmune diseases. Here, we present a method to develop antigen (Ag)-specific Tregs from iPSCs (i.e., iPSC-Tregs). The method is based on incorporating the transcription factor FoxP3 and an Ag-specific T cell receptor (TCR) into iPSCs and then differentiating on OP9 stromal cells expressing Notch ligands delta-like (DL) 1 and DL4. Following in vitro differentiation, the iPSC-Tregs express CD4, CD8, CD3, CD25, FoxP3, and Ag-specific TCR and are able to respond to Ag stimulation. This method has been successfully applied to cell-based therapy of autoimmune arthritis in a murine model. Adoptive transfer of these Ag-specific iPSC-Tregs into Ag-induced arthritis (AIA)-bearing mice has the ability to reduce joint inflammation and swelling and to prevent bone loss.

We present here a method to develop functional antigen (Ag)-specific regulatory T cells (Tregs) from induced pluripotent stem cells (iPSCs) for immunotherapy of autoimmune arthritis in a murine model.

Entwicklung von Stammzellen abgeleiteten Antigen-spezifische regulatorische T-Zellen gegen Autoimmunität

Autoimmune diseases arise due to the loss of immunological self-tolerance. Regulatory T cells (Tregs) are important mediators of immunologic ...

Using Phylogenetic Analysis to Investigate Eukaryotic Gene Origin

Phylogenetic analysis uses nucleotide or amino acid sequences or other parameters, such as domain sequences and three-dimensional structure, to construct a tree to show the evolutionary relationship among different taxa (classification units) at the molecular level. Phylogenetic analysis can also be used to investigate domain relationships within an individual taxon, particularly for organisms that have undergone substantial change in morphology and physiology, but for which researchers lack fossil evidence due to the organisms&#39; long evolutionary history or scarcity of fossilization.
In this text, a detailed protocol is described for using the phylogenetic method, including amino acid sequence alignment using Clustal Omega, and subsequent phylogenetic tree construction using both Maximum Likelihood (ML) of Molecular Evolutionary Genetics Analysis (MEGA) and Bayesian Inference via MrBayes. To investigate the origin of eukaryotic Sugars Will Eventually be Exported Transporters (SWEET) genes, 228 SWEETs including 35 SWEET proteins from unicellular eukaryotes and 57 SemiSWEET proteins from prokaryotes were analyzed. Interestingly, SemiSWEETs were found in prokaryotes, but SWEETs were found in eukaryotes. Two phylogenetic trees constructed using theoretically distinct methods have consistently&#160;suggested that the first eukaryotic SWEET gene might stem from the fusion of a bacterial SemiSWEET gene and an archaeal SemiSWEET gene.&#160;It is worth noting that one should be cautious to draw a conclusion based only on phylogenetic analysis, although it is useful to explain the underlying relationship between different taxa, which is difficult or even impossible to discern through experimental means.

A method of constructing a phylogenetic tree based on sequence homology of SWEETs from eukaryotes and SemiSWEETs from prokaryotes is described. Phylogenetic analysis is a useful tool for explaining the evolutionary relatedness between homologous proteins or genes from different organism groups.

Mit der phylogenetischen Analyse zu eukaryotischen Gens Herkunft untersuchen

Phylogenetic analysis uses nucleotide or amino acid sequences or other parameters, such as domain sequences and three-dimensional structure, to construct ...

Methoden, um die regulatorische Rolle kleiner RNAs und Ribosomal Belegung von Untersuchen

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video

Auswahl der Plasmodium falciparum Parasiten für Cytoadhesion zu Human Brain Endothelial Cells

Eine Einführung in die parasitischen Wespen

Zwei Methoden der Heterokaryon Formation zu entdecken HCV Restriktionsfaktoren

Ein

Ein einfaches Protokoll für Thrombozyten-vermittelte Verklumpung

Isolierung und Analyse von Brain-sequestered Leukozyten aus

Trennung

High Yield Reinigung von

Entwicklung von Stammzellen abgeleiteten Antigen-spezifische regulatorische T-Zellen gegen Autoimmunität

Mit der phylogenetischen Analyse zu eukaryotischen Gens Herkunft untersuchen