Name: determination of sialic acids in liver and milk samples of wild-type and cmah knock-out mice.
Uploaded: 2017-07-14T15:00:00.000+00:00
Duration: 8 min 4 s
Description: Watch this Scientific Journal Video about Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice. at JoVE.com

Diese Arbeit wurde zum Teil von der Naturwissenschaftlichen Stiftung von China (Zuschussnummern 31471703, A0201300537 und 31671854 an JV und LL) und dem 100 Foreign Talents Plan (Zuschussnummer JSB2014012 an JV) unterstützt.

Verfahren, die Tierfächer betreffen, wurden vom Ethischen Komitee des Experimentellen Tierzentrums der Nanjing Agricultural University im Einklang mit den nationalen Richtlinien für das experimentelle Tierschutz (Ministerium für Wissenschaft und Technologie, PR von China, 2006) mit den Tieren, die in einem SPF untergebracht wurden, genehmigt (Berechtigungs-ID: SYXK-J-2011-0037). 1. Cmah Knock-out Maus Modell <ol><li> Verwenden Sie Wildtyp-C57Bl / 6-Mäuse aus dem Vergleichsmedizinzentrum der Universität von Yangzhou (China). HINWEIS : Cmah- Knock-out-Mäuse wurden basierend auf den Informationen aus früheren Cmah- Knock-out-Studien 17 , 19 erstellt und kommerziell unter Verwendung einer CRISPR / Cas9 20- Strategie gewonnen, indem 92 Basenpaare aus Exon 6 des Cmah- Gens entfernt wurden, was ebenfalls der Fall ist Deletiert im menschlichen CMAH- Gen 19 . Positiv F 0 &lt;/ sub&gt; -mice (2 Personen) wurden mit Wildtyp - Mäusen gekreuzt heterozygot F 1 -mice zu erhalten. Nach dem Überqueren von heterozygoten F 1 -Mäuse (5 Individuen) konnte man homozygote Cmah- Knock-out-F 2 -Mäuse erfolgreich erhalten (3 Individuen). </li><li> Führen Sie die Genotypisierung von Mäusen mit genomischer DNA nach dem von Zangala 21 gezeigten Verfahren unter Verwendung eines kommerziellen DNA-Reinigungskits durch. <ol><li> Verstärken Sie ein entsprechendes DNA-Fragment des Cmah- Gens unter Verwendung von kommerzieller DNA-Polymerase und dem Primerpaar 5&#39;gaaagggctcggctctgtataa &#39;&#39; und 5&#39;tttaaatertcccgggtgagaagc3 &#39;. Führen Sie die Genamplifikation unter Verwendung von 34 PCR-Zyklen aus, die aus einer Denaturierung bei 94 ° C für 40 s, einem Glühen bei 63 ° C für 40 s und einer Dehnung bei 72 ° C für 1 min bestehen. </li><li> Visualisierung von PCR-Produkten auf einem 1% Agarosegel. Man sollte ein einzelnes Band (0,5 kb) für das Wildtyp-Individuum, ein Doppelband (0,4 und 0,5 kb) für dieHeterozygoten Knock-out-Individuum und ein einziges Band (0,4 kb) für das homozygote Knock-out-Individuum. </li></ol></li></ol> 2. Probenahme <ol><li> Sammeln Sie die Mausmilch mit dem von Willingham et al. 22 </li><li> Sammle das Mauslebergewebe mit dem von Gonçalves et al. Beschriebenen Protokoll . 23 und Proben bei -80 ° C aufbewahren. </li></ol> 3. Isolierung von Sialinsäuren aus Milch <ol><li> 100 ml einer 2 M Essigsäurelösung durch Zugabe von 12 ml Eisessig in 88 ml destilliertem H 2 O zubereiten. </li><li> 50 μl Milch in ein 1,5 mL Zentrifugenröhrchen geben und 1,2 ml der vorbereiteten wässrigen Essigsäurelösung zugeben. </li><li> Inkubieren Sie die Suspension für 4 h bei 80 ° C und zentrifugieren Sie die Probe bei 14.000 xg für 10 min. </li><li> Übertragen Sie die obersten 1.000 μl des Überstandes in ein frisches 1,5 mL Zentrifugenröhrchen und remDas Lösungsmittel durch Zentrifugalverdampfung bei Raumtemperatur abkühlen lassen, um die Trockenheit zu beenden (abhängig von der angeschlossenen Vakuumpumpe dauert dies 4 - 20 h). Die Probe in 500 μl destilliertem H 2 O auflösen. </li><li> Bereiten Sie eine Mikroanionenaustauschersäule vor. Dieser Schritt wird spezifisch anionische Verbindungen anreichern und kationische und neutrale Verbindungen aus den Milch- und Leberproben entfernen und damit die Selektivität des fluorogenen OPD-Markierungsmittels für die Sialinsäurederivatisierung erhöhen. <ol><li> Übertragen Sie für jede Probe 200 mg des Anionenaustauscherharzes (Dowex 1X8) in leere 3 mL Säulenröhrchen mit einem angehängten Hahn. </li><li> Man gibt 2 ml der in Schritt 3.1 hergestellten wässrigen Essigsäurelösung zu, um die Chloridionen im Harz mit Acetat-Ionen zu ersetzen. Schließen Sie den Hahn, sobald das Lösungsmittel die Oberseite des Harzes erreicht. </li><li> Fügen Sie 2 ml destilliertes H 2 O vor, öffnen Sie den Hahn und stoppen Sie den Fluss, sobald der Großteil des Lösungsmittels erreicht istDie Oberseite des Harzes. Stellen Sie sicher, dass das Harz immer mit Lösungsmittel bedeckt ist. </li><li> Die Harzsäule zwei weitere Male mit 2 ml destilliertem H 2 O zum Entfernen des überschüssigen Acetats waschen. </li></ol></li><li> Übertragen Sie die resultierenden 500 μl Probenlöser aus Schritt 3.4. Auf die Harzsäule auftragen und den Durchfluss verwerfen. Das Harz mit 2 ml destilliertem H 2 O vorsichtig waschen. Die Probenanionen aus dem Harz unter Verwendung von 1 ml einer 50 mM Ammoniumacetatlösung (386 mg Ammoniumacetat, gelöst in 100 ml destilliertem H 2 O) in ein 1,5 ml eluieren Zentrifugenröhrchen. Entfernen Sie das Lösungsmittel durch Zentrifugalverdampfung bei Raumtemperatur bis zur Trockenheit. HINWEIS: Trockene Proben können bei 4-6 ° C für bis zu 12 Monate gelagert werden. </li></ol> 4. Isolierung von Sialinsäuren aus Lebergewebe <ol><li> Vorsicht 20 - 50 mg Mausleber auftauen und in eine Dounce - Gewebemühle (1 ml oder 2 ml Volumen) überführen. Zugabe von 1,2 ml der wässrigen EssigsäurelösungHergestellt in Schritt 3.1 und homogenisieren das Gewebe durch sanfte Scherung für 10 s. Die erhaltene Suspension in ein 1,5 mL Zentrifugenröhrchen überführen. </li><li> Folgen Sie den Schritten 3.3. Auf 3,6. HINWEIS: Trockene Proben können bei 4-6 ° C für bis zu 12 Monate gelagert werden. </li></ol> 5. Vorbereitung eines gemischten Sialinsäure-Standards <ol><li> Wiegen zwischen 5 - 8 mg N-Acetylneuraminsäure auf einem analytischen Gleichgewicht in ein 1,5 mL Zentrifugenröhrchen. Man beachte das genaue Gewicht und füge 164 μl destilliertes H 2 O für jede mg hinzu ( dh wenn das Gewicht von Neu5Ac 7,2 mg beträgt, dann 7,2 x 164 = 1, 181 μl destilliertes H 2 O) zugeben. Daraus ergibt sich eine 20 mM Neu5Ac-Stammlösung, die bei -20 ° C für bis zu 12 Monate gelagert werden kann. </li><li> N-Glykolylneuraminsäure in kleineren Mengen zu einem moderaten Preis erhalten, wie in 1 mg Aliquoten. Füge 154 μl destilliertes H 2 O direkt zu der Verbindung hinzu, um eine ~ 20 mM Neu5Gc-Stammlösung zu erhalten. Übertragen Sie dieLösung in ein 1,5 mL Zentrifugenröhrchen gegeben. Diese Lösung kann bei -20 ° C für bis zu 12 Monate gelagert werden. </li><li> Kombinieren Sie 5 μl aus jeder Stammlösung aus Schritt 5.1 und 5.2 in ein frisches 1,5 mL Zentrifugenröhrchen und entfernen Sie das Lösungsmittel durch Zentrifugalverdampfung bei Raumtemperatur bis zur Trockene. HINWEIS: Der gemischte Sialinsäurestandard kann bis zu 12 Monate bei 4 - 6 ° C gelagert werden. </li></ol> 6. Fluoreszenzderivatisierung von Sialinsäuren <ol><li> Vorbereiten von 10 ml OPD-Lösung, bestehend aus 100 mg o-Phenylendiamin und 208 mg Natriumhydrogensulfit in 10 ml destilliertem H 2 O. </li><li> Füge 20 μl OPD-Lösung zu den aus Mäusemilch gewonnenen Sialinsäureproben (Schritt 3), Mausleber (Schritt 4) oder dem gemischten Sialinsäurestandard (Schritt 5) hinzu. Vortex kräftig für 30 s und inkubieren Proben für 4 h bei 80 ° C im Dunkeln ( dh wickeln die Mikroröhrchen in Aluminiumfolie). </li><li> Lassen Sie die Proben 5 min abkühlen, fügen Sie 80 μ hinzu; L destilliertem H 2 O und die Röhrchen bei 14000 × g für 1 min zentrifugiert. </li><li> Übertragen Sie 80 μl aus dem Überstand in eine 300 μl hochauflösende HPLC-Durchstechflasche. Die derivatisierten Sialinsäureproben können bis zu einer Woche bei 4 - 6 ° C gelagert werden. </li></ol> 7. HPLC-Analyse von Sialinsäurederivaten <ol><li> Analysieren Sie die Proben mit einem Standard-HPLC-System, das mit einem Online-Fluoreszenzdetektor verbunden ist. </li><li> Verwenden Sie für die Analyse eine Umkehrphasen-C18-Säule mit den Standardabmessungen von 250 mm Länge und 4,6 mm Durchmesser. </li><li> Vorbereitung des Lösungsmittels A durch Verdünnen von 200 ml Stammlösung mit 800 ml LCMS-Wasser (LCMS - Flüssigchromatographie-Massenspektrometrie). Die Stammlösung selbst kann wie folgt hergestellt werden: <ol><li> Füge 46 g Ameisensäure zu 800 ml LCMS-Klasse H 2 O hinzu. </li><li> Stellen Sie den pH-Wert auf 4,5 durch tropfenweise Zugabe von Ammoniumhydroxidlösung (pur. Pa) ein. </li><li> Übertragen Sie das Lösungsmittel auf einMesszylinder und füllen bis zu 1.000 ml mit LCMS-Klasse H 2 O. Diese Stammlösung kann bei 4 - 6 ° C für bis zu 3 Monate gelagert werden. </li></ol></li><li> Für Lösungsmittel B, verwenden Sie LCMS-Grad Acetonitril. </li><li> Trennen Sie die Sialinsäurederivate bei einer 1 mL / min Fließgeschwindigkeit mit folgender Gradientenelution: <ol><li> Beginnen Sie mit der Zugabe von 10% des Lösungsmittels B, das dem Lösungsmittel A gemischt wurde. </li><li> Von 0 min bis 15 min erhöht man allmählich den Anteil des Lösungsmittels B mit einem linearen Gradienten auf 60%. </li><li> Von 15 min auf 16 min steigern schnell den Anteil an Lösungsmittel B mit einem linearen Gradienten von 60% bis 90%. Dies initiiert das Waschen der HPLC-Säule. </li><li> Um die HPLC-Säule weiter zu waschen, halten Sie den Füllstand des Lösungsmittels B bei 90% zwischen 16 min und 18 min, bevor Sie den Füllstand des Lösungsmittels B wieder auf 10% zwischen 18 min und 19 min reduzieren. </li><li> Die HPLC-Säule auf die Ausgangsbedingungen von 10% B zwischen 19 und 24 min re-equilibrieren. </li></ol></li><li> Im50 μl Probe in das HPLC-System geben. </li><li> Überwachen Sie die Eluenten mit den Fluoreszenzdetektor-Anregungs- / Emissionswellenlängen von 373/448 nm und die derivatisierten Sialinsäuren können bei den ungefähre Retentionszeiten von 9 min (für Neu5Gc-OPD) und 10 min (für Neu5Ac-OPD) erwartet werden. </li><li> Berechnen Sie die relative Menge von Neu5Gc (F Neu5Gc ) aus den Fluoreszenz-Peakflächen des Neu5Ac (A Neu5Ac ) und Neu5Gc (A Neu5Gc ) wie folgt: F Neu5Gc [%] = 100 × A Neu5Gc / (A Neu5Ac + A Neu5Gc ). Im Falle der Milch- und Leberproben aus der homozygoten Cmah- Knock-out-Maus sollte F Neu5Gc 0% betragen , während die Werte für F Neu5Gc von heterozygoten und Wildtyp-Mäusen je nach Mausalter und Gewebetyp stark variieren können (zwischen 2% Und&gt; 90%) mit erwarteten Fehlerrändern von ± 12%. </li></ol>

<ol>
	<li>Lamari, F. N., Karamanos, N. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separation+methods+for+sialic+acids+and+critical+evaluation+of+their+biologic+relevance.">Separation methods for sialic acids and critical evaluation of their biologic relevance.</a> J Chromatogr B Analyt Technol Biomed Life Sci. 781 (1-2), 3-19 (2002).</li><li>Irie, A., Koyama, S., Kozutsumi, Y., Kawasaki, T., Suzuki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+basis+for+the+absence+of+N-glycolylneuraminic+acid+in+humans.">The molecular basis for the absence of N-glycolylneuraminic acid in humans.</a> J Biol Chem. 273 (25), 15866-15871 (1998).</li><li>Chou, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mutation+in+human+CMP-sialic+acid+hydroxylase+occurred+after+the+Homo-Pan+divergence.">A mutation in human CMP-sialic acid hydroxylase occurred after the Homo-Pan divergence.</a> Proc Natl Acad Sci U S A. 95 (20), 11751-11756 (1998).</li><li>Rehan, I. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-Scale+Glycomics+of+Livestock:+Discovery+of+Highly+Sensitive+Serum+Biomarkers+Indicating+an+Environmental+Stress+Affecting+Immune+Responses+and+Productivity+of+Holstein+Dairy+Cows.">Large-Scale Glycomics of Livestock: Discovery of Highly Sensitive Serum Biomarkers Indicating an Environmental Stress Affecting Immune Responses and Productivity of Holstein Dairy Cows.</a> J Agric Food Chem. 63 (48), 10578-10590 (2015).</li><li>Wang, B., McVeagh, P., Petocz, P., Brand-Miller, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brain+ganglioside+and+glycoprotein+sialic+acid+in+breastfed+compared+with+formula-fed+infants.">Brain ganglioside and glycoprotein sialic acid in breastfed compared with formula-fed infants.</a> Am J Clin Nutr. 78 (5), 1024-1029 (2003).</li><li>Yao, H. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+sialic+acids+in+red+meat+by+UPLC-FLD+using+indoxylsialosides+as+internal+standards.">Quantification of sialic acids in red meat by UPLC-FLD using indoxylsialosides as internal standards.</a> Glycoconj J. 33 (2), 219-226 (2016).</li><li>Nguyen, D. H., Tangvoranuntakul, P., Varki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+natural+human+antibodies+against+a+nonhuman+sialic+acid+that+metabolically+incorporates+into+activated+and+malignant+immune+cells.">Effects of natural human antibodies against a nonhuman sialic acid that metabolically incorporates into activated and malignant immune cells.</a> J Immunol. 175 (1), 228-236 (2005).</li><li>Byres, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incorporation+of+a+non-human+glycan+mediates+human+susceptibility+to+a+bacterial+toxin.">Incorporation of a non-human glycan mediates human susceptibility to a bacterial toxin.</a> Nature. 456 (7222), 648-652 (2008).</li><li>Hedlund, M., Padler-Karavani, V., Varki, N. M., Varki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+a+human-specific+mechanism+for+diet+and+antibody-mediated+inflammation+in+carcinoma+progression.">Evidence for a human-specific mechanism for diet and antibody-mediated inflammation in carcinoma progression.</a> Proc Natl Acad Sci U S A. 105 (48), 18936-18941 (2008).</li><li>Tangvoranuntakul, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+uptake+and+incorporation+of+an+immunogenic+nonhuman+dietary+sialic+acid.">Human uptake and incorporation of an immunogenic nonhuman dietary sialic acid.</a> Proc Natl Acad Sci U S A. 100 (21), 12045-12050 (2003).</li><li>Svennerholm, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+estimation+of+sialic+acids.+II.+A+colorimetric+resorcinol-hydrochloric+acid+method.">Quantitative estimation of sialic acids. II. A colorimetric resorcinol-hydrochloric acid method.</a> Biochim Biophys Acta. 24 (3), 604-611 (1957).</li><li>Warren, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+thiobarbituric+acid+assay+of+sialic+acids.">The thiobarbituric acid assay of sialic acids.</a> J Biol Chem. 234 (8), 1971-1975 (1959).</li><li>Kakehi, K., Maeda, K., Teramae, M., Honda, S., Takai, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+sialic+acids+by+gas+chromatography+of+the+mannosamine+derivatives+released+by+the+action+of+N-acetylneuraminate+lyase.">Analysis of sialic acids by gas chromatography of the mannosamine derivatives released by the action of N-acetylneuraminate lyase.</a> J Chromatogr. 272 (1), 1-8 (1983).</li><li>Wheeler, S. F., Domann, P., Harvey, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivatization+of+sialic+acids+for+stabilization+in+matrix-assisted+laser+desorption/ionization+mass+spectrometry+and+concomitant+differentiation+of+alpha(2+-->+3)-+and+alpha(2+-->+6)-isomers.">Derivatization of sialic acids for stabilization in matrix-assisted laser desorption/ionization mass spectrometry and concomitant differentiation of alpha(2 --> 3)- and alpha(2 --> 6)-isomers.</a> Rapid Commun Mass Spectrom. 23 (2), 303-312 (2009).</li><li>Hurum, D. C., Rohrer, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+sialic+acids+in+infant+formula+by+chromatographic+methods:+a+comparison+of+high-performance+anion-exchange+chromatography+with+pulsed+amperometric+detection+and+ultra-high-performance+liquid+chromatography+methods.">Determination of sialic acids in infant formula by chromatographic methods: a comparison of high-performance anion-exchange chromatography with pulsed amperometric detection and ultra-high-performance liquid chromatography methods.</a> J Dairy Sci. 95 (3), 1152-1161 (2012).</li><li>Ito, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+fluorometric+high-performance+liquid+chromatography+method+for+sialic+acid+determination:+an+internal+standard+method+and+its+application+to+sialic+acid+analysis+of+human+apolipoprotein.">An improved fluorometric high-performance liquid chromatography method for sialic acid determination: an internal standard method and its application to sialic acid analysis of human apolipoprotein.</a> E. Anal Biochem. 300 (2), 260-266 (2002).</li><li>Naito, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germinal+Center+Marker+GL7+Probes+Activation-Dependent+Repression+of+N-Glycolylneuraminic+Acid,+a+Sialic+Acid+Species+Involved+in+the+Negative+Modulation+of+B-Cell+Activation.">Germinal Center Marker GL7 Probes Activation-Dependent Repression of N-Glycolylneuraminic Acid, a Sialic Acid Species Involved in the Negative Modulation of B-Cell Activation.</a> Mol Cell Biol. 27 (8), 3008-3022 (2007).</li><li>Manzi, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-pressure+liquid+chromatography+of+sialic+acids+on+a+pellicular+resin+anion-exchange+column+with+pulsed+amperometric+detection:+a+comparison+with+six+other+systems.">High-pressure liquid chromatography of sialic acids on a pellicular resin anion-exchange column with pulsed amperometric detection: a comparison with six other systems.</a> Anal Biochem. 188 (1), 20-32 (1990).</li><li>Hedlund, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-glycolylneuraminic+acid+deficiency+in+mice:+implications+for+human+biology+and+evolution.">N-glycolylneuraminic acid deficiency in mice: implications for human biology and evolution.</a> Mol Cell Biol. 27 (12), 4340-4346 (2007).</li><li>Platt, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9+knockin+mice+for+genome+editing+and+cancer+modeling.">CRISPR-Cas9 knockin mice for genome editing and cancer modeling.</a> Cell. 159 (2), 440-455 (2014).</li><li>Zangala, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+genomic+DNA+from+mouse+tails.">Isolation of genomic DNA from mouse tails.</a> J Vis Exp. (6), e246 (2007).</li><li>Willingham, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Milk+collection+methods+for+mice+and+Reeves'+muntjac+deer.">Milk collection methods for mice and Reeves' muntjac deer.</a> J Vis Exp. (89), (2014).</li><li>Goncalves, L. A., Vigario, A. M., Penha-Goncalves, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+isolation+of+murine+hepatocytes+for+in+vitro+malaria+liver+stage+studies.">Improved isolation of murine hepatocytes for in vitro malaria liver stage studies.</a> Malar J. 6, 169 (2007).</li></ol>

Die Autoren haben nichts zu offenbaren.

Das hier beschriebene Protokoll erlaubt die phänotypische Beurteilung von homozygoten Cmah- Knock-out-Mäusen durch Analysieren und Quantifizieren der relativen Mengen an Neu5Gc Milch und Leberproben. Die Analyse wurde unter Verwendung eines Standard-HPLC-Setups mit Fluoreszenzdetektion durchgeführt. Der wichtigste Schritt dieses Verfahrens ist die Herstellung der Anionenaustauschsäulen und die Durchführung der Anionenaustauschchromatographie; Um das Harz richtig zu regeln und die richtigen Wasch- und Eluti...

N-Acetylneuraminsäure (Neu5Ac) und N-Glykolylneuraminsäure (Neu5Gc) sind die häufigsten Sialinsäuren bei den meisten Säugetieren 1 . Obwohl es in der Lage ist, Neu5Ac endogen zu synthetisieren, sind die Menschen nicht in der Lage, Neu5Gc aufgrund einer primären Exon-Deletion auf dem CMAH- Gen, das für eine CMP-Neu5Ac-Hydroxylase 2 , 3 kodiert , zu produzieren . Allerdings können tierische Lebensmittelprodukte diätetische Quellen von Neu5Gc 4 , 5 , 6 sein , was zur Herstellung von Anti-Neu5Gc-Antikörpern führt und daher eine Immunantwort gegen Neu5Gc 7 auslöst. Diese diätetische Wirkung von Neu5Gc wird vermutlich zur chronischen Entzündung und verschiedenen anderen Krankheiten beitragen 8 , 9 , 10 . Um die Wirkungen von Neu5Gc in h zu verstehenUmans, ein Tiermodell für die systematische Untersuchung der Wirkungen von lebensmittelhaltigen Sialinsäuren ist höchst wünschenswert. Obwohl die auf der Polymerase-Kettenreaktion (PCR) basierenden Protokolle zur Analyse von Knock-out-Mäusen gut etabliert sind und ein bequemer Weg für die genotypische Beurteilung ist, erfordert die funktionelle Analyse des Phänotyps auf dem metabolischen Niveau spezifischere Analysemethoden. Der Phänotyp eines Cmah- Knock-out-Mausmodells kann durch Isolierung und Analyse der Zusammensetzung von Sialinsäuren in Leber- oder Milchproben beurteilt werden. Mehrere Verfahren zum Nachweis von Sialinsäuren in tierischen Geweben wurden bisher beschrieben: Die Umsetzung von Sialinsäuren mit Resorcin 11 oder Thiobarbitursäure 12 führt zur Bildung eines chromophoren Produktes und kann einfach unter Verwendung eines plateraderbasierten Aufbaus analysiert werden, aber nur das gesamte Sialis Säuregehalt kann bestimmt werden. Alternativ wurde auch die Analyse von Sialinsäuren mittels Gaschromatographie beschrieben13 , MALDI-ToF-Massenspektrometrie 14 oder amperometrische Methoden 15 . Die am häufigsten angewandten Sialinsäureanalyseverfahren basieren jedoch auf der hydrolytischen Freisetzung, gefolgt von der Fluoreszenzderivatisierung und der nachfolgenden Hochleistungsflüssigkeitschromatographie 16 , 17 , 18 .

<table><tbody><tr><td>&lt;strong&gt;Chemicals:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>N-acetylneuraminic acid</td><td>Sigma</td><td>A0812</td><td></td></tr><tr><td>N-glycolylneuraminic acid</td><td>Sigma</td><td>50644</td><td>1 mg aliquot should be sufficient</td></tr><tr><td>o-Phenylenediamine</td><td>Sigma</td><td>694975</td><td></td></tr><tr><td>Sodium hydrogen sulfite</td><td>J&amp;amp;K Scientific Ltd</td><td>75234</td><td></td></tr><tr><td>&lt;strong&gt;Tools/Materials:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>3 mL SPE tubes</td><td>Supelco</td><td>Sigma 57024</td><td>empty solid phase extraction columns</td></tr><tr><td>Luer stopcock</td><td>Sigma</td><td>S7396</td><td>to stop the flow of the SPE tube</td></tr><tr><td>Dowex 1X8</td><td>Dow Chemicals</td><td>Sigma 44340</td><td>200 - 400 mesh</td></tr><tr><td>Dounce tissue grinder</td><td>Sigma</td><td>D8938</td><td>tight fit</td></tr><tr><td>&lt;strong&gt;HPLC Analysis:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>High-recovery HPLC vial</td><td>Agilent Technologies</td><td>#5188-2788</td><td></td></tr><tr><td>HPLC System</td><td>Shimadzu</td><td>Nexera</td><td></td></tr><tr><td>Fluorescence Detector for HPLC</td><td>Shimadzu</td><td>RF-20Axs</td><td></td></tr><tr><td>HPLC Column</td><td>Phenomenex</td><td>Hyperclone ODS</td><td>250 x 4.6 mm</td></tr><tr><td>LCMS-grade H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Merck Millipore</td><td>#WX00011</td><td></td></tr><tr><td>LCMS-grade Acetonitrile</td><td>Merck Millipore</td><td>#100029</td><td>Hypergrade</td></tr><tr><td>Ammonium hydroxide solution</td><td>Fluka</td><td>#44273</td><td>puriss. P.a.</td></tr></tbody></table>

determination of sialic acids in liver and milk samples of wild-type and cmah knock-out mice.

CMAH (Cytidinmonophosphat-N-acetylneuraminsäure-hydroxylase) ist verantwortlich für die Oxidation von Cytidinmonophosphat-N-acetylneuraminsäuren bei Säugetieren. Jedoch kann der Mensch Cytidinmonophosphat-N-acetylneuraminsäure nicht zu Cytidinmonophosphat-N-glykolylneuraminsäure aufgrund einer primären Exon-Deletion des CMAH- Gens oxidieren. Um die Effekte und Implikationen des Mangels an CMAH-Aktivität genauer zu verstehen, ist ein Cmah- Knock-out-Modell bei Mäusen von großem Interesse an Grund- und angewandter Forschung. Das Analyseverfahren zur Bestimmung des Phänotyps dieses Mausmodells wird hier im Detail beschrieben und basiert auf dem Nachweis sowohl der N-Acetylneuraminsäure als auch der N-Glykolylenuraminsäure in der Leber und der Milch von Wildtyp- und Cmah- Knock-out-Mäusen. Endogene Sialinsäuren werden freigesetzt und mit o-Phenylendiamin derivatisiert, um fluorogene Derivate zu erzeugen, die anschließend mittels HPLC analysiert werden können. Das vorgestellte Protokoll kann seinAuch für die Analyse von Milch und Gewebeproben aus verschiedenen anderen Ursprüngen angewendet und kann von Nutzen sein, um die ernährungs- und gesundheitlichen Auswirkungen von N-Glykolylneuraminsäure zu untersuchen.

Ein schematischer Überblick über das beschriebene Analyseverfahren ist in Abbildung 1 dargestellt und beinhaltet die Isolierung von Sialinsäuren aus Milch- und Leberproben von Wildtyp- und Cmah- Knockout-Mutanten-Mäusen sowie die Fluoreszenz-Derivatisierung und HPLC-Analyse dieser Komponenten. Abbildung 2 und Abbildung 3 zeigen repräsentative HPLC-Chromatogramme von derivatisierten Sia...

Watch this Scientific Journal Video about Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice. at JoVE.com

Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

Wir beschreiben ein HPLC-basiertes Verfahren zur Bestimmung von N-Acetylneuraminsäure und N-Glykolylenuraminsäure in Mausleber und Milch.

Bestimmung von Sialinsäuren in Leber- und Milchproben von Wildtyp und<em&gt; CMAH</em&gt; Knock-out Mäuse.

CMAH (cytidine monophosphate-N-acetylneuraminic acid hydroxylase) is responsible for the oxidation of cytidine monophosphate-N-acetylneuraminic acids in ...

determination-sialic-acids-liver-milk-samples-wild-type-cmah-knock

Research

JoVE Journal

Biology

Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

9.7K Aufrufe.  Nanjing Agricultural University.  Wir beschreiben ein HPLC-basiertes Verfahren zur Bestimmung von N-Acetylneuraminsäure und N-Glykolylenuraminsäure in Mausleber und Milch. 

Serie: Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

Determining Bile Duct Density in the Mouse Liver

Mouse is broadly used as a model organism to study biliary diseases. To evaluate the development and function of the biliary system, various techniques are used, including serum chemistry, histological analysis, and immunostaining for specific markers. Although these techniques can provide important information about the biliary system, they often do not present a full picture of bile duct (BD) developmental defects across the whole liver. This is in part due to the robust ability of the mouse liver to drain the bile even in animals with significant impairment in biliary development. Here we present a simple method to calculate the average number of BDs associated with each portal vein (PV) in sections covering all lobes of mutant/transgenic mice. In this method, livers are mounted and sectioned in a stereotypic manner to facilitate comparison among various genotypes and experimental conditions. BDs are identified via light microscopy of cytokeratin-stained cholangiocytes, and then counted and divided by the total number of PVs present in liver section. As an example, we show how this method can clearly distinguish between wild-type mice and a mouse model of Alagille syndrome. The method presented here cannot substitute for techniques that visualize the three-dimensional structure of the biliary tree. However, it offers an easy and direct way to quantitatively assess BD development and the degree of ductular reaction formation in mice.

We present a rather simple and sensitive method for accurate quantification of bile duct density in the mouse liver. This method can aid in determining the effects of genetic and environmental modifiers and the effectiveness of potential therapies in mouse models of biliary diseases.

Bestimmung der Gallengangsdichte in der Mausleber

Mouse is broadly used as a model organism to study biliary diseases. To evaluate the development and function of the biliary system, various techniques ...

Forschung

Entwicklungsbiologie

Metabolic Glycoengineering of Sialic Acid Using N-acyl-modified Mannosamines

Sialic acid (Sia) is a highly important constituent of glycoconjugates, such as N- and O-glycans or glycolipids. Due to its position at the non-reducing termini of oligo- and polysaccharides, as well as its unique chemical characteristics, sialic acid is involved in a multitude of different receptor-ligand interactions. By modifying the expression of sialic acid on the cell surface, sialic acid-dependent interactions will consequently be influenced. This can be helpful to investigate sialic acid-dependent interactions and has the potential to influence certain diseases in a beneficial way. Via metabolic glycoengineering (MGE), the expression of sialic acid on the cell surface can be modulated. Herein, cells, tissues, or even entire animals are treated with C2-modified derivatives of N-acetylmannosamine (ManNAc). These amino sugars act as sialic acid precursor molecules and therefore are metabolized to the corresponding sialic acid species and expressed on glycoconjugates. Applying this method produces intriguing effects on various biological processes. For example, it can drastically reduce&#160;the expression of polysialic acid (polySia) in treated neuronal cells and thus affects neuronal growth and differentiation. Here, we show the chemical synthesis of two of the most common C2-modified N-acylmannosamine derivatives, N-propionylmannosamine (ManNProp) as well as N-butanoylmannosamine (ManNBut), and further show how these non-natural amino sugars can be applied in cell culture experiments. The expression of modified sialic acid species is quantified by high performance liquid chromatography (HPLC) and further analyzed via mass spectrometry. The effects on polysialic acid expression are elucidated via Western blot using a commercially available polysialic acid antibody.

Metabolic Glycoengineering of Sialic Acid Using N-acyl-modified Mannosamines

Sialic acid is a typical monosaccharide-unit found in glycoconjugates. It is involved in a plethora of molecular and cellular interactions. Here we present a method to modify cell surface sialic acid expression using metabolic glycoengineering with N-acetylmannosamine derivatives.

Metabolische Glykan der Sialinsäure Säure mit N-Acyl-Mannosamines geändert

Sialic acid (Sia) is a highly important constituent of glycoconjugates, such as N- and O-glycans or glycolipids. Due to its position at the non-reducing ...

Biotechnik

The bm12 Inducible Model of Systemic Lupus Erythematosus (SLE) in C57BL/6 Mice

Systemic lupus erythematosus (SLE) is an autoimmune disease with diverse clinical and immunological manifestations. Several spontaneous and inducible animal models mirror common components of human disease, including the bm12 transfer model. Upon transfer of bm12 splenocytes or purified CD4 T cells, C57BL/6 mice rapidly develop large frequencies of T follicular helper cells (Tfh), germinal center (GC) B cells, and plasma cells followed by high levels of circulating anti-nuclear antibodies. Since this model utilizes mice on a pure C57BL/6 background, researchers can quickly and easily study disease progression in transgenic or knockout mouse strains in a relatively short period of time. Here we describe protocols for the induction of the model and the quantitation Tfh, GC B cells, and plasma cells by multi-color flow cytometry. Importantly, these protocols can also be used to characterize disease in most mouse models of SLE and identify Tfh, GC B cells, and plasma cells in other disease models.

The bm12 Inducible Model of Systemic Lupus Erythematosus SLE in C57BL/6 Mice

The transfer of bm12 lymphocytes into a C57BL/6 recipient is an established model of systemic lupus erythematosus. Here we describe how to initiate disease using this model and how to characterize T follicular helper cells, germinal center B cells and plasma cells by flow cytometry.

Das BM12 Inducible Modell des systemischen Lupus erythematodes (SLE) in C57BL / 6-Mäuse

Systemic lupus erythematosus (SLE) is an autoimmune disease with diverse clinical and immunological manifestations. Several spontaneous and inducible ...

Medizin

A Method for the Measurement of Salivary Gland Function in Mice

Patients with Sj&#246;gren&#39;s syndrome, an autoimmune disease affecting the exocrine glands, develop salivary gland inflammation and have reduced saliva production. Similarly, saliva production is severely compromised in patients receiving radiation treatment for head and neck cancers. Rodent models, developed to mimic these clinical conditions, facilitate an understanding of the disease pathogenesis and allow for the development of new therapeutic strategies. Therefore, the ability to accurately, reproducibly, and repeatedly measure salivary gland function in animal models is critical. Building on procedures previously described in the literature, a method was developed that meets these criteria and was used to evaluate salivary gland function in mice. An additional advantage of this new method is that it is easily mastered, and has little inter-operator variation. Salivary gland function is evaluated as the amount (weight or volume) or rate (mL/min) of saliva produced in response to pilocarpine stimulation. The collected saliva is a good source for the analyses of protein content, immunoglobulin concentrations, and other biomolecules.

Salivary gland hypofunction is a frequent consequence of autoimmune disease and radiation therapy. Reproducible evaluation of salivary gland function in mouse models of these diseases is a technical challenge. Here, a simple method for accurate and reproducible measurement of saliva production in mice is described.

Eine Methode zur Messung der Speicheldrüse Funktion bei Mäusen

Patients with Sj&#246;gren&#39;s syndrome, an autoimmune disease affecting the exocrine glands, develop salivary gland inflammation and have reduced ...

Immunologie und Infektion

Using a Bacterial Pathogen to Probe for Cellular and Organismic-level Host Responses

There are a variety of strategies bacterial pathogens employ to survive and proliferate once inside the eukaryotic cell. The so-called 'cytosolic' pathogens (Listeria monocytogenes, Shigella flexneri, Burkholderia pseudomallei, Francisella tularensis, and Rickettsia spp.) gain access to the infected cell cytosol by physically and enzymatically degrading the primary vacuolar membrane. Once in the cytosol, these pathogens both proliferate as well as generate sufficient mechanical forces to penetrate the plasma membrane of the host cell in order to infect new cells. Here, we show how this terminal step of the cellular infection cycle of L. monocytogenes (Lm) can be quantified by both colony-forming unit assays and flow cytometry and give examples of how both pathogen- and host-encoded factors impact this process. We also show a close correspondence of Lm infection dynamics of cultured cells infected in vitro and those of hepatic cells derived from mice infected in vivo. These function-based assays are relatively simple and can be readily scaled up for discovery-based high-throughput screens for modulators of eukaryotic cell function.

We describe both in vitro and in vivo infection assays that can be used to analyze the activities of host-encoding factors.

Verwenden eine bakterielle Erreger, Sonde für zelluläre und organismische Ebene Host Antworten

There are a variety of strategies bacterial pathogens employ to survive and proliferate once inside the eukaryotic cell. The so-called 'cytosolic' ...

Using Unfixed, Frozen Tissues to Study Natural Mucin Distribution

Mucins are complex and heavily glycosylated O-linked glycoproteins, which contain more than 70% carbohydrate by weight1-3. Secreted mucins, produced by goblet cells and the gastric mucosa, provide the scaffold for a micrometers-thick mucus layer that lines the epithelia of the gut and respiratory tract3,4. In addition to mucins, mucus layers also contain antimicrobial peptides, cytokines, and immunoglobulins5-9. The mucus layer is an important part of host innate immunity, and forms the first line of defense against invading microorganisms8,10-12. As such, the mucus is subject to numerous interactions with microbes, both pathogens and symbionts, and secreted mucins form an important interface for these interactions. The study of such biological interactions usually involves histological methods for tissue collection and staining. The two most commonly used histological methods for tissue collection and preservation in the clinic and in research laboratories are: formalin fixation followed by paraffin embedding, and tissue freezing, followed by embedding in cryo-protectant media.
Paraffin-embedded tissue samples produce sections with optimal qualities for histological visualization including clarity and well-defined morphology. However, during the paraffin embedding process a number of epitopes become altered and in order to study these epitopes, tissue sections have to be further processed with one of many epitope retrieval methods13. Secreted mucins and lipids are extracted from the tissue during the paraffin-embedding clearing step, which requires prolong incubation with organic solvents (xylene or Citrisolv). Therefore this approach is sub-optimal for studies focusing on the nature and distribution of mucins and mucus in vivo.
In contrast, freezing tissues in Optimal Cutting Temperature (OCT) embedding medium avoids dehydration and clearing of the sample, and maintains the sample hydration. This allows for better preservation of the hydrated mucus layer, and thus permits the study of the numerous roles of mucins in epithelial biology. As this method requires minimal processing of the tissue, the tissue is preserved in a more natural state. Therefore frozen tissues sections do not require any additional processing prior to staining and can be readily analyzed using immunohistochemistry methods.
We demonstrate the preservation of micrometers-thick secreted mucus layer in frozen colon samples. This layer is drastically reduced when the same tissues are embedded in paraffin. We also demonstrate immunofluorescence staining of glycan epitopes presented on mucins using plant lectins. The advantage of this approach is that it does not require the use of special fixatives and allows utilizing frozen tissues that may already be preserved in the laboratory.

Unfixed frozen tissue samples embedded in Optimal Cutting Temperature medium (OCT) can be used to study natural distribution and glycosylation of secreted mucus. In this approach tissue processing is minimal and the natural presentation of glycolipids, mucins and glycan-epitopes is preserved. Tissue sections can be analyzed by immunohistochemistry using fluorescence or chromogenic detection.

Mit Unfixierter, Frozen Tissues Natural Mucin Verteilung Studie

Mucins are complex and heavily glycosylated O-linked glycoproteins, which contain more than 70% carbohydrate by weight1-3. Secreted mucins, produced by ...

Biologie

Induction of Drug-Induced, Autoimmune Hepatitis in BALB/c Mice for the Study of Its Pathogenic Mechanisms

Drug-induced autoimmune hepatitis (DIH) is the most common hepatic drug-induced hypersensitization process observed in approximately 9 to 12% of patients with autoimmune hepatitis. The overwhelming majority of patients with DIH are women. The underlying mechanisms of these sex differences in prevalence are unclear because of the paucity of animal models that mimic human disease. Even so, underlying mechanisms are widely believed to be associated with human leukocyte antigen haplotypes and sex hormones. In contrast, using a DIH mouse model, we have uncovered that IL-4 initiated&#160;CD4+ T cells directed against an epitope of cytochrome P450 2E1 induces influx of neutrophils, macrophages and mast cells into the livers of female BALB/c mice. Using this model, we have also shown that IL-33-induced FoxP3+regulatory T cells confer protection against DIH in female and male mice. This DIH model is induced by immunizing mice with an epitope of CYP2E1 that has been covalently altered with a drug metabolite that has been associated with DIH. This epitope is recognized by patients with DIH. Our method induces robust and reproducible hepatitis and autoantibodies that can be utilized to study the pathogenesis of DIH. While in vivo studies can cause undue pain and distress in mice when done improperly, the advantage of an in vivo model is the ability to evaluate the pathogenesis of disease in a large number of mice. Additionally, biological effects of the altered liver proteins can be studied using invasive procedures. The addition of in vitro studies to the experimental design allows rapid repetition and mechanistic analysis at a cellular level. Thus, we will demonstrate our model protocol and how it can be utilized to study in vivo and in vitro mechanisms of DIH.

We describe an in vivo immunization, translational hepatitis model in BALB/c mice that can be utilized to study the pathogenesis of drug-induced autoimmune hepatitis including sex differences seen in this disease. We will describe how this model demonstrates reproducible analyses using in vivo and in vitro experimental techniques.

Induktion der medikamenteninduzierten Autoimmunhepatitis bei BALB/c-Mäusen zur Untersuchung ihrer pathogenen Mechanismen

Drug-induced autoimmune hepatitis (DIH) is the most common hepatic drug-induced hypersensitization process observed in approximately 9 to 12% of patients ...

Inducing Meningococcal Meningitis Serogroup C in Mice via Intracisternal Delivery

Neisseria meningitidis (meningococcus) is a narrow-host-range microorganism, globally recognized as the leading cause of bacterial meningitis. Meningococcus is a transient colonizer of human nasopharynx of approximately 10% of healthy subject. In particular circumstances, it acquires an invasive ability to penetrate the mucosal barrier and invades the bloodstream causing septicaemia. In the latest case, fulminating sepsis could arise even without the consequent development of meningitis. Conversely, bacteria could poorly multiply in the bloodstream, cross the blood brain barrier, reach the central nervous system, leading to fulminant meningitis. The murine models of bacterial meningitis represent a useful tool to investigate the host-pathogen interactions and to analyze the pathogenetic mechanisms responsible for this lethal disease. Although, several experimental model systems have been evaluated over the last decades, none of these were able to reproduce the characteristic pathological events of meningococcal disease. In this experimental protocol, we describe a detailed procedure for the induction of meningococcal meningitis in a mouse model based on the intracisternal inoculation of bacteria. The peculiar signs of human meningitis were recorded in the murine host through the assessment of clinical parameters (e.g., temperature, body weight), evaluation of survival rate, microbiological analysis and histological examination of brain injury. When using intracisternal (i.cist.) inoculum, meningococci complete delivery directly into cisterna magna, leading to a very efficient meningococcal replication in the brain tissue. A 1,000-fold increase of viable count of bacteria is observed in about 18 h. Moreover, meningococci are also found in the spleen, and liver of infected mice, suggesting that the liver may represent a target organ for meningococcal replication.

Here, we describe a method to induce meningococcal meningitis through an intracisternal route of infection in adult mice. We present a step by step protocol of meningococcal infection from the preparation of inoculum to the intracisternal infection; then record the animal survival and evaluate the bacterial loads in murine tissues.

Induzieren von Meningokokken-Meningitis Serogroup C bei Mäusen über Intracisternal Delivery

Neisseria meningitidis (meningococcus) is a narrow-host-range microorganism, globally recognized as the leading cause of bacterial meningitis. ...

Indirect Immunofluorescence on Frozen Sections of Mouse Mammary Gland

Indirect immunofluorescence is used to detect and locate proteins of interest in a tissue. The protocol presented here describes a complete and simple method for the immune detection of proteins, the mouse lactating mammary gland being taken as an example. A protocol for the preparation of the tissue samples, especially concerning the dissection of mouse mammary gland, tissue fixation and frozen tissue sectioning, are detailed. A standard protocol to perform indirect immunofluorescence, including an optional antigen retrieval step, is also presented. The observation of the labeled tissue sections as well as image acquisition and post-treatments are also stated. This procedure gives a full overview, from the collection of animal tissue to the cellular localization of a protein. Although this general method can be applied to other tissue samples, it should be adapted to each tissue/primary antibody couple studied.

The indirect immunofluorescence protocol described in this article allows the detection and the localization of proteins in the mouse mammary gland. A complete method is given to prepare mammary gland samples, to perform immunohistochemistry, to image the tissue sections by fluorescence microscopy, and to reconstruct images.

Die indirekte Immunfluoreszenz auf Gefrierschnitte von Mäusemilchdrüse

Indirect immunofluorescence is used to detect and locate proteins of interest in a tissue. The protocol presented here describes a complete and simple ...

<meta charset="utf8"></head><body>Optimierte Ein-Personen-Methode zur Milchentnahme in Laktationsstudien an Mäusen

An Efficient Single-Person Technique for Milk Sampling from Laboratory Mice

Rodent models have been widely used in biology since the early 20th century to study basic physiology and biochemical mechanisms. In lactation and neonatal development research, there is a need to sample milk to determine the composition and how milk may be affected by experimental manipulations, thereby impacting newborn development. Collecting biofluids in sufficient amounts from small rodents can be difficult. Several studies have demonstrated different techniques to obtain milk from mice. However, these techniques often require at least two trained personnel, which may be challenging in some cases.&#160;
Here, we demonstrate a modified milk sampling technique based on a method published in 2009. With this affordable and easy-to-assemble method, one trained person can routinely obtain 0.1&#8211;0.5 mL of milk from a dam under anesthesia in less than 10 min. Using this method, we collected sufficient milk on post-delivery day 2 (PD2) and post-delivery day 10 (PD10). We measured milk macronutrient components and compared them with the existing literature to validate our collection method.&#160;
We recorded that on PD2, milk protein averaged at 70.1 &#177; 5.2 g/L, milk fat was 174.4 &#177; 7.1 g/L, and milk lactose was 12.3 &#177; 0.6 g/L. On PD10, while milk lactose and protein remained at similar concentrations as on PD2, milk fat was significantly higher (224.4 &#177; 17.1 g/L). We also observed that the relative abundance of individual milk proteins varied between PD2 and PD10. More specifically, &#945;S1-casein and whey acidic protein were higher, while &#946;-casein was lower at PD10 compared with PD2. Overall, we demonstrate an efficient single-person technique for milk sampling from mice using a device that can easily be assembled with commonly used laboratory equipment.

<meta charset="utf8"></head><body>Eine effiziente Ein-Personen-Technik für die Milchprobenahme von Labormäusen

This article describes how to assemble a device that can be used to collect milk from laboratory mice. This device is affordable, portable, and allows a collection of 0.1&#8211;0.5 mL of milk by one trained person. A detailed milking protocol is also included.&#160;

Bestimmung von Sialinsäuren in Leber- und Milchproben von Wildtyp und

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video