Diese Arbeit wurde vom National Science Centre, Polen unterstützt (Grant/Award Number: 2018/31/D/NZ2/03901).

1. Herstellung der siRNA-Mischung
<ol><li>Einen Tag vor Beginn des Experiments werden Zellen (z.B. HeLa) auf einer 100-mm-Schale so ausgesät, dass sie am nächsten Tag eine 70%-90%-Konfluenz erreichen. Anmerkungen: Alle Operationen müssen unter sterilen Bedingungen in einer Laminar-Flow-Kammer durchgeführt werden.</li>
	<li>Die entsprechende Menge siRNA wird auf eine Konzentration von 140 nM in Opti-MEM-Medium verdünnt (siehe Materialtabelle) hergestellt. Eine 96-Well-Platte kann als Reservoir verwendet werden.</li>
	<li>Geben Sie 5 μl der siRNA-Lösung (oder des Opti-MEM-Mediums für die Kontrollproben) in jede Vertiefung einer schwarzen 384-Well-Zellkultur-Mikrotiterplatte. HINWEIS: Abhängig von der Anzahl der getesteten siRNA-Proben kann eine elektronische oder Mehrkanalpipette verwendet werden.</li>
	<li>Bereiten Sie die entsprechende Menge RNAiMAX-Transfektionsreagenzlösung (siehe Materialtabelle) in Opti-MEM-Medium vor. Fügen Sie 1 μl RNAiMAX pro 100 μl Medium hinzu.</li>
	<li>Geben Sie 10 μl der Transfektionsreagenzlösung in jede Vertiefung der 384-Well-Platte. Der bequemste und schnellste Weg, dies zu tun, ist mit einem Reagenzienspender.</li>
	<li>Inkubieren Sie die siRNA mit dem Transfektionsreagenz für 30 min bei Raumtemperatur.</li>
</ol>2. Vorbereitung der Zellen für die Transfektion
<ol><li>Während der Inkubation (Schritt 1.6) wird das Medium mit einer Absaugvorrichtung angesaugt (siehe Materialtabelle) und die Zellen mit 3 ml PBS gewaschen.</li>
	<li>Fügen Sie 1,5 ml Trypsin hinzu, das 1:2 in PBS verdünnt ist, und inkubieren Sie die Zellen bei 37 °C für 10 Minuten.</li>
	<li>Überprüfen Sie, ob sich die Zellen gelöst haben. Wenn dies der Fall ist, fügen Sie 3 ml DMEM-Medium mit 10 % FBS hinzu. Suspendieren Sie die Zellen gründlich und übertragen Sie sie in ein 15-ml-Röhrchen. Nehmen Sie mindestens 150 μl der Suspension und zählen Sie die Zellen in einer Zellzählkammer (siehe Materialtabelle).</li>
	<li>Bereiten Sie eine Zellsuspension in der entsprechenden Konzentration (35.000/ml für die HeLa-Linie) in DMEM-Medium mit 10 % FBS, Penicillin und Streptomycin vor.</li>
</ol>3. Zelltransfektion
<ol><li>Geben Sie 20 μl der Zellsuspension mit dem Reagenziendispenser in jede Vertiefung der 384-Well-Platte. Dies führt dazu, dass pro Well 700 Zellen ausgesät werden.</li>
	<li>Inkubieren Sie die Zellen 1 h bei Raumtemperatur und legen Sie sie dann für 72 h (37 °C und 5 % CO2) in den Inkubator.</li>
</ol>4. Gründung der BrdU
<ol><li>Bereiten Sie eine 90-μM-Lösung von BrdU (siehe Materialtabelle) in DMEM-Medium mit 10 % FBS vor.</li>
	<li>56 h nach der siRNA-Transfektion (16 h vor der Zellfixierung) werden 10 μl 90 μM BrdU-Lösung in jede Vertiefung der 384-Well-Platte gegeben (die endgültige BrdU-Konzentration beträgt 20 μM). HINWEIS: Die Aktion sollte so schnell wie möglich ausgeführt werden. Daher ist es am besten, einen Reagenziendispenser, eine elektronische Pipette oder eine Multi-Dispenser-Pipette zu verwenden. Denken Sie daran, Kontrollbohrungen ohne Zusatz von BrdU vorzubereiten.</li>
	<li>Inkubieren Sie die Zellen für 16 h (37 °C und 5 % CO2).</li>
</ol>5. Markierung von Mitochondrien
<ol><li>Bereiten Sie eine 20 μM Lösung von BrdU in DMEM mit 10 % FBS vor und fügen Sie ihr die Mitochondrien-Tracking-Farbstofflösung (siehe Materialtabelle) bis zu einer Konzentration von 1,1 μM hinzu.</li>
	<li>15 h nach Beginn der BrdU-Inkorporation (1 h vor der Zellfixierung) werden 10 μl der Mitochondrien-Tracking-Farbstofflösung (siehe Materialtabelle) in jede Vertiefung der 384-Well-Platte gegeben (die endgültige Farbstoffkonzentration beträgt 200 nM). Anmerkungen: Verwenden Sie einen Reagenziendispenser, eine elektronische Pipette oder eine Multi-Dispenser-Pipette. Denken Sie daran, Kontrollvertiefungen ohne Zusatz von BrdU, aber mit Zugabe des Mitochondrien-Tracking-Farbstoffs beizubehalten.</li>
	<li>Inkubieren Sie die Zellen für 1 h (37 °C und 5 % CO2).</li>
</ol>6. Fixierung der Zellen
Anmerkungen: Das Waschen erfolgt am bequemsten mit einem Mikrotiterplattenreiniger, während die Zugabe von Reagenzien am schnellsten mit einem Reagenzienspender erfolgt.
<ol><li>Spülen Sie mit dem Mikrotiterplatten-Washer (siehe Materialtabelle) jeweils zweimal mit 100 μl PBS aus. Lassen Sie nach dem zweiten Waschen 25 μl PBS in der Vertiefung. HINWEIS: Wenn PBS in der Vertiefung verbleibt, verringert sich die Wahrscheinlichkeit einer Zellablösung während der Zugabe von Flüssigkeit im nächsten Schritt. Alle Wäschen werden mit dem PBS abgeschlossen; Daher sollte die im nächsten Schritt hinzugefügte Lösung immer in einer 2-fachen Konzentration hergestellt werden, da sie in gleichem Volumen zum verbleibenden PBS hinzugefügt wird.</li>
	<li>Fixieren Sie die Zellen durch Zugabe von 25 μl einer 8%igen Formaldehydlösung in PBS mit 0,4% Triton X-100 und Hoechst 33342 bei einer Konzentration von 4 μg/ml (die Endkonzentrationen der einzelnen Reagenzien betragen 4 %, 0,2 % bzw. 2 μg/ml) (siehe Materialtabelle).</li>
	<li>Inkubieren Sie die Platte im Dunkeln bei Raumtemperatur für 30 Minuten.</li>
</ol>7. Sperrung
<ol><li>Spülen Sie jede Vertiefung viermal mit 100 μl PBS aus. Lassen Sie nach der letzten Wäsche 25 μl PBS in der Welle.</li>
	<li>Geben Sie 25 μl 6 % BSA in PBS (die endgültige BSA-Konzentration beträgt 3 %) in jede Vertiefung.</li>
	<li>Inkubieren Sie die Platte im Dunkeln bei Raumtemperatur für 30 Minuten.</li>
</ol>8. Zugabe der Primärantikörper
<ol><li>Aspirieren Sie die BSA mit einem Mikrotiterplatten-Washer und lassen Sie 10 μl Lösung in der Vertiefung.</li>
	<li>Fügen Sie 10 μl der primären Antikörperlösung hinzu, die in 3 % BSA in PBS hergestellt wurde. Anti-BrdU mit 0,8 μg/ml und Anti-DNA mit 0,4 μg/ml (die Endkonzentrationen der Antikörper betragen 0,4 μg/ml bzw. 0,2 μg/ml) (siehe Materialtabelle).</li>
	<li>Inkubieren Sie die Platte im Dunkeln bei 4 °C über Nacht.</li>
</ol>9. Zugabe der Sekundärantikörper
<ol><li>Spülen Sie jede Vertiefung viermal mit 100 μl PBS aus. Lassen Sie nach dem letzten Waschen 10 μl PBS in der Vertiefung.</li>
	<li>Fügen Sie 10 μl der 4 μg/ml Sekundärantikörperlösung hinzu, die in 6 % BSA in PBS hergestellt wurde (die Endkonzentration beträgt 2 μg/ml). Verwenden Sie isotypspezifische Antikörper (Anti-Maus-IgG1 und Anti-Maus-IgM), die an Fluorochrome wie Alexa Fluor 488 und Alexa Fluor 555 konjugiert sind (siehe Materialtabelle).</li>
	<li>Inkubieren Sie die Platte im Dunkeln bei Raumtemperatur für 1 h.</li>
	<li>Spülen Sie jede Vertiefung viermal mit 100 μl PBS aus. Lassen Sie nach dem letzten Waschen 50 μl PBS in der Vertiefung.</li>
	<li>Verschließen Sie die Platte mit einer selbstklebenden Siegelfolie (siehe Materialtabelle) und lagern Sie sie im Dunkeln bei 4 °C. Die Bildgebung muss innerhalb von 2 Wochen durchgeführt werden.</li>
</ol>10. Bildgebung
HINWEIS: Die Bildgebung muss mit einem automatisierten Weitfeldmikroskop durchgeführt werden. Das Mikroskop muss mit einem Motortisch ausgestattet sein, der mit Bedienelementen ausgestattet ist, um einzelne Bereiche der Platte automatisch abzubilden.
<ol><li>Überprüfen Sie die Autofokuseinstellungen in den Eckbereichen der Platte (Vertiefungen A1, A24, P24, P1) und in der Mitte. HINWEIS: Für die Bildgebung wird empfohlen, ein 20-faches Objektiv mit kurzem Arbeitsabstand (siehe Materialtabelle) mit der höchstmöglichen numerischen Apertur zu verwenden.</li>
	<li>Wählen Sie anhand der von der Bildgebungssoftware im Live-View-Modus erzeugten Intensitätshistogramme eine ausreichend lange Belichtungszeit für die einzelnen Fluoreszenzkanäle, damit das resultierende Bild nicht übersättigt wird.</li>
	<li>Legen Sie die entsprechende Anzahl von Ebenen für die Bildgebung auf der z-Achse fest. HINWEIS: Das Sichtfeld bei 20-facher Vergrößerung ist groß genug, dass sich nicht alle Zellen in derselben Fokusebene befinden, daher muss ein Z-Schnitt durchgeführt werden, um alle Zellen in ihrer richtigen Fokusebene anzuzeigen. In der Regel reichen fünf Flugzeuge aus. Je nach verfügbarem Speicherplatz können einzelne Z-Stapel oder nur Projektionen der maximalen Intensität gespeichert werden. Die im Abschnitt "Repräsentative Ergebnisse" gezeigte Bildanalyse basiert auf Projektionen der maximalen Intensität.</li>
	<li>Wählen Sie die entsprechende Anzahl von Sichtfeldern aus, die pro Vertiefung angezeigt werden sollen. HINWEIS: Je nach Konfluenz können ca. 60-300 Zellen in einem Sichtfeld abgebildet werden. In der Regel können HeLa-Zellen mit einer Konfluenz von 60 % bis 90 % durch die Abbildung von fünf Sichtfeldern von 500 Zellen bis über 1.000 Zellen analysiert werden.</li>
	<li>Wählen Sie die Wells aus, die abgebildet werden sollen, und starten Sie die Bildgebung.</li>
</ol>11. Quantitative Bildanalyse
HINWEIS: Die quantitative Analyse der aufgenommenen Bilder kann mit einer Open-Source-Software wie Cell Profiler15 durchgeführt werden. Für die vorliegende Studie wurde die Analyse mit der Software ScanR 3.0.0 durchgeführt (siehe Materialtabelle).
<ol><li>Beginnen Sie die Analyse, indem Sie eine Hintergrundkorrektur für alle Bilder aus allen Fluoreszenzkanälen durchführen. Wählen Sie je nach Größe der analysierten Objekte die passende Filtergröße: 80 Pixel für Zellkerne und 4 Pixel für BrdU- und mtDNA-Spots.</li>
	<li>Beginnen Sie mit der Segmentierung des Bildes, indem Sie eine Maske des Hauptobjekts erstellen, die auf dem Verhältnis der Intensität des Fluoreszenzsignals zum Hintergrund für den Kanal basiert, der den Zellkernen entspricht.</li>
	<li>Erstellen Sie Masken für die Unterobjekte, die die BrdU- bzw. mtDNA-Punkte darstellen, indem Sie die für die gegebenen Strukturen geeigneten Fluoreszenzkanäle verwenden. HINWEIS: Jedes Unterobjekt ist dem nächstgelegenen Hauptobjekt (Zellkern) zugeordnet.</li>
	<li>Legen Sie die Parameter fest, die während der Analyse gemessen werden sollen, und messen Sie die Intensität der einzelnen Pixel innerhalb jeder Maske für alle Fluoreszenzkanäle. HINWEIS: Es ist auch notwendig, die Anzahl der Unterobjekte zu berechnen, die einem bestimmten Zellkern zugeordnet sind, und die Fläche jedes Unterobjekts.</li>
	<li>Definieren Sie die abgeleiteten Parameter, die auf der Grundlage der erhaltenen Daten berechnet werden sollen. Um die Gesamtfluoreszenzintensitäten für den BrdU- oder mtDNA-Kanal zu erhalten, summieren Sie die Intensitäten aller Unterobjekte, die einem bestimmten Zellkern zugeordnet sind. Um die mittlere Fluoreszenzintensität zu erhalten, dividieren Sie die Gesamtfluoreszenzintensität durch die Summe der Fläche der Unterobjekte, die einem bestimmten Zellkern zugeordnet sind. HINWEIS: Um sicherzustellen, dass sich das erstellte Unterobjekt (BrdU- oder mtDNA-Spot) tatsächlich in den Mitochondrien befindet, ist es notwendig, sie basierend auf der Fluoreszenzintensität des Mitochondrien-Tracking-Farbstoffs zu gaten.</li>
	<li>Führen Sie eine weitere Analyse der mit der ScanR-Software erhaltenen Daten mit der Statistiksoftware R 4.2.216 zusammen mit den folgenden Paketen durch: dplyr 17, data.table18, ggplot219 und ggpubr20. Dieser Schritt ist optional.</li>
</ol>

Hochdurchsatz-Quantifizierung der Synthese und Verteilung von mtDNA

<ol>
	<li>Brown, G. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+respiration+and+ATP+synthesis+in+mammalian+mitochondria+and+cells.">Control of respiration and ATP synthesis in mammalian mitochondria and cells.</a> The Biochemical Journal. 284, 1-13 (1992).</li><li>Zhang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biochemical+basis+and+metabolic+interplay+of+redox+regulation).">Biochemical basis and metabolic interplay of redox regulation).</a> Redox Biology. 26, 101284 (2019).</li><li>Pizzo, P., Drago, I., Filadi, R., Pozzan, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+Ca2++homeostasis:+Mechanism,+role,+and+tissue+specificities.">Mitochondrial Ca2+ homeostasis: Mechanism, role, and tissue specificities.</a> Pflugers Archiv: European Journal of Physiology. 464 (1), 3-17 (2012).</li><li>Shadel, G. S., Horvath, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+ROS+signaling+in+organismal+homeostasis.">Mitochondrial ROS signaling in organismal homeostasis.</a> Cell. 163 (3), 560-569 (2015).</li><li>Mart&#237;nez-Reyes, I., Chandel, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+TCA+cycle+metabolites+control+physiology+and+disease.">Mitochondrial TCA cycle metabolites control physiology and disease.</a> Nature Communications. 11 (1), 102 (2020).</li><li>Galluzzi, L., Kepp, O., Trojel-Hansen, C., Kroemer, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+control+of+cellular+life,+stress,+and+death.">Mitochondrial control of cellular life, stress, and death.</a> Circulation Research. 111 (9), 1198-1207 (2012).</li><li>Rone, M. B., Fan, J., Papadopoulos, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cholesterol+transport+in+steroid+biosynthesis:+role+of+protein-protein+interactions+and+implications+in+disease+states.">Cholesterol transport in steroid biosynthesis: role of protein-protein interactions and implications in disease states.</a> Biochimica Et Biophysica Acta. 1791 (7), 646-658 (2009).</li><li>Swenson, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+synthesis+to+utilization:+The+ins+and+outs+of+mitochondrial+heme.">From synthesis to utilization: The ins and outs of mitochondrial heme.</a> Cells. 9 (3), 579 (2020).</li><li>West, A. P., Shadel, G. S., Ghosh, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondria+in+innate+immune+responses.">Mitochondria in innate immune responses.</a> Nature Reviews. Immunology. 11 (6), 389-402 (2011).</li><li>Nunnari, J., Suomalainen, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondria:+In+sickness+and+in+health.">Mitochondria: In sickness and in health.</a> Cell. 148 (6), 1145-1159 (2012).</li><li>Pohjoism&#228;ki, J. L. O., Goffart, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Of+circles,+forks+and+humanity:+Topological+organisation+and+replication+of+mammalian+mitochondrial+DNA.">Of circles, forks and humanity: Topological organisation and replication of mammalian mitochondrial DNA.</a> BioEssays. 33 (4), 290-299 (2011).</li><li>Gustafsson, C. M., Falkenberg, M., Larsson, N. -. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maintenance+and+expression+of+mammalian+mitochondrial+DNA.">Maintenance and expression of mammalian mitochondrial DNA.</a> Annual Review of Biochemistry. 85, 133-160 (2016).</li><li>Nicholls, T. J., Gustafsson, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separating+and+segregating+the+human+mitochondrial+genome.">Separating and segregating the human mitochondrial genome.</a> Trends in Biochemical Sciences. 43 (11), 869-881 (2018).</li><li>Gratzner, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibody+to+5-bromo-+and+5-iododeoxyuridine:+A+new+reagent+for+detection+of+DNA+replication.">Monoclonal antibody to 5-bromo- and 5-iododeoxyuridine: A new reagent for detection of DNA replication.</a> Science. 218 (4571), 474-475 (1982).</li><li>Stirling, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CellProfiler+4:+Improvements+in+speed,+utility+and+usability.">CellProfiler 4: Improvements in speed, utility and usability.</a> BMC Bioinformatics. 22 (1), 433 (2021).</li><li>R Core Team. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=R:+A+Language+and+Environment+for+Statistical+Computing.">R: A Language and Environment for Statistical Computing.</a> R Foundation for Statistical Computing. , (2021).</li><li>. dplyr: A Grammar of Data Manipulation Available from: <a target="_blank" href="https://CRAN.R-project.org/package=dplyr">https://CRAN.R-project.org/package=dplyr</a> (2021)</li><li>. data.table: Extension of `data.frame Available from: <a target="_blank" href="https://CRAN.R-project.org/package=data.table">https://CRAN.R-project.org/package=data.table</a> (2020)</li><li>. ggplot2: Elegant graphics for data analysis Available from: <a target="_blank" href="https://ggplot2.tidyverse.org">https://ggplot2.tidyverse.org</a> (2016)</li><li>. ggpubr: &amp;#34;ggplot2&amp;#34; based publication ready plots Available from: <a target="_blank" href="https://CRAN.R-project.org/package=ggpubr">https://CRAN.R-project.org/package=ggpubr</a> (2020)</li><li>Hashiguchi, K., Zhang-Akiyama, Q. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+of+human+cell+lines+lacking+mitochondrial+DNA.">Establishment of human cell lines lacking mitochondrial DNA.</a> Methods in Molecular Biology. 554, 383-391 (2009).</li><li>Piechota, J., Szczesny, R., Wolanin, K., Chlebowski, A., Bartnik, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nuclear+and+mitochondrial+genome+responses+in+HeLa+cells+treated+with+inhibitors+of+mitochondrial+DNA+expression.">Nuclear and mitochondrial genome responses in HeLa cells treated with inhibitors of mitochondrial DNA expression.</a> Acta Biochimica Polonica. 53 (3), 485-495 (2006).</li><li>Spelbrink, J. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+mitochondrial+DNA+deletions+associated+with+mutations+in+the+gene+encoding+Twinkle,+a+phage+T7+gene+4-like+protein+localized+in+mitochondria.">Human mitochondrial DNA deletions associated with mutations in the gene encoding Twinkle, a phage T7 gene 4-like protein localized in mitochondria.</a> Nature Genetics. 28 (3), 223-231 (2001).</li><li>Campbell, C. T., Kolesar, J. E., Kaufman, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+transcription+factor+A+regulates+mitochondrial+transcription+initiation,+DNA+packaging,+and+genome+copy+number.">Mitochondrial transcription factor A regulates mitochondrial transcription initiation, DNA packaging, and genome copy number.</a> Biochimica et Biophysica Acta. 1819 (9-10), 921-929 (2012).</li><li>Krasich, R., Copeland, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+polymerases+in+the+mitochondria:+A+critical+review+of+the+evidence.">DNA polymerases in the mitochondria: A critical review of the evidence.</a> Frontiers in Bioscience. 22 (4), 692-709 (2017).</li><li>Kotrys, A. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+proteomics+revealed+C6orf203/MTRES1+as+a+factor+preventing+stress-induced+transcription+deficiency+in+human+mitochondria.">Quantitative proteomics revealed C6orf203/MTRES1 as a factor preventing stress-induced transcription deficiency in human mitochondria.</a> Nucleic Acids Research. 47 (14), 7502-7517 (2019).</li><li>Gratzner, H. G., Pollack, A., Ingram, D. J., Leif, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deoxyribonucleic+acid+replication+in+single+cells+and+chromosomes+by+immunologic+techniques.">Deoxyribonucleic acid replication in single cells and chromosomes by immunologic techniques.</a> Journal of Histochemistry &amp; Cytochemistry. 24 (1), 34-39 (1976).</li><li>Leif, R. C., Stein, J. H., Zucker, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+short+history+of+the+initial+application+of+anti-5-BrdU+to+the+detection+and+measurement+of+S+phase.">A short history of the initial application of anti-5-BrdU to the detection and measurement of S phase.</a> Cytometry. Part A: The Journal of the International Society for Analytical Cytology. 58 (1), 45-52 (2004).</li><li>Lentz, S. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+DNA+(mtDNA)+biogenesis:+visualization+and+duel+incorporation+of+BrdU+and+EdU+into+newly+synthesized+mtDNA+in+vitro.">Mitochondrial DNA (mtDNA) biogenesis: visualization and duel incorporation of BrdU and EdU into newly synthesized mtDNA in vitro.</a> The Journal of Histochemistry and Cytochemistry. 58 (2), 207-218 (2010).</li><li>Liu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multi-omic+measurements+of+heterogeneity+in+HeLa+cells+across+laboratories.">Multi-omic measurements of heterogeneity in HeLa cells across laboratories.</a> Nature Biotechnology. 37 (3), 314-322 (2019).</li></ol>

Die Autoren haben nichts zu verraten.

In der Vergangenheit wurde die DNA-Markierung durch BrdU-Einbau und Antikörpernachweis in der nukleären DNA-Replikation und Zellzyklusforschung eingesetzt 14,27,28. Bisher enthielten alle Protokolle zum Nachweis von BrdU-markierter DNA einen DNA-Denaturierungsschritt (sauer oder thermisch) oder einen Enzymverdau (DNase oder Proteinase), um die Epitopexposition zu ermöglichen und das Eindringen von Antikörpern zu erleichtern....

Für die meisten eukaryotischen Zellen sind Mitochondrien essentielle Organellen, da sie eine entscheidende Rolle in zahlreichen zellulären Prozessen spielen. Mitochondrien sind in erster Linie die wichtigsten Energielieferanten der Zellen1. Mitochondrien sind auch an der Regulierung der zellulären Homöostase (z. B. intrazelluläres Redox2 und des Kalziumhaushalts3), der Zellsignalübertragung 4,5, der Apoptose6, der Synthese verschiedener biochemischer Verbindungen 7,8 und der angeborenen Immunantwortbeteiligt 9. Mitochondriale Dysfunktion wird mit verschiedenen pathologischen Zuständen und menschlichen Krankheiten in Verbindung gebracht10.
Die Funktion der Mitochondrien hängt von der genetischen Information ab, die sich in zwei getrennten Genomen befindet: dem Kern- und dem mitochondrialen Genom. Das mitochondriale Genom kodiert im Vergleich zum Kerngenom nur eine kleine Anzahl von Genen, aber alle mtDNA-kodierten Gene sind für das menschliche Leben unerlässlich. Die mitochondriale Proteinmaschinerie, die für die Aufrechterhaltung der mtDNA notwendig ist, wird von nDNA kodiert. Die grundlegenden Komponenten des mitochondrialen Replisoms sowie einige mitochondriale Biogenesefaktoren wurden bereits identifiziert (in früheren Forschungsarbeiten überprüft11,12). Die mitochondrialen DNA-Replikations- und Erhaltungsmechanismen sind jedoch noch weit davon entfernt, verstanden zu werden. Im Gegensatz zur nDNA liegt das mitochondriale Genom in mehreren Kopien vor, was eine zusätzliche Schicht zur Regulierung der mitochondrialen Genexpression darstellt. Viel weniger ist derzeit über die Verteilung und Segregation von mtDNA innerhalb von Organellen bekannt, inwieweit diese Prozesse reguliert sind und wenn ja, welche Proteine beteiligt sind13. Das Segregationsmuster ist entscheidend, wenn Zellen eine gemischte Population aus Wildtyp- und mutierter mtDNA enthalten. Ihre ungleiche Verteilung kann zur Bildung von Zellen mit einer schädlichen Menge an mutierter mtDNA führen.
Bisher wurden die Proteinfaktoren, die für den Erhalt der mtDNA notwendig sind, vor allem durch biochemische Methoden, bioinformatische Analysen oder durch krankheitsassoziierte Studien identifiziert. Um eine hohe Wahrscheinlichkeit zu gewährleisten, Faktoren zu identifizieren, die sich bisher der Identifizierung entzogen haben, wird in dieser Arbeit eine andere Strategie beschrieben. Die Methode basiert auf der Markierung von mtDNA während der Replikation oder Reparatur mit 5-Brom-2'-desoxyuridin (BrdU), einem Nukleosid-Analogon von Thymidin. BrdU wird während der DNA-Synthese leicht in entstehende DNA-Stränge eingebaut und im Allgemeinen zur Überwachung der Replikation von Kern-DNAverwendet 14. Das hier entwickelte Verfahren wurde jedoch für den Nachweis von in mtDNA eingebautem BrdU unter Verwendung der Immunfluoreszenz von Anti-BrdU-Antikörpern optimiert.
Der Ansatz ermöglicht die Hochdurchsatzquantifizierung der mtDNA-Synthese und -Verteilung in humanen Zellen, die in vitro kultiviert wurden. Eine Hochdurchsatzstrategie ist notwendig, um Tests unter verschiedenen Versuchsbedingungen in relativ kurzer Zeit durchzuführen; Daher wird im Protokoll vorgeschlagen, ein Multi-Well-Format für die Zellkultivierung und automatisierte Fluoreszenzmikroskopie für die Bildgebung zu verwenden. Das Protokoll umfasst die Transfektion von humanen HeLa-Zellen mit einer siRNA-Bibliothek und die anschließende Überwachung der mtDNA-Replikation oder -Reparatur durch die metabolische Markierung neu synthetisierter DNA mit BrdU. Dieser Ansatz wird mit einer Immunfärbung der DNA mit Hilfe von Anti-DNA-Antikörpern kombiniert. Beide Parameter werden mittels quantitativer Fluoreszenzmikroskopie analysiert. Zusätzlich werden Mitochondrien mit einem bestimmten Farbstoff sichtbar gemacht. Um die Spezifität des Protokolls zu demonstrieren, wurde die BrdU-Färbung an Zellen ohne mtDNA (rho0-Zellen), an HeLa-Zellen nach dem Silencing bekannter mtDNA-Erhaltungsfaktoren und an HeLa-Zellen nach Behandlung mit einem mtDNA-Replikationsinhibitor getestet. Die mtDNA-Konzentrationen wurden auch mit einer unabhängigen Methode, nämlich der qPCR, gemessen.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2&#8242;,3&#8242;-Dideoxycytidine (ddC)</td>
			<td>Sigma-Aldrich</td>
			<td>D5782</td>
			<td></td>
		</tr>
		<tr>
			<td>384&#160; Well Cell Culture Microplates, black</td>
			<td>Greiner Bio-One</td>
			<td>#781946</td>
			<td></td>
		</tr>
		<tr>
			<td>5-Bromo-2&#8242;-deoxyuridine (BrdU)</td>
			<td>Sigma-Aldrich</td>
			<td>B5002-1G</td>
			<td>Dissolve BrdU powder in water to 20 mM stock solution and aliquot. Use 20 &#181;M BrdU solution for labeling.</td>
		</tr>
		<tr>
			<td>Adhesive sealing film</td>
			<td>Nerbe Plus</td>
			<td>04-095-0060</td>
			<td></td>
		</tr>
		<tr>
			<td>Alexa Fluor 488 goat anti-mouse IgG1 secondary antibody</td>
			<td>Thermo Fisher Scientific</td>
			<td>A-21121</td>
			<td></td>
		</tr>
		<tr>
			<td>Alexa Fluor 555 goat anti-mouse IgM secondary antibody</td>
			<td>Thermo Fisher Scientific</td>
			<td>A-21426</td>
			<td></td>
		</tr>
		<tr>
			<td>BioTek 405 LS microplate washer</td>
			<td>Agilent</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine Serum Albumin (BSA)</td>
			<td>Sigma-Aldrich</td>
			<td>A4503</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell counting chamber Thoma</td>
			<td>Heinz Herenz</td>
			<td>REF:1080339</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td>Cytiva</td>
			<td>SH30243.01</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td>Thermo Fisher Scientific</td>
			<td>41965-062</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Thermo Fisher Scientific</td>
			<td>10270-106</td>
			<td></td>
		</tr>
		<tr>
			<td>Formaldehyde solution</td>
			<td>Sigma-Aldrich</td>
			<td>F1635</td>
			<td>Formaldehyde is toxic; please read the safety data sheet carefully.</td>
		</tr>
		<tr>
			<td>Hoechst 33342</td>
			<td>Thermo Fisher Scientific</td>
			<td>H3570</td>
			<td></td>
		</tr>
		<tr>
			<td>IgG1 mouse monoclonal anti-BrdU (IIB5) primary antibody</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-32323</td>
			<td></td>
		</tr>
		<tr>
			<td>IgM mouse monoclonal anti-DNA (AC-30-10) primary antibody</td>
			<td>Progen</td>
			<td>#61014</td>
			<td></td>
		</tr>
		<tr>
			<td>LightCycler 480 System</td>
			<td>Roche</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Lipofectamine RNAiMAX Transfection Reagent</td>
			<td>Thermo Fisher Scientific</td>
			<td>#13778150</td>
			<td></td>
		</tr>
		<tr>
			<td>MitoTracker Deep Red FM</td>
			<td>Thermo Fisher Scientific</td>
			<td>M22426</td>
			<td>Mitochondria tracking dye&#160;</td>
		</tr>
		<tr>
			<td>Multidrop Combi Reagent Dispenser</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Opti-MEM</td>
			<td>Thermo Fisher Scientific</td>
			<td>51985-042</td>
			<td></td>
		</tr>
		<tr>
			<td>Orca-R2 (C10600) CCD Camera</td>
			<td>Hamamatsu</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>P0781-100ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate buffered saline (PBS)</td>
			<td>Sigma-Aldrich</td>
			<td>P4417-100TAB</td>
			<td></td>
		</tr>
		<tr>
			<td>PowerUp SYBR Green Master Mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>A25742</td>
			<td></td>
		</tr>
		<tr>
			<td>qPCR primer Fw B2M (reference)</td>
			<td></td>
			<td></td>
			<td>CAGGTACTCCAAAGATTCAGG&#160;</td>
		</tr>
		<tr>
			<td>qPCR primer Fw GPI (reference gene)</td>
			<td></td>
			<td></td>
			<td>GACCTTTACTACCCAGGAGA</td>
		</tr>
		<tr>
			<td>qPCR primer Fw MT-ND1&#160;</td>
			<td></td>
			<td></td>
			<td>TAGCAGAGACCAACCGAACC&#160;</td>
		</tr>
		<tr>
			<td>qPCR primer Fw POLG</td>
			<td></td>
			<td></td>
			<td>TGGAAGGCAGGCATGGTCAAACC</td>
		</tr>
		<tr>
			<td>qPCR primer Fw TFAM</td>
			<td></td>
			<td></td>
			<td>GATGAGTTCTGCCTGCTTTAT</td>
		</tr>
		<tr>
			<td>qPCR primer Fw TWNK</td>
			<td></td>
			<td></td>
			<td>GCCATGTGACACTGGTCATT</td>
		</tr>
		<tr>
			<td>qPCR primer Rev B2M (reference)</td>
			<td></td>
			<td></td>
			<td>GTCAACTTCAATGTCGGATGG&#160;</td>
		</tr>
		<tr>
			<td>qPCR primer Rev GPI (reference gene)</td>
			<td></td>
			<td></td>
			<td>AGTAGACAGGGCAACAAAGT</td>
		</tr>
		<tr>
			<td>qPCR primer Rev MT-ND1&#160;</td>
			<td></td>
			<td></td>
			<td>ATGAAGAATAGGGCGAAGGG&#160;</td>
		</tr>
		<tr>
			<td>qPCR primer Rev POLG</td>
			<td></td>
			<td></td>
			<td>GGAGTCAGAACACCTGGCTTTGG</td>
		</tr>
		<tr>
			<td>qPCR primer Rev TFAM</td>
			<td></td>
			<td></td>
			<td>GGACTTCTGCCAGCATAATA</td>
		</tr>
		<tr>
			<td>qPCR primer Rev TWNK</td>
			<td></td>
			<td></td>
			<td>AACATTGTCTGCTTCCTGGC</td>
		</tr>
		<tr>
			<td>ScanR microscope</td>
			<td>Olympus</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>siRNA Ctrl</td>
			<td>Dharmacon</td>
			<td>D-001810-10-5</td>
			<td></td>
		</tr>
		<tr>
			<td>siRNA POLG</td>
			<td>Invitrogen</td>
			<td>POLGHSS108223</td>
			<td></td>
		</tr>
		<tr>
			<td>siRNA TFAM</td>
			<td>Invitrogen</td>
			<td>TFAMHSS144252</td>
			<td></td>
		</tr>
		<tr>
			<td>siRNA TWNK</td>
			<td>Invitrogen</td>
			<td>C10orf2HSS125597</td>
			<td></td>
		</tr>
		<tr>
			<td>Suction device</td>
			<td>NeoLab</td>
			<td>2-9335</td>
			<td>Suction device for cell culture</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma-Aldrich</td>
			<td>T9284-500ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypsin</td>
			<td>Biowest</td>
			<td>L0931-500</td>
			<td></td>
		</tr>
		<tr>
			<td>UPlanSApo 20x 0.75 NA objective</td>
			<td>Olympus</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

high-throughput image-based quantification of mitochondrial dna synthesis and distribution

Die überwiegende Mehrheit der zellulären Prozesse erfordert eine kontinuierliche Energiezufuhr, deren häufigster Träger das ATP-Molekül ist. Eukaryotische Zellen produzieren den größten Teil ihres ATP in den Mitochondrien durch oxidative Phosphorylierung. Mitochondrien sind einzigartige Organellen, weil sie ein eigenes Genom haben, das repliziert und an die nächste Generation von Zellen weitergegeben wird. Im Gegensatz zum Kerngenom gibt es in der Zelle mehrere Kopien des mitochondrialen Genoms. Die detaillierte Untersuchung der Mechanismen, die für die Replikation, Reparatur und Aufrechterhaltung des mitochondrialen Genoms verantwortlich sind, ist unerlässlich, um das ordnungsgemäße Funktionieren von Mitochondrien und ganzen Zellen sowohl unter normalen als auch unter Krankheitsbedingungen zu verstehen. Hier wird eine Methode vorgestellt, die die Hochdurchsatzquantifizierung der Synthese und Verteilung von mitochondrialer DNA (mtDNA) in in vitro kultivierten humanen Zellen ermöglicht. Dieser Ansatz basiert auf der Immunfluoreszenzdetektion von aktiv synthetisierten DNA-Molekülen, die durch den Einbau von 5-Brom-2'-Desoxyuridin (BrdU) markiert sind, und der gleichzeitigen Detektion aller mtDNA-Moleküle mit Anti-DNA-Antikörpern. Zusätzlich werden die Mitochondrien mit spezifischen Farbstoffen oder Antikörpern sichtbar gemacht. Die Kultivierung von Zellen im Multi-Well-Format und der Einsatz eines automatisierten Fluoreszenzmikroskops erleichtern es, die Dynamik der mtDNA und die Morphologie der Mitochondrien unter verschiedenen experimentellen Bedingungen in relativ kurzer Zeit zu untersuchen.

For most eukaryotic cells mitochondria are essential organelles, as they play a crucial role in numerous cellular processes. First and foremost, mitochondria are the key energy suppliers of cells1. Mitochondria are also involved in regulating cellular homeostasis (for instance, intracellular redox2 and the calcium balance3), cell signaling4,5, apoptosis6, the synthesis of different biochemical compounds7,8, and the innate immune response9. Mitochondrial dysfunction is associated with various pathological states and human diseases10. 
The functioning of mitochondria depends on the genetic information located in two separate genomes: the nuclear and mitochondrial genomes. The mitochondrial genome encodes a small number of genes compared to the nuclear genome, but all the mtDNA-encoded genes are essential for human life. The mitochondrial protein machinery necessary to maintain the mtDNA is encoded by nDNA. The basic components of the mitochondrial replisome, as well as some mitochondrial biogenesis factors, have already been identified (reviewed in previous research11,12). However, mitochondrial DNA replication and maintenance mechanisms are still far from being understood. In contrast to nDNA, the mitochondrial genome exists in multiple copies, which provides an additional layer for regulating mitochondrial gene expression. Much less is currently known about the distribution and segregation of mtDNA within organelles, to what extent these processes are regulated, and if they are, which proteins are involved13. The segregation pattern is crucial when cells contain a mixed population of wild-type and mutated mtDNA. Their unequal distribution may lead to the generation of cells with a detrimental amount of mutated mtDNA.
So far, the protein factors necessary for mtDNA maintenance have been identified mainly by biochemical methods, bioinformatic analyses, or through disease-associated studies. In this work, in order to ensure a high chance of identifying factors that have previously escaped identification, a different strategy is described. The method is based on the labeling of mtDNA during replication or repair with 5-bromo-2'-deoxyuridine (BrdU), a nucleoside analog of thymidine. BrdU is readily incorporated into nascent DNA strands during DNA synthesis and, in general, is used for monitoring the replication of nuclear DNA14. However, the procedure developed here has been optimized for detecting BrdU incorporated into mtDNA using the immunofluorescence of anti-BrdU antibodies.
The approach allows for the high-throughput quantification of mtDNA synthesis and distribution in human cells cultured in vitro. A high-throughput strategy is necessary to conduct tests under different experimental conditions in a relatively short time; therefore, it is proposed in the protocol to utilize a multi-well format for cell culturing and automated fluorescence microscopy for imaging. The protocol includes the transfection of human HeLa cells with an siRNA library and the subsequent monitoring of mtDNA replication or repair using the metabolic labeling of newly synthesized DNA with BrdU. This approach is combined with immunostaining of the DNA with the help of anti-DNA antibodies. Both parameters are analyzed using quantitative fluorescence microscopy. Additionally, mitochondria are visualized with a specific dye. To demonstrate the specificity of the protocol, BrdU staining was tested on cells devoid of mtDNA (rho0 cells), on HeLa cells upon the silencing of well-known mtDNA maintenance factors, and on HeLa cells after treatment with an mtDNA replication inhibitor. The mtDNA levels were also measured by an independent method, namely qPCR.

Autor im Rampenlicht: Bildbasierte Hochdurchsatz-Quantifizierung der mitochondrialen DNA-Synthese und -Verteilung  

Bildbasierte Hochdurchsatz-Quantifizierung der mitochondrialen DNA-Synthese und -Verteilung

The protocol aims to identify proteins with dysfunction leads to changes in the number of mitochondrial DNA molecules. This research may also reveal the factors involving the distribution of mitochondrial DNA within the mitochondria. Mitochondrial replication and maintenance mechanisms are still not fully understood.Much less is known about regulating the distribution of mitochondrial genomes within organoids and the proteins involved in it. As a result, identifying and characterizing some new players will be of great importance. The main advantage of the technique is its high-throughput and high content protocol.We can simultaneously test many experimental conditions and measure various parameters during a single experiment. In genome-wide studies, the proposed protocol provides an opportunity to outline a global picture of how nuclear encoded genetic information regulates its mitochondrial counterpart. Additionally, it has the potential to identify proteins whose dysfunction causes mitochondrial DNA stress and activates the interferon response pathway.

Ein Schema des Verfahrens für die Hochdurchsatzuntersuchung der Dynamik der mtDNA-Synthese und -Verteilung ist in Abbildung 1 dargestellt. Die Verwendung eines Multi-Well-Plattenformats ermöglicht die gleichzeitige Analyse vieler verschiedener experimenteller Bedingungen, wie z.B. das Silencing verschiedener Gene mit Hilfe einer siRNA-Bibliothek. Die Bedingungen, die für die Markierung neu synthetisierter DNA-Moleküle mit BrdU verwendet werden, ermöglichen den Nachweis von BrdU-markiert...

Watch this Scientific Journal Video about High-Throughput Image-Based Quantification of Mitochondrial DNA Synthesis and Distribution at JoVE.com

Es wird ein Verfahren zur Untersuchung der Dynamik des mitochondrialen DNA-Stoffwechsels (mtDNA) in Zellen unter Verwendung eines Multi-Well-Plattenformats und automatisierter Immunfluoreszenzbildgebung zum Nachweis und zur Quantifizierung der mtDNA-Synthese und -Verteilung beschrieben. Dies kann weiter genutzt werden, um die Auswirkungen verschiedener Inhibitoren, zellulärer Belastungen und Genstilllegung auf den mtDNA-Stoffwechsel zu untersuchen.

The vast majority of cellular processes require a continuous supply of energy, the most common carrier of which is the ATP molecule. Eukaryotic cells ...

Das Protokoll zielt darauf ab, Proteine zu identifizieren, deren Dysfunktion zu Veränderungen in der Anzahl der mitochondrialen DNA-Moleküle führt. Diese Forschung könnte auch die Faktoren aufdecken, die an der Verteilung der mitochondrialen DNA innerhalb der Mitochondrien beteiligt sind. Die mitochondrialen Replikations- und Erhaltungsmechanismen sind noch nicht vollständig verstanden.Viel weniger ist über die Regulation der Verteilung von mitochondrialen Genomen innerhalb von Organoiden und den daran beteiligten Proteinen bekannt. Daher wird es von großer Bedeutung sein, einige neue Spieler zu identifizieren und zu charakterisieren. Der Hauptvorteil der Technik ist ihr hoher Durchsatz und ihr High-Content-Protokoll.Wir können gleichzeitig viele Versuchsbedingungen testen und verschiedene Parameter während eines einzigen Experiments messen. In genomweiten Studien bietet das vorgeschlagene Protokoll die Möglichkeit, ein globales Bild davon zu zeichnen, wie nukleär kodierte genetische Information ihr mitochondriales Gegenstück reguliert. Darüber hinaus hat es das Potenzial, Proteine zu identifizieren, deren Dysfunktion mitochondrialen DNA-Stress verursacht und den Interferon-Antwortweg aktiviert.

high-throughput-image-based-quantification-mitochondrial-dna

Research

JoVE Journal

Biochemistry

High-Throughput Image-Based Quantification of Mitochondrial DNA Synthesis and Distribution

1.5K Aufrufe.  University of Warsaw. Das Protokoll zielt darauf ab, Proteine zu identifizieren, deren Dysfunktion zu Veränderungen in der Anzahl der mitochondrialen DNA-Moleküle führt. Diese Forschung könnte auch die Faktoren aufdecken, die an der Verteilung der mitochondrialen DNA innerhalb der Mitochondrien beteiligt sind. Die mitochondrialen Replikations- und Erhaltungsmechanismen sind noch nicht vollständig verstanden.Viel weniger ist über die Regulation der Verteilung von mitochondrialen Genomen innerhalb von O...

Serie: Autor im Rampenlicht: Bildbasierte Hochdurchsatz-Quantifizierung der mitochondrialen DNA-Synthese und -Verteilung  

The vast majority of cellular processes require a continuous supply of energy, the most common carrier of which is the ATP molecule. Eukaryotic cells produce most of their ATP in the mitochondria by oxidative phosphorylation. Mitochondria are unique organelles because they have their own genome that is replicated and passed on to the next generation of cells. In contrast to the nuclear genome, there are multiple copies of the mitochondrial genome in the cell. The detailed study of the mechanisms responsible for the replication, repair, and maintenance of the mitochondrial genome is essential for understanding the proper functioning of mitochondria and whole cells under both normal and disease conditions. Here, a method that allows the high-throughput quantification of the synthesis and distribution of mitochondrial DNA (mtDNA) in human cells cultured in vitro is presented. This approach is based on the immunofluorescence detection of actively synthesized DNA molecules labeled by 5-bromo-2'-deoxyuridine (BrdU) incorporation and the concurrent detection of all the mtDNA molecules with anti-DNA antibodies. Additionally, the mitochondria are visualized with specific dyes or antibodies. The culturing of cells in a multi-well format and the utilization of an automated fluorescence microscope make it easier to study the dynamics of mtDNA and the morphology of mitochondria under a variety of experimental conditions in a relatively short time.

A procedure for studying the dynamics of mitochondrial DNA (mtDNA) metabolism in cells using a multi-well plate format and automated immunofluorescence imaging to detect and quantify mtDNA synthesis and distribution is described. This can be further used to investigate the effects of various inhibitors, cellular stresses, and gene silencing on mtDNA metabolism.

Forschung

Biochemie

Preparation of siRNA Mixture for Mitochondrial DNA Synthesis

To begin, prepare a 140 nano molar mix of small interfering RNA or siRNA by diluting the siRNA in optimum medium. Add the five microliters of the diluted mix to the wells of a black 384 well cell culture microplate. Prepare the appropriate amount of RNAiMAX transfection reagent solution in optimum medium and add 10 microliters to each well of the 384 well plate with a reagent dispenser.

Herstellung einer siRNA-Mischung für die mitochondriale DNA-Synthese

Cell Transfection and 5-Bromo-2&#39;-Deoxyuridine (BrdU) Incorporation in HeLa Cells

Cell Transfection and 5-Bromo-2&#039;-Deoxyuridine (BrdU) Incorporation in HeLa Cells  

To begin the cell transfection, add 20 microliters of the HeLa cell suspension to the 384-well plate wells containing diluted siRNA to seed 700 HeLa cells per well. After one hour of incubation at room temperature, place the well plate in an incubator for 72 hours at 37 degrees Celsius and 5%carbon dioxide. To incorporate BrdU in the transfected cells, add 10 microliters of 90-micromolar BrdU solution to each well after 56 hours of siRNA transfection.Incubate the cells for 16 hours at 37 degrees Celsius and 5%carbon dioxide. The specificity of BrdU incorporation into the mitochondrial DNA of HeLa cells was studied using rho0 cells lacking mitochondrial DNA.

Zelltransfektion und Einbau von 5-Brom-2&#39;-Desoxyuridin (BrdU) in HeLa-Zellen

5-Bromo-2&#39;-Deoxyuridine (BrdU) Labeling of Mitochondrial DNA in HeLa Cells

5-Bromo-2&#039;-Deoxyuridine (BrdU) Labeling of Mitochondrial DNA in HeLa Cells  

To begin the mitochondria labeling prepare a 20 micromolar solution of BrdU in DMEM with 10%fetal bovine serum or FBS. Then add the mitochondria tracking dye to adjust the final concentration to 1.1 micromolar. After 15 hours add 10 microliters of the mitochondria tracking dye solution to the HeLa cell suspension containing wells.Incubate the cells for one hour. The conditions used to label newly synthesized DNA molecules with BrdU allowed the detection of BrdU labeled DNA in the mitochondria of HeLa cells. The signal obtained with anti-BrdU antibodies was specific and only observed in cells treated with BrdU.Regardless of BrdU treatment no anti-BrdU or anti-DNA antibody signal was detected in the mitochondria of row zero cells. Quantifying the fluorescent signal from the anti-BrdU antibodies indicated that row zero cells treated with BrdU showed the same low level of fluorescence as the BrdU untreated cells, while the signal for the parental lines A549 and HeLa were 50 fold higher.

5-Brom-2&#39;-Desoxyuridin (BrdU) Markierung von mitochondrialer DNA in HeLa-Zellen

HeLa Cell Fixation with Hoechst 33342 and Blocking

To begin the HeLa cell fixation, rinse the HeLa cell-containing 384-well plate two times with 100 microliters of PBS using the microplate washer. Leave 25 microliters of PBS in the well after the second wash and add 25 microliters of an 8%formaldehyde solution. Incubate the plate in the dark at room temperature for 30 minutes.Then, rinse each well four times with 100 microliters of PBS and leave 25 microliters of PBS in the well after the last wash. Add 25 microliters of 6%bovine serum albumin, or BSA, in PBS to each well and incubate the plate in the dark for 30 minutes.

HeLa Zellfixierung mit Hoechst 33342 und Blockierung

Addition of Primary and Secondary Antibodies to the Transfected HeLa Cells to Monitor the mtDNA Distribution

To begin the addition of the primary antibody, aspirate the bovine serum albumin or BSA from the fixed and blocked transfected HeLa cells leaving 10 microliters of BSA solution in the well. Then add 10 microliters of the primary antibody solution prepared in 3%BSA in PBS and incubate the plate in the dark at four degrees Celsius overnight. After the incubation, rinse each well four times with 100 microliters of PBS, leaving 10 microliters after the last wash.Next, add 10 microliters of secondary antibody solution to the 384 well plate. Use isotype specific antibodies conjugated to fluorochromes, such as Alexa Fluor 488 and Alexa Fluor 555. After incubating the plate in the dark for one hour, rinse each well four times with 100 microliters of PBS and leave 50 microliters of PBS in the well after the last wash.The use of anti-DNA antibodies allowed the monitoring of the mitochondrial DNA distribution in the cell under the given experimental conditions. The downregulation of mitochondrial transcription factor A TFAM led to drastic changes in the mitochondrial DNA distribution with fewer mitochondrial DNA spots than in control cells. Quantifying the mean fluorescent signal from the anti-DNA antibody showed a several fold increase upon TFAM silencing compared to the other conditions tested.

Zugabe von primären und sekundären Antikörpern zu den transfizierten HeLa-Zellen zur Überwachung der mtDNA-Verteilung

Quantitative Image Analysis to Measure the mtDNA and Gene Expression Levels in the Transfected HeLa Cells

To begin the imaging of transfected HeLa cells select a sufficiently long exposure time for the individual fluorescence channels in live view mode based on the intensity histograms generated by the imaging software. Set the appropriate number of planes for imaging on the Z axis. Select the appropriate number of fields of view to display per well.To start the quantitative analysis of acquired images, perform background correction for all the images from all the fluorescence channels. Depending on the size of the analyzed objects, select the appropriate filter size. Next, start the image segmenting by creating a mask of the main object based on the ratio of the intensity of the fluorescent signal to the background for the channel corresponding to the cell nuclei.Create masks for the sub objects representing BrdU and mitochondrial DNA spots using the fluorescence channels appropriate for the given structures. Set the parameters and measure the intensity of the individual pixels within each mask for all the fluorescence channels. To obtain the total fluorescence intensities for the BrdU or mitochondrial DNA channel sum up the intensities of all the sub objects assigned to a given cell nucleus.To obtain the mean fluorescence intensity, divide the total fluorescence intensity by the sum of the area of the sub objects assigned to a given cell nucleus. The imaging results were verified by measuring the mitochondrial DNA and gene expression levels using quantitative real-time PCR. Treatment with dideoxycytidine or DDC resulted in a very strong decrease in the mitochondrial DNA levels.A weaker effect was observed in TFAM and TWINKLE helicase silencing, while the transfection of cells with mitochondrial DNA polymerase gamma or POLG siRNA had a modest effect on the mitochondrial DNA copy number. Quantifying the TFAM and TWINKLE helicase expression confirmed an efficient reduction in their mRNA expression to approximately 15 to 20%of the control levels. In POLG, the mRNA expression was reduced only to 30%which explains the unexpected modest effect on the mitochondrial DNA copy number.