Wir danken dem Meningitis Trust und dem MRC für die Finanzierung dieser Arbeit.

1. Erzeugung des mutierenden Amplikons mittels SOE-PCR23 und Amplifikation der Spectinomycin-Kassette
<ol><li>Beginnen Sie mit der Durchführung einer PCR zur Amplifikation der Homologiearme (Ply 5' (488 bp) bzw. Ply3' (715 bp)) der flankierenden Regionen des Ply-Gens aus dem Stamm 519/43. Verwenden Sie die Primer plyFw1_NOTI (TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG), ply5'R1_BamHI (CGAAATATAGACCAAAGGACGC GGATCC AGAACCAAACTTGACCTTGA), ply3'F1_BamHI (TCAAGGTCAAGTTTGGTTCTCTGGATCC GCGTCCTTTGGTCTATATTTCG) und plyRv2_NotI (TTTGCGGCCGCCATTTTCTCTCTTATCCTCTACC).</li>
	<li>Verwenden Sie die folgenden PCR-Bedingungen für Schicht5': Denaturierung bei 94 °C für 60 s, Schritt 2: Denaturierung bei 94 °C für 30 s, Schritt 3: Glühen bei 58 °C für 30 s, Schritt 4: Verlängerung bei 72 °C für 30 s, Schritt 5: Zurück zu Schritt 2 und Wiederholung für 35 Zyklen, Schritt 6: endgültige Verlängerung bei 72 °C für 30 s.<ol><li>Verwenden Sie die gleichen PCR-Bedingungen für ply3' mit Ausnahme der Verlängerungszeit in Schritt 4 und Schritt 6, wo sie 60 s betragen sollte.</li>
	</ol></li>
	<li>Analysieren Sie die PCR-Produkte durch Gelelektrophorese und entfernen Sie das Amplikon aus dem Gel.</li>
	<li>Reinigen Sie die PCR-Amplikons gemäß dem Protokoll, das in den Anweisungen des Herstellers (Materialtabelle) beschrieben ist.</li>
	<li>Verwenden Sie äquimolare Mengen beider Homologiearme als Vorlagen in der SOE-PCR. Verschmelzen Sie die beiden Amplikons mit den Primern plyFw1_ NOTI (TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG) und plyRv2_NotI (TTTGCGGCCGCCATTTTCTCTCTCTTATCCTCTACC).</li>
	<li>Verwenden Sie die folgenden SOE-PCR-Bedingungen (Schritt 1: Denaturierung bei 94 °C für 2 min, Schritt 2: Denaturierung bei 94 °C für 30 s, Schritt 3: Glühen bei 58 °C für 30 s, Schritt 4: Verlängerung bei 68 °C für 60 s, Schritt 5: Zurück zu Schritt 2 und Wiederholung für 25 Zyklen, Schritt 6: endgültige Verlängerung bei 68 °C für 90 s).</li>
	<li>Analysieren Sie das SOE-PCR-Produkt durch Gelelektrophorese. Entfernen Sie es mit einem Gel-Extraktionskit aus dem Gel und befolgen Sie die Anweisungen.</li>
	<li>Amplifizieren Sie die Spectinomycin-Kassette aus dem Plasmid pR412 unter den folgenden PCR-Bedingungen: Schritt 1: Denaturierung bei 94 °C für 60 s, Schritt 2: Denaturierung bei 94 °C für 30 s, Schritt 3: Glühen bei 55 °C für 30 s, Schritt 4: Verlängerung bei 68 °C für 60 s, Schritt 5: Gehen Sie zurück zu Schritt 2 und wiederholen Sie den Vorgang für 25 Zyklen, Schritt 6: Endverlängerung bei 68 °C für 60 s.<ol><li>Verwenden Sie die Primer BamHI_SP2F2 (GGATCC, CTA, GAA, CTA, GTG, GAT, CCC, CC) und BamHI_SP2R2 (GGATCC, AA, TCT, TCT, GCA, GAT, TTT, AC, ATG, ATC, ATC). Das Plasmid pR412 wurde von Dr. Marc PrudHomme (CNRS-Université Paul Sabatier, Toulouse, Frankreich) erworben.</li>
	</ol></li>
	<li>Analysieren Sie die PCR-Amplikons durch Gelelektrophorese. Das resultierende PCR-Amplikon wird wie oben beschrieben entfernt und gereinigt.</li>
</ol>2. Erzeugung des Plasmids pSD1 und chemische Umwandlung von E. coli Dh5α
<ol><li>Führen Sie eine Ligatur gemäß den Herstellerangaben des pGEMT-easy system I (Materialtabelle) durch. In einem Mikrozentrifugenröhrchen werden 5 μl 2x Ligationspuffer, 1 μl pGEMTeasy, 2 μl des ply_SOE Produkts, 1 μl T4-DNA-Ligase und Wasser zu einem Gesamtvolumen von 20 μl gegeben. Über Nacht bei 4 °C inkubieren. Dadurch entsteht das Plasmid pSD1.</li>
	<li>Transformieren Sie chemisch kompetente E. coli Dh5α mit pSD1. Beginnen Sie mit der Inkubation von 50 μl chemisch kompetentem E. coli Dh5α mit 3 μl pSD1-Ligationsreaktion für 15 Minuten auf Eis. Anschließend werden die Zellen einem thermischen Schock (42 °C, 30 s) ausgesetzt. Legen Sie die Zellen für 2 Minuten auf Eis.</li>
	<li>Entfernen Sie die Zellen aus dem Eis und fügen Sie 350 μl S.O.C.-Medien hinzu. Inkubation der Kultur für 2 h bei 37 °C, 120 U/min.</li>
	<li>Platte der Transformation auf Luria Bertani Agar (LBA) ergänzt mit 0,4 mM IPTG, 0,24 mg/ml X-Gal für die Blau/Weiß-Selektion und 100 μg/ml Ampicillin, um sicherzustellen, dass alle in der Platte wachsenden Kolonien das Plasmid-Rückgrat haben. Weiße Kolonien enthalten pSD1.</li>
	<li>Wählen Sie drei weiße Kolonien und richten Sie über Nacht ein Wachstum in 10 ml LB ein, ergänzt mit 100 μg/ml Ampicillin. Die Kulturen werden über Nacht bei 37 °C unter Schütteln inkubiert.</li>
	<li>Am nächsten Tag zentrifugieren Sie die Kulturen bei 3.082 x g und verwenden Sie das Pellet zur Plasmidextraktion.</li>
</ol>3. Plasmid-DNA-Extraktion, Restriktionsverdau von pSD1 und Spectinomycin-Gen und Assemblierung von pSD2
<ol><li>Extrahieren Sie die Plasmid-DNA gemäß den Anweisungen, die mit dem kommerziellen Kit geliefert werden (Materialtabelle).</li>
	<li>Richten Sie einen BamHI-Restriktionsaufschluss sowohl für das pSD1-Plasmid als auch für die zuvor amplifizierte und gereinigte Spectinomycin-Kassette ein. Verwenden Sie die folgenden Bedingungen und Mengen, die in Tabelle 1 beschrieben sind.</li>
	<li>Inkubation der Restriktionsaufschlussreaktionen und Kontrollen bei 37 °C für 3 h.</li>
	<li>Analysieren Sie den Restriktionsaufschluss durch Elektrophorese, entfernen Sie die Bande und reinigen Sie sie gemäß den Anweisungen, die mit dem handelsüblichen Kit geliefert werden (Materialtabelle).</li>
	<li>Als nächstes bereiten Sie eine Ligationsreaktion gemäß den Anweisungen des Herstellers (Materialtabelle) unter Verwendung des BamHI-verdauten pSD1 und Spectinomycin (aus Schritt 3.2) vor. In einem Mikrozentrifugenröhrchen die folgenden Reaktionskomponenten zugeben: 5 μl 2x Ligationspuffer, 2 μL pSD1, 2 μl Spectinomycin-Kassette, 1 μl T4-DNA-Ligase und über Nacht bei 4 °C inkubieren. Dadurch entsteht das Plasmid pSD2.</li>
	<li>Umwandlung des Plasmids pSD2 in chemisch kompetentes E. coli Dh5α, wie in Schritt 2.2 beschrieben.</li>
	<li>Wählen Sie die Transformanten, die das Plasmid pSD2 tragen, basierend auf ihrer Fähigkeit aus, in LBA zu wachsen, das mit 100 μg/ml Spectinomycin und Ampicillin ergänzt wird.</li>
	<li>Führen Sie eine Plasmid-DNA-Extraktion (pSD2) wie oben beschrieben und gemäß den Anweisungen des Herstellers (μl) durch.</li>
</ol>4. Transformation des Stammes 519/43 von S. pneumoniae
<ol><li>Bereiten Sie eine Nachtkultur von S. pneumoniae 519/43 in BHI vor und lassen Sie sie bei 37 °C, 5% CO2 statisch wachsen.</li>
	<li>Am nächsten Tag werden die Kulturen 1:50 und 1:100 in 10 ml frischer BHI-Brühe verdünnt. Inkubieren Sie die Kulturen statisch bei 37 °C, bis der OD595 nm zwischen 0,05 und 0,1 liegt (optimale DNA-Erfassung näher an 0,1 OD).</li>
	<li>Sobald ein OD von 0,1 erreicht ist, nehmen Sie 860 μl und füllen Sie es in ein Mikrozentrifugenröhrchen um. In dasselbe Mikrozentrifugenröhrchen geben Sie: 100 μl 100 mM NaOH, 10 μl 20% (w/v) BSA, 10 μl 100 mM CaCl 2,2 μl 50 ng/ml CSP124 und 500 ng pSD2.</li>
	<li>Die Reaktion wird statisch bei 37 °C für 3 h inkubiert.</li>
	<li>Platte 330 μl auf 5% Blutagarplatten (BA), ergänzt mit 100 μg/ml Spectinomycin, stündlich über die 3 Inkubationsstunden.</li>
	<li>Inkubation der Platten über Nacht bei 37 °C, 5% CO2. Patchen Sie Spectinomycin-resistente Kolonien auf eine andere BA-Platte, die mit 100 μg/ml Spectinomycin ergänzt wurde, sowie auf BA-Platten, die mit 100 μg/ml Ampicillin ergänzt wurden. Inkubieren Sie beide Plattensätze über Nacht unter den oben genannten Bedingungen. Die Ampicillinplatten sollen auf das Vorhandensein des Plasmidrückgrats getestet werden.</li>
	<li>Bestätigen Sie das Vorhandensein der Spectinomycin-Kassette durch PCR unter Verwendung der Primer plyFw1_ NOTI (TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG) und SPEC_REV (TAATTCCTCTAAGTCATAATTTCCG). Bestätigen Sie die Mutation durch PCR mit den Primern plySCN1 (CCAATGGAAATCGCTAGGCAAGAGATAA) und plySCN2 (ATTACTTAGTCCAACCACCCTGAT), die außerhalb der mutierten Region anhaften.</li>
	<li>Bestätigen Sie die Integration an der richtigen Stelle des Genoms durch Sequenzierung mit den Primern plySCN1 (CCAATGGAAATCGCTAGGCAAGAGATAA), plySCN2 (ATTACTTAGTCCAACCACGGCTGAT) sowie Primern mit ihrer Bindungsstelle in der Spectinomycin-Kassette sqr1 (CCTGATCCAAACATGTAAGTACCACC), sqf2 (CGTAGTTATCTTGGAGAGAATA) spec_sqf1 (GGTACTTACATGTTTGGATCAGG) und spec_sqr2 TATTCTCTCCAAGATAACTACG.</li>
</ol>

<ol>
	<li>Bentley, S. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+Analysis+of+the+Capsular+Biosynthetic+Locus+from+All+90+Pneumococcal+Serotypes.">Genetic Analysis of the Capsular Biosynthetic Locus from All 90 Pneumococcal Serotypes.</a> PLoS Genetics. 2 (3), 31 (2006).</li><li>Calix, J. J., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+pneumococcal+serotype,+11E,+has+a+variably+inactivated+wcjE+gene.">A new pneumococcal serotype, 11E, has a variably inactivated wcjE gene.</a> The Journal of Infectious Diseases. 202 (1), 29-38 (2010).</li><li>Park, I. H., Pritchard, D. G., Cartee, R., Brandao, A., Brandileone, M. C. C., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+a+New+Capsular+Serotype+(6C)+within+Serogroup+6+of+Streptococcus+pneumoniae.">Discovery of a New Capsular Serotype (6C) within Serogroup 6 of Streptococcus pneumoniae.</a> Journal of Clinical Microbiology. 45 (4), 1225-1233 (2007).</li><li>Jin, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=First+Report+of+Putative+Streptococcus+pneumoniae+Serotype+6D+among+Nasopharyngeal+Isolates+from+Fijian+Children.">First Report of Putative Streptococcus pneumoniae Serotype 6D among Nasopharyngeal Isolates from Fijian Children.</a> The Journal of Infectious Diseases. 200 (9), 1375-1380 (2009).</li><li>Oliver, M. B., vander Linden, M. P. G., K&#252;ntzel, S. A., Saad, J. S., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+Streptococcus+pneumoniae+Serotype+6+Variants+with+Glycosyltransferases+Synthesizing+Two+Differing+Repeating+Units.">Discovery of Streptococcus pneumoniae Serotype 6 Variants with Glycosyltransferases Synthesizing Two Differing Repeating Units.</a> Journal of Biological Chemistry. 288 (36), 25976-25985 (2013).</li><li>Calix, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serological+Characterization+of+Two+Capsule+Subtypes+among+Streptococcus+pneumoniae+Serotype+20+Strains.">Serological Characterization of Two Capsule Subtypes among Streptococcus pneumoniae Serotype 20 Strains.</a> Journal of Biological Chemistry. 287 (33), 27885-27894 (2012).</li><li>Park, I. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=and+Serological+Characterization+of+a+New+Pneumococcal+Serotype,+6H,+and+Generation+of+a+Pneumococcal+Strain+Producing+Three+Different+Capsular+Repeat+Units.">and Serological Characterization of a New Pneumococcal Serotype, 6H, and Generation of a Pneumococcal Strain Producing Three Different Capsular Repeat Units.</a> Clinical and Vaccine Immunology. 22 (3), 313-318 (2015).</li><li>O'Brien, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Burden+of+disease+caused+by+Streptococcus+pneumoniae+in+children+younger+than+5+years:+global+estimates.">Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates.</a> The Lancet. 374 (9693), 893-902 (2009).</li><li>Henriques-Normark, B., Tuomanen, E. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Pneumococcus:+Epidemiology,+Microbiology,+and+Pathogenesis.">The Pneumococcus: Epidemiology, Microbiology, and Pathogenesis.</a> Cold Spring Harbor Perspectives in Medicine. 3 (7), 010215 (2013).</li><li>Leimkugel, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Outbreak+of+Serotype+1+Streptococcus+pneumoniae+Meningitis+in+Northern+Ghana+with+Features+That+Are+Characteristic+of+Neisseria+meningitidis+Meningitis+Epidemics.">An Outbreak of Serotype 1 Streptococcus pneumoniae Meningitis in Northern Ghana with Features That Are Characteristic of Neisseria meningitidis Meningitis Epidemics.</a> The Journal of Infectious Diseases. 192 (2), 192-199 (2005).</li><li>Yaro, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epidemiological+and+Molecular+Characteristics+of+a+Highly+Lethal+Pneumococcal+Meningitis+Epidemic+in+Burkina+Faso.">Epidemiological and Molecular Characteristics of a Highly Lethal Pneumococcal Meningitis Epidemic in Burkina Faso.</a> Clinical Infectious Diseases. 43 (6), 693-700 (2006).</li><li>Antonio, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+epidemiology+of+pneumococci+obtained+from+Gambian+children+aged+2-29+months+with+invasive+pneumococcal+disease+during+a+trial+of+a+9-valent+pneumococcal+conjugate+vaccine.">Molecular epidemiology of pneumococci obtained from Gambian children aged 2-29 months with invasive pneumococcal disease during a trial of a 9-valent pneumococcal conjugate vaccine.</a> BMC Infectious Diseases. 8 (1), 81 (2008).</li><li>Kwambana-Adams, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+outbreak+of+pneumococcal+meningitis+among+older+children+(&#8805;5+years)+and+adults+after+the+implementation+of+an+infant+vaccination+programme+with+the+13-valent+pneumococcal+conjugate+vaccine+in+Ghana.">An outbreak of pneumococcal meningitis among older children (&#8805;5 years) and adults after the implementation of an infant vaccination programme with the 13-valent pneumococcal conjugate vaccine in Ghana.</a> BMC Infectious Diseases. 16 (1), 575 (2016).</li><li>Antonio, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Seasonality+and+outbreak+of+a+predominant+Streptococcus+pneumoniae+serotype+1+clone+from+The+Gambia:+Expansion+of+ST217+hypervirulent+clonal+complex+in+West+Africa.">Seasonality and outbreak of a predominant Streptococcus pneumoniae serotype 1 clone from The Gambia: Expansion of ST217 hypervirulent clonal complex in West Africa.</a> BMC Microbiology. 8 (1), 198 (2008).</li><li>Staples, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterization+of+an+Australian+serotype+1+Streptococcus+pneumoniae+outbreak.">Molecular characterization of an Australian serotype 1 Streptococcus pneumoniae outbreak.</a> Epidemiology and Infection. 143 (2), 325-333 (2015).</li><li>Gessner, B. D., Mueller, J. E., Yaro, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=African+meningitis+belt+pneumococcal+disease+epidemiology+indicates+a+need+for+an+effective+serotype+1+containing+vaccine,+including+for+older+children+and+adults.">African meningitis belt pneumococcal disease epidemiology indicates a need for an effective serotype 1 containing vaccine, including for older children and adults.</a> BMC Infectious Diseases. 10 (1), 22 (2010).</li><li>Hill, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nasopharyngeal+carriage+of+Streptococcus+pneumoniae+in+Gambian+infants:+a+longitudinal+study.">Nasopharyngeal carriage of Streptococcus pneumoniae in Gambian infants: a longitudinal study.</a> Clinical Infectious Diseases. 46 (6), 807-814 (2008).</li><li>Ebruke, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temporal+changes+in+nasopharyngeal+carriage+of+Streptococcus+pneumoniae+serotype+1+genotypes+in+healthy+Gambians+before+and+after+the+7-valent+pneumococcal+conjugate+vaccine.">Temporal changes in nasopharyngeal carriage of Streptococcus pneumoniae serotype 1 genotypes in healthy Gambians before and after the 7-valent pneumococcal conjugate vaccine.</a> PeerJ. 3, 90 (2015).</li><li>Adegbola, R. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype+and+antimicrobial+susceptibility+patterns+of+isolates+of+Streptococcus+pneumoniae+causing+invasive+disease+in+The+Gambia+1996-2003.">Serotype and antimicrobial susceptibility patterns of isolates of Streptococcus pneumoniae causing invasive disease in The Gambia 1996-2003.</a> Tropical Medicine and International Health. 11 (7), 1128-1135 (2006).</li><li>Marks, L. R., Reddinger, R. M., Hakansson, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+Levels+of+Genetic+Recombination+during+Nasopharyngeal+Carriage+and+Biofilm+Formation+in+Streptococcus+pneumoniae.">High Levels of Genetic Recombination during Nasopharyngeal Carriage and Biofilm Formation in Streptococcus pneumoniae.</a> mBio. 3 (5), (2012).</li><li>Ritchie, N. D., Mitchell, T. J., Evans, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+is+different+about+serotype+1+pneumococci.">What is different about serotype 1 pneumococci.</a> Future Microbiology. 7 (1), 33-46 (2012).</li><li>Harvey, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+variable+region+of+pneumococcal+pathogenicity+island+1+is+responsible+for+unusually+high+virulence+of+a+serotype+1+isolate.">The variable region of pneumococcal pathogenicity island 1 is responsible for unusually high virulence of a serotype 1 isolate.</a> Infection and Immunity. 84 (3), 822-832 (2016).</li><li>Horton, R. M., Cai, Z. L., Ho, S. N., Pease, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+splicing+by+overlap+extension:+tailor-made+genes+using+the+polymerase+chain+reaction.">Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction.</a> BioTechniques. 8 (5), 528-535 (1990).</li><li>Alioing, G., Granadel, C., Morrison, D. A., Claverys, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Competence+pheromone,+oligopeptide+permease,+and+induction+of+competence+in+Streptococcus+pneumoniae.">Competence pheromone, oligopeptide permease, and induction of competence in Streptococcus pneumoniae.</a> Molecular Microbiology. 21 (3), 471-478 (1996).</li><li>Lund, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Enumeration and description of the strains belonging to the State Serum Institute, Copenhagen Denmark. , (1951).</li><li>Barany, F., Tomasz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+Streptococcus+pneumoniae+by+heterologous+plasmid+deoxyribonucleic+acid.">Genetic transformation of Streptococcus pneumoniae by heterologous plasmid deoxyribonucleic acid.</a> Journal of Bacteriology. 144 (2), 698-709 (1980).</li><li>Terra, V. S., Homer, K. A., Rao, S. G., Andrew, P. W., Yesilkaya, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+novel+&#946;-galactosidase+activity+that+contributes+to+glycoprotein+degradation+and+virulence+in+Streptococcus+pneumoniae.">Characterization of novel &#946;-galactosidase activity that contributes to glycoprotein degradation and virulence in Streptococcus pneumoniae.</a> Infection and Immunity. 78 (1), (2010).</li><li>Terra, V. S., Zhi, X., Kahya, H. F., Andrew, P. W., Yesilkaya, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pneumococcal+6-phospho-&#946;-glucosidase+(BglA3)+is+involved+in+virulence+and+nutrient+metabolism.">Pneumococcal 6-phospho-&#946;-glucosidase (BglA3) is involved in virulence and nutrient metabolism.</a> Infection and Immunity. 84 (1), (2015).</li><li>Harvey, R. M., Ogunniyi, A. D., Chen, A. Y., Paton, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pneumolysin+with+Low+Hemolytic+Activity+Confers+an+Early+Growth+Advantage+to+Streptococcus+pneumoniae+in+the+Blood.">Pneumolysin with Low Hemolytic Activity Confers an Early Growth Advantage to Streptococcus pneumoniae in the Blood.</a> Infection and Immunity. 79 (10), 4122 (2011).</li><li>Terra, V. S., Plumptre, C. D., Wall, E. C., Brown, J. S., Wren, B. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+a+pneumolysin+deficient+mutant+in+Streptococcus+pneumoniae+serotype+1+strain+519/43+and+phenotypic+characterisation.">Construction of a pneumolysin deficient mutant in Streptococcus pneumoniae serotype 1 strain 519/43 and phenotypic characterisation.</a> Microbial Pathogenesis. 141, 103999 (2020).</li></ol>

Die Autoren haben nichts zu offenbaren.

Streptococcus pneumoniae, insbesondere Serotyp 1, ist nach wie vor eine globale Bedrohung, die invasive Pneumokokkenerkrankungen und Meningitis verursacht. Trotz der Einführung verschiedener Impfstoffe, die vor Serotyp 1 schützen sollten, ist dieser Serotyp in Afrika immer noch in der Lage, Ausbrüche zu verursachen, die zu einer hohen Morbidität und Mortalität führen13. Die Fähigkeit, diesen Serotyp genetisch zu manipulieren, ist aufgrund seiner klinischen Relevanz von entscheidend...

Streptococcus pneumoniae (S. pneumoniae, der Pneumokokkus) ist weltweit eine der Hauptursachen für Morbidität und Mortalität. Bis vor kurzem wurden fast 100 Serotypen von S. pneumoniae entdeckt 1,2,3,4,5,6,7. Jährlich sterben rund 700.000 Kinder unter 5 Jahrenan der invasiven Pneumokokkenerkrankung (IPD) 8. S. pneumoniae ist weltweit die Hauptursache für bakterielle Pneumonie, Mittelohrentzündung, Meningitis und Septikämie9.
Im afrikanischen Meningitis-Gürtel ist Serotyp 1 für Meningitis-Ausbrüche verantwortlich, bei denen der Sequenztyp (ST) ST217, ein extrem virulenter Sequenztyp, 10,11,12,13,14,15 dominant ist. Seine Bedeutung in der Meningitis-Pathologie wurde mit der von Neisseria meningitidis im afrikanischen Meningitis-Gürtelverglichen 16. Serotyp 1 ist oft die Hauptursache für IPD; Es ist jedoch sehr selten in der Kutsche zu finden. Tatsächlich ist dieser Serotyp in Gambia für 20% aller invasiven Erkrankungen verantwortlich, wurde jedoch nur bei 0,5% der gesunden Träger gefunden14,17,18,19. Genetischer Austausch und Rekombination in kompetenten Pneumokokken erfolgt im Allgemeinen eher bei der Beförderung als bei invasiven Erkrankungen20. Darüber hinaus wurde gezeigt, dass Serotyp 1 eine der kürzesten Trageraten aufweist, die bei Pneumokokken beschrieben wurden (nur 9 Tage). Daher wurde vorgeschlagen, dass dieser Serotyp eine viel niedrigere Rekombinationsrate aufweisen könnte als andere21.
Eingehende Studien sind notwendig, um den Grund für die niedrige Beförderungsrate von Serotyp-1-Stämmen und ihre Bedeutung für invasive Erkrankungen in Afrika südlich der Sahara zu verstehen.
Hier berichten wir über ein Protokoll, das eine genomweite Mutagenese eines bestimmten Serotyp-1-Stammes ermöglicht, 519/43. Dieser Stamm kann leicht neue DNA erwerben und in sein Genom rekombinieren. Diese Methode ist noch nicht übergreifend, aber sie ist sehr effizient, wenn sie im 519/43-Hintergrund durchgeführt wird (andere Ziele wurden mutiert, Manuskripte sind in Vorbereitung). Durch die einfache Verwendung des 519/43-Stammes und die Nutzung seiner natürlichen Kompetenz sowie die Substitution der Art und Weise, wie die exogene DNA bereitgestellt wird, konnten wir das Pneumolysin-Gen (ply) in diesem Serotyp-1-Stamm mutieren. Diese Methode stellt eine Verbesserung gegenüber der von Harvey et al.22 vorgestellten Methode dar, da sie in einem Schritt durchgeführt wird, ohne dass die DNA durch einen anderen Serotyp geleitet werden muss. Nichtsdestotrotz und aufgrund der Variabilität zwischen den Stämmen wurde keine Methode für alle Stämme standardisiert. Die Fähigkeit, bestimmte Gene zu mutieren und ihre Auswirkungen zu beobachten, wird ein tiefgreifendes Verständnis der Serotyp 1 S. pneumoniae-Stämme ermöglichen und Antworten auf die Rolle dieser Stämme bei Meningitis in Afrika südlich der Sahara liefern.

<table><tbody><tr><td>AccuPrime &lt;em&gt;Pfx&lt;/em&gt; DNA polymerase</td><td>Invitrogen</td><td>12344024</td><td>Used for amplification of the fragments</td></tr><tr><td>Ampicillin sodium salt</td><td>Sigma Aldrich</td><td>A9518</td><td>Used for bacterial selection on stage 1(pSD1)</td></tr><tr><td>Blood Agar Base</td><td>Oxoid</td><td>CM0055</td><td>Used to plate &lt;em&gt;S. pneumoniae&lt;/em&gt; transformants</td></tr><tr><td>Bovine Serum Albumine</td><td>sigma</td><td>55470</td><td>used for &lt;em&gt;S. pneumoniae&lt;/em&gt; Transformation</td></tr><tr><td>Brain Heart Infusion</td><td>Oxoid</td><td>CM1135</td><td>used to grow &lt;em&gt;S. pneumoniae&lt;/em&gt; cells</td></tr><tr><td>Calcium Chloride Cacl&lt;sub&gt;2&lt;/sub&gt;</td><td>Sigma</td><td>449709</td><td>used for &lt;em&gt;S. pneumoniae&lt;/em&gt; Transformation</td></tr><tr><td>Competence stimulating peptide 1</td><td>AnaSpec</td><td>AS-63779</td><td>used for &lt;em&gt;S. pneumoniae&lt;/em&gt; Transformation</td></tr><tr><td>Luria Broth Agar</td><td>Gibco</td><td>22700025</td><td>used for plating and selection of pSD1 and pSD2</td></tr><tr><td>Luria Broth Base (Miller&#039;s formulation)</td><td>Gibco</td><td>12795027</td><td>used for plating and selection of pSD1 and pSD2</td></tr><tr><td>Monarch Gel Extraction Kit</td><td>NEB</td><td>T1020S</td><td>Used to extract the bands from the DNA gel</td></tr><tr><td>Monarch Plasmid Miniprep Kit</td><td>NEB</td><td>T1010S</td><td>Used to extract plasmid from the cells</td></tr><tr><td>pGEM T-easy</td><td>Promega</td><td>A1360</td><td>used as suicide plasmid</td></tr><tr><td>S.O.C.</td><td>Invitrogen</td><td>15544034</td><td>used for recovery of cells after transformation</td></tr><tr><td>Sodium Hydroxide (NaOH)</td><td>Sigma</td><td>S0899</td><td>used for &lt;em&gt;S.pneumoniae&lt;/em&gt; Transformation</td></tr><tr><td>Spectinomycin Hydrochloride</td><td>SigmaAldrich</td><td>PHR1426</td><td>Used for bacterial selection</td></tr><tr><td>Subcloning Efficiency DH5&amp;alpha; Competent Cells</td><td>Invitrogen</td><td>18265017</td><td>used for the creation of pSD1 and pSD2</td></tr></tbody></table>

constructing mutants in serotype 1 streptococcus pneumoniae strain 519/43

Streptococcus pneumoniae Serotyp 1 ist nach wie vor ein großes Problem in Ländern mit niedrigem und mittlerem Einkommen, insbesondere in Afrika südlich der Sahara. Trotz seiner Bedeutung wurden Studien zu diesem Serotyp durch den Mangel an genetischen Werkzeugen behindert, um ihn zu modifizieren. In dieser Studie beschreiben wir eine Methode zur genetischen Modifikation eines klinischen Serotyp-1-Isolats (Stamm 519/43). Interessanterweise wurde dies erreicht, indem die Fähigkeit der Pneumokokken ausgenutzt wurde, DNA auf natürliche Weise zu erwerben. Im Gegensatz zu den meisten Pneumokokken war die Verwendung von linearer DNA jedoch nicht erfolgreich; Um diesen wichtigen Stamm zu mutieren, musste ein Selbstmord-Plasmid verwendet werden. Diese Methodik hat die Mittel für ein tieferes Verständnis dieses schwer fassbaren Serotyps geschaffen, sowohl in Bezug auf seine Biologie als auch auf seine Pathogenität. Um die Methode zu validieren, wurde das wichtigste bekannte Pneumokokken-Toxin, Pneumolysin, mutiert, da es einen bekannten und leicht zu verfolgenden Phänotyp aufweist. Wir zeigten, dass die Mutante erwartungsgemäß ihre Fähigkeit verlor, rote Blutkörperchen zu lysieren. Indem wir in der Lage waren, ein wichtiges Gen im interessierenden Serotyp zu mutieren, konnten wir verschiedene Phänotypen für Funktionsverlustmutanten bei intraperitonealen und intranasalen Infektionen beobachten, die für andere Serotypen beobachtet wurden. Zusammenfassend belegt diese Studie, dass der Stamm 519/43 (Serotyp 1) genetisch verändert werden kann.

Das hier beschriebene Protokoll beginnt mit der Verwendung von PCR zur Amplifikation des linken und rechten Homologiearms, während gleichzeitig 191 bp aus der mittleren Region des Lagengens gelöscht werden. Während der Durchführung der PCR wird eine BamHI-Stelle am 3'-Ende des linken Homologiearms und am 5'-Ende des rechten Homologiearms eingeführt (Abbildung 1A). Darauf folgt die PCR-SOE, bei der linke und rechte Homologiearme zu einem Amplikon fusioniert werden (<strong class...

Watch this Scientific Journal Video about Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43 at JoVE.com

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Hier beschreiben wir einen S. pneumoniae Serotyp 1 Stamm 519/43, der genetisch verändert werden kann, indem er seine Fähigkeit nutzt, DNA und ein Suizid-Plasmid auf natürliche Weise zu erwerben. Als Prinzipienbeweis wurde eine isogene Mutante im Pneumolysin-Gen (Ply) hergestellt.

Konstruktion von Mutanten im Serotyp 1 Streptococcus pneumoniae Stamm 519/43

Streptococcus pneumoniae serotype 1 remains a huge problem in low-and-middle income countries, particularly in sub-Saharan Africa. Despite its importance, ...

constructing-mutants-serotype-1-streptococcus-pneumoniae-strain

Research

JoVE Journal

Immunology and Infection

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

1.6K Aufrufe.  London School of Hygiene and Tropical Medicine. Hier beschreiben wir einen S. pneumoniae Serotyp 1 Stamm 519/43, der genetisch verändert werden kann, indem er seine Fähigkeit nutzt, DNA und ein Suizid-Plasmid auf natürliche Weise zu erwerben. Als Prinzipienbeweis wurde eine isogene Mutante im Pneumolysin-Gen (Ply) hergestellt.

Serie: Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in which the gene of interest has been disrupted. A gene-disruption DNA construct containing a suitable antibiotic resistance marker gene is useful for the generation of gene-disrupted strains in bacteria. However, conventional construction methods, which require gene cloning steps, involve complex and time-consuming protocols. Here, a relatively facile, rapid, and cost-effective method for targeted gene disruption in Streptococcus mutans is described. The method utilizes a 2-step fusion polymerase chain reaction (PCR) to generate the disruption construct and electroporation for genetic transformation. This method does not require an enzymatic reaction, other than PCR, and additionally offers greater flexibility in terms of the design of the disruption construct. Employment of electroporation facilitates the preparation of competent cells and improves the transformation efficiency. The present method may be adapted for the generation of gene-disrupted strains of various species.

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

We describe a facile, rapid, and relatively inexpensive method for the generation of gene-disrupted Streptococcus mutans strains; this technique may be adapted for the generation of gene-disrupted strains of various species.

Generation von einem Gen gestört Streptococcus Mutans Belastung ohne Gene Klonen

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in ...

Forschung

Genetik

Characterization of Inflammatory Responses During Intranasal Colonization with Streptococcus pneumoniae

Nasopharyngeal colonization by Streptococcus pneumoniae is a prerequisite to invasion to the lungs or bloodstream1. This organism is capable of colonizing the mucosal surface of the nasopharynx, where it can reside, multiply and eventually overcome host defences to invade to other tissues of the host. Establishment of an infection in the normally lower respiratory tract results in pneumonia. Alternatively, the bacteria can disseminate into the bloodstream causing bacteraemia, which is associated with high mortality rates2, or else lead directly to the development of pneumococcal meningitis. Understanding the kinetics of, and immune responses to, nasopharyngeal colonization is an important aspect of S. pneumoniae infection models.
Our mouse model of intranasal colonization is adapted from human models3 and has been used by multiple research groups in the study of host-pathogen responses in the nasopharynx4-7. In the first part of the model, we use a clinical isolate of S. pneumoniae to establish a self-limiting bacterial colonization that is similar to carriage events in human adults. The procedure detailed herein involves preparation of a bacterial inoculum, followed by the establishment of a colonization event through delivery of the inoculum via an intranasal route of administration. Resident macrophages are the predominant cell type in the nasopharynx during the steady state. Typically, there are few lymphocytes present in uninfected mice8, however mucosal colonization will lead to low- to high-grade inflammation (depending on the virulence of the bacterial species and strain) that will result in an immune response and the subsequent recruitment of host immune cells. These cells can be isolated by a lavage of the tracheal contents through the nares, and correlated to the density of colonization bacteria to better understand the kinetics of the infection.

Characterization of Inflammatory Responses During Intranasal Colonization with Streptococcus pneumoniae

Colonization of the murine nasopharynx with Streptococcus pneumoniae and the subsequent extraction of adherent or recruited cells is described. This technique involves flushing the nasopharynx and collection of the fluid through the nares and is adaptable for various readouts, including differential cell quantification and analysis of mRNA expression in situ.

Charakterisierung von Entzündungsreaktionen während der intranasalen Kolonisation mit Streptococcus pneumoniae

Nasopharyngeal colonization by Streptococcus pneumoniae is a prerequisite to invasion to the lungs or bloodstream1. This organism is capable of colonizing ...

Immunologie und Infektion

Following in Real Time the Impact of Pneumococcal Virulence Factors in an Acute Mouse Pneumonia Model Using Bioluminescent Bacteria

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. Despite advances in knowledge of this illness, the availability of intensive care units (ICU), and the use of potent antimicrobial agents and effective vaccines, the mortality rates remain high1. Streptococcus pneumoniae is the leading pathogen of community-acquired pneumonia (CAP) and one of the most common causes of bacteremia in humans. This pathogen is equipped with an armamentarium of surface-exposed adhesins and virulence factors contributing to pneumonia and invasive pneumococcal disease (IPD). The assessment of the in vivo role of bacterial fitness or virulence factors is of utmost importance to unravel S. pneumoniae pathogenicity mechanisms. Murine models of pneumonia, bacteremia, and meningitis are being used to determine the impact of pneumococcal factors at different stages of the infection. Here we describe a protocol to monitor in real-time pneumococcal dissemination in mice after intranasal or intraperitoneal infections with bioluminescent bacteria. The results show the multiplication and dissemination of pneumococci in the lower respiratory tract and blood, which can be visualized and evaluated using an imaging system and the accompanying analysis software.

Streptococcus pneumoniae is the leading pathogen causing severe community-acquired pneumonia and responsible for over 2&#160;million deaths worldwide. The impact of bacterial factors implicated in fitness or virulence can be monitored in real-time in an acute mouse pneumonia or bacteremia model using bioluminescent bacteria.

Nach der in Echtzeit die Auswirkungen der Pneumokokken-Virulenzfaktoren in einer akuten Lungenentzündung Maus-Modells mit Biolumineszenz-Bakterien

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. ...

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal epidemiology, capsular serotyping can provide useful information for vaccine efficacy and impact studies.&#160;The Quellung reaction is the gold standard method for pneumococcal capsular serotyping. The method involves testing a pneumococcal cell suspension with pooled and specific antisera directed against the capsular polysaccharide. The antigen-antibody reactions are observed microscopically. The protocol has three main steps: 1) preparation of a bacterial cell suspension, 2) mixing of cells and antisera on a glass slide, and 3) reading the Quellung reaction using a microscope. The Quellung reaction is reasonably simple to perform and can be applied wherever a suitable microscope and antisera are available.

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

The Quellung reaction is the gold standard technique for serotyping Streptococcus pneumoniae. This technique utilizes a microscope and specific pneumococcal antisera and is commonly used in reference and research laboratories worldwide.

Kapsel Serotypisierung von<em&gt; Streptococcus pneumoniae</em&gt; Verwenden der Quellung Reaktion

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal ...

Visualization of Streptococcus pneumoniae within Cardiac Microlesions and Subsequent Cardiac Remodeling

During bacteremia Streptococcus pneumoniae can translocate across the vascular endothelium into the myocardium and form discrete bacteria-filled microscopic lesions (microlesions) that are remarkable due to the absence of infiltrating immune cells. Due to their release of cardiotoxic products, S. pneumoniae within microlesions are thought to contribute to the heart failure that is frequently observed during fulminate invasive pneumococcal disease in adults. Herein is demonstrated a protocol for experimental mouse infection that leads to reproducible cardiac microlesion formation within 30 hr. Instruction is provided on microlesion identification in hematoxylin &#38; eosin stained heart sections and the morphological distinctions between early and late microlesions are highlighted. Instruction is provided on a protocol for verification of S. pneumoniae within microlesions using antibodies against pneumococcal capsular polysaccharide and immunofluorescent microscopy. Last, a protocol for antibiotic intervention that rescues infected mice and for the detection and assessment of scar formation in the hearts of convalescent mice is provided. Together, these protocols will facilitate the investigation of the molecular mechanisms underlying pneumococcal cardiac invasion, cardiomyocyte death, cardiac remodeling as a result of exposure to S. pneumoniae, and the immune response to the pneumococci in the heart.

Visualization of Streptococcus pneumoniae within Cardiac Microlesions and Subsequent Cardiac Remodeling

Streptococcus pneumoniae forms discrete non-purulent microscopic lesions in the heart. Outlined is the protocol for a murine model of cardiac microlesion formation. Instruction is provided on microlesion visualization using microscopy, discrimination between early and late microlesions, and methods to detect cardiac remodeling in hearts of convalescent animals.

Visualisierung<em&gt; Streptococcus pneumoniae</em&gt; Innerhalb Cardiac Mikroläsionen und anschließende Herz Remodeling

During bacteremia Streptococcus pneumoniae can translocate across the vascular endothelium into the myocardium and form discrete bacteria-filled ...

Medizin

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa is able to form biofilms, develop antibiotic resistance, produce virulence factors, and rapidly evolve in the course of a chronic infection. Thus P. aeruginosa can cause both acute and chronic, difficult to treat infections, resulting in significant morbidity in certain patient populations. P. aeruginosa strain PA14 is a human clinical isolate with a conserved genome structure that infects a variety of mammalian and nonvertebrate hosts making PA14 an attractive strain for studying this pathogen. In 2006, a nonredundant transposon insertion mutant library containing 5,459 mutants corresponding to 4,596 predicted PA14 genes was generated. Since then, distribution of the PA14 library has allowed the research community to better understand the function of individual genes and complex pathways of P. aeruginosa. Maintenance of library integrity through the replication process requires proper handling and precise techniques. To that end, this manuscript presents protocols that describe in detail the steps involved in library replication, library quality control and proper storage of individual mutants.

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa infection causes significant morbidity in vulnerable hosts. The nonredundant transposon insertion mutant library of P. aeruginosa strain PA14, designated as PA14NR Set, facilitates analysis of gene functionality in numerous processes. Presented here is a protocol to generate high-quality copies of the PA14NR Set mutant library.

Replikation von bestellt, Nonredundant Bibliothek von Pseudomonas Aeruginosa Stamm PA14 Transposon Insertion Mutanten

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa ...

Homogeneous Glycoconjugate Produced by Combined Unnatural Amino Acid Incorporation and Click-Chemistry for Vaccine Purposes

Genetic code expansion is a powerful tool to introduce unnatural amino acids (UAAs) into proteins to modify their characteristics, to study or create new protein functions or to have access to protein conjugates. Stop codon suppression, in particular amber codon suppression, has emerged as the most popular method to genetically introduce UAAs at defined positions. This methodology is herein applied to the preparation of a carrier protein containing an UAA harboring a bioorthogonal functional group. This reactive handle can next be used to specifically and efficiently graft a synthetic oligosaccharide hapten to provide a homogeneous glycoconjugate vaccine. The protocol is limited to the synthesis of glycoconjugates in a 1:1 carbohydrate hapten/carrier protein ratio but amenable to numerous pairs of biorthogonal functional groups. Glycococonjugate vaccine homogeneity is an important criterion to ensure complete physico-chemical characterization, thereby, satisfying more and more demanding drug regulatory agency recommendations, a criterion which is unmet by classical conjugation strategies. Moreover, this protocol makes it possible to finely tune the structure of the actual conjugate vaccine, giving rise to tools to address structure-immunogenicity relationships.

Genetic code expansion is applied for the introduction of an unnatural amino acid bearing a biorthogonal functional group on a carrier protein at a defined site. The biorthogonal function is further used for the site-selective coupling of a carbohydrate antigen to provide a homogeneous glycoconjugate vaccine.

Homogenes Glycoconjugate hergestellt durch kombinierte unnatürliche Aminosäure-Inkorporation und Click-Chemie für Impfstoffzwecke

Genetic code expansion is a powerful tool to introduce unnatural amino acids (UAAs) into proteins to modify their characteristics, to study or create new ...

Biotechnik

Purification of a High Molecular Mass Protein in Streptococcus mutans

Elucidation of a gene&#39;s function typically involves comparison of phenotypic traits of wild-type strains and strains in which the gene of interest has been disrupted. Loss of function following gene disruption is subsequently restored by exogenous addition of the product of the disrupted gene. This helps to determine the function of the gene. A method previously described involves generating a gtfC gene-disrupted Streptococcus mutans strain. Here, an undemanding method is described for purifying the gtfC gene product from the newly generated S. mutans strain following the gene disruption. It involves the addition of a polyhistidine-coding sequence at the 3&#8242; end of the gene of interest, which allows simple purification of the gene product using immobilized metal affinity chromatography. No enzymatic reactions other than PCR are required for the genetic modification in this method. The restoration of the gene product by exogenous addition after gene disruption is an efficient method for determining gene function, which may also be adapted to different species.

Purification of a High Molecular Mass Protein in Streptococcus mutans

Described here is a simple method for the purification of a gene product in Streptococcus mutans. This technique may be advantageous in the purification of proteins, especially membrane proteins and high molecular mass proteins, and can be used with various other bacterial species.

Reinigung eines hochmolekularen Proteins in Streptococcus mutans

Elucidation of a gene&#39;s function typically involves comparison of phenotypic traits of wild-type strains and strains in which the gene of interest has ...

Inducing Meningococcal Meningitis Serogroup C in Mice via Intracisternal Delivery

Neisseria meningitidis (meningococcus) is a narrow-host-range microorganism, globally recognized as the leading cause of bacterial meningitis. Meningococcus is a transient colonizer of human nasopharynx of approximately 10% of healthy subject. In particular circumstances, it acquires an invasive ability to penetrate the mucosal barrier and invades the bloodstream causing septicaemia. In the latest case, fulminating sepsis could arise even without the consequent development of meningitis. Conversely, bacteria could poorly multiply in the bloodstream, cross the blood brain barrier, reach the central nervous system, leading to fulminant meningitis. The murine models of bacterial meningitis represent a useful tool to investigate the host-pathogen interactions and to analyze the pathogenetic mechanisms responsible for this lethal disease. Although, several experimental model systems have been evaluated over the last decades, none of these were able to reproduce the characteristic pathological events of meningococcal disease. In this experimental protocol, we describe a detailed procedure for the induction of meningococcal meningitis in a mouse model based on the intracisternal inoculation of bacteria. The peculiar signs of human meningitis were recorded in the murine host through the assessment of clinical parameters (e.g., temperature, body weight), evaluation of survival rate, microbiological analysis and histological examination of brain injury. When using intracisternal (i.cist.) inoculum, meningococci complete delivery directly into cisterna magna, leading to a very efficient meningococcal replication in the brain tissue. A 1,000-fold increase of viable count of bacteria is observed in about 18 h. Moreover, meningococci are also found in the spleen, and liver of infected mice, suggesting that the liver may represent a target organ for meningococcal replication.

Here, we describe a method to induce meningococcal meningitis through an intracisternal route of infection in adult mice. We present a step by step protocol of meningococcal infection from the preparation of inoculum to the intracisternal infection; then record the animal survival and evaluate the bacterial loads in murine tissues.

Induzieren von Meningokokken-Meningitis Serogroup C bei Mäusen über Intracisternal Delivery

Neisseria meningitidis (meningococcus) is a narrow-host-range microorganism, globally recognized as the leading cause of bacterial meningitis. ...

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of these products are naturally produced by the organisms, other products require genetic engineering of the organism to increase the yields of production. Avirulent strains of Escherichia coli have traditionally been the preferred bacterial species for producing biopharmaceuticals; however, some products are difficult for E. coli to produce. Thus, avirulent strains of other bacterial species could provide useful alternatives for production of some commercial products. Pseudomonas aeruginosa is a common and well-studied Gram-negative bacterium that could provide a suitable alternative to E. coli. However, P. aeruginosa is an opportunistic human pathogen. Here, we detail a procedure that can be used to generate nonpathogenic strains of P. aeruginosa through sequential genomic deletions using the pEX100T-NotI plasmid. The main advantage of this method is to produce a marker-free strain. This method may be used to generate highly attenuated P. aeruginosa strains for the production of commercial products, or to design strains for other specific uses. We also describe a simple and reproducible mouse model of bacterial systemic infection via intraperitoneal injection of validated test strains to test the attenuation of the genetically engineered strain in comparison to the FDA-approved BL21 strain of E. coli.

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Here, we describe a simple and reproducible protocol of mouse model of infection to evaluate the attenuation of the genetically modified strains of Pseudomonas aeruginosa in comparison to the United States Food and Drug Administration (FDA)-approved Escherichia coli for commercial applications.

Generierung von In-Frame-Gen-Deletion Mutanten in Pseudomonas aeruginosa und Tests auf VirulenzDämpfung in einem einfachen Mausmodell der Infektion

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of ...

Konstruktion von Mutanten im Serotyp 1 Streptococcus pneumoniae Stamm 519/43

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video