Name: ultrasound-guided induced pluripotent stem cell-derived cardiomyocyte implantation in myocardial infarcted mice
Uploaded: 2022-03-30T15:00:00
Description: Watch this Scientific Journal Video about Ultrasound-Guided Induced Pluripotent Stem Cell-Derived Cardiomyocyte Implantation in Myocardial Infarcted Mice at JoVE.com

This work was supported by the Major Research Plan of the National Natural Science Foundation of China (No. 91539111to JY), Key Project of Science and Technology of Hunan Province (No. 2020SK53420 to JY) and The Science and Technology Innovation Program of Hunan Province (2021RC2106 to CF).

All animal experiments in this study were reviewed and approved by the ethics committee of the Second Xiangya Hospital of Central South University. See the Table of Materials for details regarding all the materials and equipment used in this protocol. The timelines for cell injection, imaging and euthansia are as follows: t0- induce infarction, t1 week- image and implant cells, t2 weeks- image and implant cells, t4 weeks- final imaging, euthanasia and tissue collection.&#160;
<s...

<ol>
	<li>Leuschner, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+monocyte+kinetics+in+acute+myocardial+infarction+are+sustained+by+extramedullary+monocytopoiesis.">Rapid monocyte kinetics in acute myocardial infarction are sustained by extramedullary monocytopoiesis.</a> The Journal of Experimental Medicine. 209 (1), 123-137 (2012).</li><li>L&#225;z&#225;r, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiomyocyte+renewal+in+the+human+heart:+insights+from+the+fall-out.">Cardiomyocyte renewal in the human heart: insights from the fall-out.</a> European Heart Journal. 38 (30), 2333-2342 (2017).</li><li>Davis, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=State+of+the+art:+cardiac+transplantation.">State of the art: cardiac transplantation.</a> Trends in Cardiovascular Medicine. 24 (8), 341-349 (2014).</li><li>Mancini, D., Colombo, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Left+ventricular+assist+devices:+A+rapidly+evolving+alternative+to+transplant.">Left ventricular assist devices: A rapidly evolving alternative to transplant.</a> Journal of the American College of Cardiology. 65 (23), 2542-2555 (2015).</li><li>Zimmermann, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translating+myocardial+remuscularization.">Translating myocardial remuscularization.</a> Circulation Research. 120 (2), 278-281 (2017).</li><li>Hu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+large-scale+investigation+of+hypoxia-preconditioned+allogeneic+mesenchymal+stem+cells+for+myocardial+repair+in+nonhuman+primates:+Paracrine+activity+without+remuscularization.">A large-scale investigation of hypoxia-preconditioned allogeneic mesenchymal stem cells for myocardial repair in nonhuman primates: Paracrine activity without remuscularization.</a> Circulation Research. 118 (6), 970-983 (2016).</li><li>Kempf, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiac+differentiation+of+human+pluripotent+stem+cells+in+scalable+suspension+culture.">Cardiac differentiation of human pluripotent stem cells in scalable suspension culture.</a> Nature Protocols. 10 (9), 1345-1361 (2015).</li><li>Chong, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+embryonic-stem-cell-derived+cardiomyocytes+regenerate+non-human+primate+hearts.">Human embryonic-stem-cell-derived cardiomyocytes regenerate non-human primate hearts.</a> Nature. 510 (7504), 273-277 (2014).</li><li>Shiba, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allogeneic+transplantation+of+iPS+cell-derived+cardiomyocytes+regenerates+primate+hearts.">Allogeneic transplantation of iPS cell-derived cardiomyocytes regenerates primate hearts.</a> Nature. 538 (7625), 388-391 (2016).</li><li>Nguyen, P. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potential+strategies+to+address+the+major+clinical+barriers+facing+stem+cell+regenerative+therapy+for+cardiovascular+disease:+A+review.">Potential strategies to address the major clinical barriers facing stem cell regenerative therapy for cardiovascular disease: A review.</a> JAMA Cardiology. 1 (8), 953-962 (2016).</li><li>Zimmermann, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Remuscularization+of+the+failing+heart.">Remuscularization of the failing heart.</a> The Journal of Physiology. 595 (12), 3685-3690 (2017).</li><li>Hu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transplantation+of+hypoxia-preconditioned+mesenchymal+stem+cells+improves+infarcted+heart+function+via+enhanced+survival+of+implanted+cells+and+angiogenesis.">Transplantation of hypoxia-preconditioned mesenchymal stem cells improves infarcted heart function via enhanced survival of implanted cells and angiogenesis.</a> The Journal of Thoracic and Cardiovascular Surgery. 135 (4), 799-808 (2008).</li><li>Feng, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heat+shock+improves+Sca-1++stem+cell+survival+and+directs+ischemic+cardiomyocytes+toward+a+prosurvival+phenotype+via+exosomal+transfer:+a+critical+role+for+HSF1/miR-34a/HSP70+pathway.">Heat shock improves Sca-1+ stem cell survival and directs ischemic cardiomyocytes toward a prosurvival phenotype via exosomal transfer: a critical role for HSF1/miR-34a/HSP70 pathway.</a> Stem Cells. 32 (2), 462-472 (2014).</li><li>Fan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiomyocytes+from+CCND2-overexpressing+human+induced-pluripotent+stem+cells+repopulate+the+myocardial+scar+in+mice:+A+6-month+study.">Cardiomyocytes from CCND2-overexpressing human induced-pluripotent stem cells repopulate the myocardial scar in mice: A 6-month study.</a> Journal of Molecular and Cellular Cardiology. 137, 25-33 (2019).</li><li>Lou, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-cadherin+overexpression+enhances+the+reparative+potency+of+human-induced+pluripotent+stem+cell-derived+cardiac+myocytes+in+infarcted+mouse+hearts.">N-cadherin overexpression enhances the reparative potency of human-induced pluripotent stem cell-derived cardiac myocytes in infarcted mouse hearts.</a> Cardiovascular Research. 116 (3), 671-685 (2020).</li><li>Sun, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transplanted+microvessels+improve+pluripotent+stem+cell-derived+cardiomyocyte+engraftment+and+cardiac+function+after+infarction+in+rats.">Transplanted microvessels improve pluripotent stem cell-derived cardiomyocyte engraftment and cardiac function after infarction in rats.</a> Science Translational Medicine. 12 (562), (2020).</li><li>Wu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiac+repair+with+echocardiography-guided+multiple+percutaneous+left+ventricular+intramyocardial+injection+of+hiPSC-CMs+after+myocardial+infarction.">Cardiac repair with echocardiography-guided multiple percutaneous left ventricular intramyocardial injection of hiPSC-CMs after myocardial infarction.</a> Frontiers in Cardiovascular Medicine. 8, 768873 (2021).</li><li>Kannappan, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functionally+competent+DNA+damage-free+induced+pluripotent+stem+cell-derived+cardiomyocytes+for+myocardial+repair.">Functionally competent DNA damage-free induced pluripotent stem cell-derived cardiomyocytes for myocardial repair.</a> Circulation. 140 (6), 520-522 (2019).</li><li>Lou, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-cadherin+overexpression+enhances+the+reparative+potency+of+human-induced+pluripotent+stem+cell-derived+cardiac+myocytes+in+infarcted+mouse+hearts.">N-cadherin overexpression enhances the reparative potency of human-induced pluripotent stem cell-derived cardiac myocytes in infarcted mouse hearts.</a> Cardiovascular Research. 116 (3), 671-685 (2020).</li><li>Zhao, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Y-27632+preconditioning+enhances+transplantation+of+human-induced+pluripotent+stem+cell-derived+cardiomyocytes+in+myocardial+infarction+mice.">Y-27632 preconditioning enhances transplantation of human-induced pluripotent stem cell-derived cardiomyocytes in myocardial infarction mice.</a> Cardiovascular Research. 115 (2), 343-356 (2019).</li><li>Zhao, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancing+the+engraftment+of+human+induced+pluripotent+stem+cell-derived+cardiomyocytes+via+a+transient+inhibition+of+rho+kinase+activity.">Enhancing the engraftment of human induced pluripotent stem cell-derived cardiomyocytes via a transient inhibition of rho kinase activity.</a> Journal of Visualized Experiments: JoVE. (149), e59452 (2019).</li><li>O'Brien, J., Hayder, H., Peng, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Automated+quantification+and+analysis+of+cell+counting+procedures+using+ImageJ+plugins.">Automated quantification and analysis of cell counting procedures using ImageJ plugins.</a> Journal of Visualized Experiments: JoVE. (117), e54719 (2016).</li><li>Kain, V., Prabhu, S. D., Halade, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammation+revisited:+inflammation+versus+resolution+of+inflammation+following+myocardial+infarction.">Inflammation revisited: inflammation versus resolution of inflammation following myocardial infarction.</a> Basic Research in Cardiology. 109 (6), 444 (2014).</li><li>Rainer, P. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiomyocyte-specific+transforming+growth+factor+&#946;+suppression+blocks+neutrophil+infiltration,+augments+multiple+cytoprotective+cascades,+and+reduces+early+mortality+after+myocardial+infarction.">Cardiomyocyte-specific transforming growth factor &#946; suppression blocks neutrophil infiltration, augments multiple cytoprotective cascades, and reduces early mortality after myocardial infarction.</a> Circulation Research. 114 (8), 1246-1257 (2014).</li><li>Yu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+embryonic+stem+cell-derived+cardiomyocyte+therapy+in+mouse+permanent+ischemia+and+ischemia-reperfusion+models.">Human embryonic stem cell-derived cardiomyocyte therapy in mouse permanent ischemia and ischemia-reperfusion models.</a> Stem Cell Research &amp; Therapy. 10 (1), 167 (2019).</li><li>Iwanaga, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+G-CSF+on+cardiac+remodeling+after+acute+myocardial+infarction+in+swine.">Effects of G-CSF on cardiac remodeling after acute myocardial infarction in swine.</a> Biochemical and Biophysical Research Communications. 325 (4), 1353-1359 (2004).</li></ol>

The critical steps of this study include hiPSC culture, cardiomyocyte differentiation, hiPSC-CM purification, and hiPSC-CM transplantation into the mouse myocardial infarction site. The key is to use cardiac ultrasound to transcutaneously guide treatment toward the infarct site at the edge of the infarction where hiPSC-CMs were injected into the area.
With the prolongation of culture time, the hiPSC-CM phenotype changes in morphology (larger cell size), structure (muscle, fibril density, arran...

When acute MI occurs, myocardial cells in the infarcted area die quickly due to ischemia and hypoxia. Several inflammatory factors are released after cell death and rupture, while inflammatory cells infiltrate the infarcted site to cause inflammation1. Significantly, fibroblasts and collagen, both without contractility and electrical conductivity, replace the myocardial cells in the infarcted site to form scar tissue. Due to the limited regeneration capacity of cardiomyocytes in adult mammals, viable tissue formed after a large area of infarction is usually not adequate for maintaining sufficient cardiac output2. MI causes heart failure, and in severe cases of heart failure, patients can only rely on heart transplants or ventricular assist devices to maintain normal heart functions3,4.
After MI, the ideal treatment strategy is to replace the dead cardiomyocytes with newly formed cardiomyocytes, forming electromechanical coupling with healthy tissues. However, treatment options have typically adopted myocardial salvage rather than replacement. Currently, stem cell- and progenitor cell-based therapies are among the most promising strategies to promote myocardial repair after MI5. However, the transplantation of these cells has several issues, primarily the inability of adult stem cells to differentiate into cardiomyocytes and their short life span6.
The ethical issues related to the use of embryonic stem (ES) cells can be circumvented by iPSCs, which are a promising source of cells. In addition, iPSCs possess strong self-renewal capabilities and can differentiate into cardiomyocytes7. Studies have shown that hiPSC-CMs transplanted into the MI site can survive and form gap junctions with host cells8,9. However, because these transplanted cells are located in the microenvironment of ischemia and inflammation, their survival rate is extremely low10,11.
Several methods have been established to improve the survival rate of transplanted cells, such as hypoxia and heat shock pretreatment of transplanted cells12,13, genetic modification14,15, and the simultaneous transplantation of cells and capillaries16. Unfortunately, most methods are limited by complexity and high cost. Hence, the present study proposes a reproducible, convenient, relatively invasive, and effective hiPSC-CM delivery method.
Ultrasound-guided intramyocardial cell injection can be carried out with only a high-resolution small veterinary ultrasound machine and a microinjector, regardless of the site. Under ultrasound guidance, directly delivering cells under the xiphoid process from the pericardium into the myocardium in mice is a safe protocol that avoids liver and lung damage. This method can be combined simultaneously with other technologies to significantly improve the survival rate of transplanted cells.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Antibody</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Cardiac troponin T</td>
			<td>Abcam</td>
			<td>ab8295</td>
			<td></td>
		</tr>
		<tr>
			<td>Donkey Anti-Mouse IgG H&#38;L (Alexa Fluor 488)</td>
			<td>Abcam</td>
			<td>ab150105</td>
			<td></td>
		</tr>
		<tr>
			<td>Donkey Anti-Mouse IgG H&#38;L (Alexa Fluor 555)</td>
			<td>Abcam</td>
			<td>ab150110</td>
			<td></td>
		</tr>
		<tr>
			<td>Donkey Anti-Rabbit IgG H&#38;L (Alexa Fluor 488)</td>
			<td>Abcam</td>
			<td>ab150073</td>
			<td></td>
		</tr>
		<tr>
			<td>Donkey Anti-Rabbit IgG H&#38;L (Alexa Fluor 555)</td>
			<td>Abcam</td>
			<td>ab150062</td>
			<td></td>
		</tr>
		<tr>
			<td>Human cardiac troponin T</td>
			<td>Abcam</td>
			<td>ab91605</td>
			<td></td>
		</tr>
		<tr>
			<td>Isolectin B4</td>
			<td>Vector</td>
			<td>FL-1201</td>
			<td></td>
		</tr>
		<tr>
			<td>Sarcomeric alpha actinin</td>
			<td>Abcam</td>
			<td>ab9465</td>
			<td></td>
		</tr>
		<tr>
			<td>Wheat germ agglutinin</td>
			<td>Thermo Fisher Scientific</td>
			<td>W11261</td>
			<td></td>
		</tr>
		<tr>
			<td>Reagent</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Accutase</td>
			<td>Thermo Fisher Scientific</td>
			<td>00-4555-56</td>
			<td></td>
		</tr>
		<tr>
			<td>B27 Supplement(minus insulin)</td>
			<td>Thermo Fisher Scientific</td>
			<td>A1895601</td>
			<td></td>
		</tr>
		<tr>
			<td>B27 Supplement(serum free)</td>
			<td>Thermo Fisher Scientific</td>
			<td>17&#8211;504-044</td>
			<td></td>
		</tr>
		<tr>
			<td>Bouin&#39;s solution</td>
			<td>Thermo Fisher Scientific</td>
			<td>SDHT10132</td>
			<td></td>
		</tr>
		<tr>
			<td>CHIR99021</td>
			<td>Selleck</td>
			<td>CT99021</td>
			<td></td>
		</tr>
		<tr>
			<td>cyclosporin A</td>
			<td>Medchemexpress</td>
			<td>HY-B0579</td>
			<td></td>
		</tr>
		<tr>
			<td>DIRECT RED</td>
			<td>Sigma-Aldrich</td>
			<td>365548-25G</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM/F12</td>
			<td>Thermo Fisher Scientific</td>
			<td>11320033</td>
			<td></td>
		</tr>
		<tr>
			<td>DNeasy Blood &#38; Tissue Kit</td>
			<td>Qiagen</td>
			<td>69504</td>
			<td></td>
		</tr>
		<tr>
			<td>FAST GREEN FCF</td>
			<td>Sigma-Aldrich</td>
			<td>&#160;F7252-5G</td>
			<td></td>
		</tr>
		<tr>
			<td>Glucose-free RPMI 1640</td>
			<td>Thermo Fisher Scientific</td>
			<td>11879020</td>
			<td></td>
		</tr>
		<tr>
			<td>IWR1</td>
			<td>Selleck</td>
			<td>S7086</td>
			<td></td>
		</tr>
		<tr>
			<td>lactic acid</td>
			<td>Sigma-Aldrich</td>
			<td>L6661</td>
			<td></td>
		</tr>
		<tr>
			<td>Matrigel</td>
			<td>BD Biosciences</td>
			<td>BD356234</td>
			<td></td>
		</tr>
		<tr>
			<td>mTeSR1</td>
			<td>Stem Cell Technologies</td>
			<td>72562</td>
			<td></td>
		</tr>
		<tr>
			<td>O.C.T. Compound</td>
			<td>SAKURA</td>
			<td>4583</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraformaldehyde</td>
			<td>Sigma-Aldrich</td>
			<td>158127</td>
			<td></td>
		</tr>
		<tr>
			<td>PowerUP SYBR Green MasterMix kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>A25742</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI1640</td>
			<td>Thermo Fisher Scientific</td>
			<td>11875119</td>
			<td></td>
		</tr>
		<tr>
			<td>STEMdif Cardiomyocyte Freezing Medium/STEMdiff</td>
			<td>Stem Cell Technologies</td>
			<td>5030</td>
			<td></td>
		</tr>
		<tr>
			<td>STEMdiff Cardiomyocyte Support Medium</td>
			<td>Stem Cell Technologies</td>
			<td>5027</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma-Aldrich</td>
			<td>T8787</td>
			<td></td>
		</tr>
		<tr>
			<td>ultrasound coupling agent</td>
			<td>CARENT</td>
			<td>22396269389</td>
			<td></td>
		</tr>
		<tr>
			<td>Y-27632</td>
			<td>Selleck</td>
			<td>S6390</td>
			<td></td>
		</tr>
		<tr>
			<td>Equipment and Supplies</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Applied Biosystems</td>
			<td>Thermo Fisher Scientific</td>
			<td>7500 Real-Time PCR</td>
			<td></td>
		</tr>
		<tr>
			<td>cryostat</td>
			<td>Leica</td>
			<td>CM1950</td>
			<td></td>
		</tr>
		<tr>
			<td>fluoresence microscope</td>
			<td>Olympus</td>
			<td>IX83</td>
			<td></td>
		</tr>
		<tr>
			<td>fine anatomical scissors</td>
			<td>Fine Science Tools</td>
			<td>15000-08</td>
			<td></td>
		</tr>
		<tr>
			<td>fine dissecting forceps</td>
			<td>Fine Science Tools</td>
			<td>11255-20</td>
			<td></td>
		</tr>
		<tr>
			<td>Micro syringe</td>
			<td>Hamilton</td>
			<td>7633</td>
			<td></td>
		</tr>
		<tr>
			<td>Small animal anesthesia machine</td>
			<td>MATRX</td>
			<td>VMR</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultra-high resolution small animal ultrasound imaging system</td>
			<td>VisualSonics</td>
			<td>Vevo 2100</td>
			<td></td>
		</tr>
		<tr>
			<td>Software</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Statistical Product and Service Solutions</td>
			<td>IBM</td>
			<td>21</td>
			<td></td>
		</tr>
		<tr>
			<td>Image J</td>
			<td>NIH</td>
			<td>1.48</td>
			<td></td>
		</tr>
		<tr>
			<td>Human mitochondrial DNA primers</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>the forward primer sequence</td>
			<td>CCGCTACCATAATCATCGCTAT</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>the reverse primer sequence</td>
			<td>TGCTAATACAATGCCAGTCAGG</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

ultrasound-guided induced pluripotent stem cell-derived cardiomyocyte implantation in myocardial infarcted mice

The key objective of cell therapy after myocardial infarction (MI) is to effectively enhance the cell grafted rate, and human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) are a promising cell source for cardiac repair after ischemic damage. However, a low grafted rate is a significant obstacle for effective cardiac tissue regeneration after transplantation. This protocol shows that multiple hiPSC-CM ultrasound-guided percutaneous injections into an MI area effectively increase cell transplantation rates. The study also describes the entire hiPSC-CM culture process, pretreatment, and ultrasound-guided percutaneous delivery methods. In addition, the use of human mitochondrial DNA help detect the absence of hiPSC-CMs in other mouse organs. Lastly, this paper describes the changes in cardiac function, angiogenesis, cell size, and apoptosis at the infarcted border zone in mice 4 weeks after cell delivery. It can be concluded that echocardiography-guided percutaneous injection of the left ventricular myocardium is a feasible, relatively invasive, satisfactory, repeatable, and effective cellular therapy.

Echocardiography for evaluation of the left ventricular function of the mice in each group revealed that the MI injuries were effectively reversed in the MD group (Figure 2A). Compared with the MI group, the SD group showed increased ejection fraction (EF) (from 30% to 35%; Figure 2B) and fraction shortening (FS) (from 18% to 22%; Figure 2C) after MI. However, it is even more crucial to note that multiple injections of the hiPSC-CMs...

Watch this Scientific Journal Video about Ultrasound-Guided Induced Pluripotent Stem Cell-Derived Cardiomyocyte Implantation in Myocardial Infarcted Mice at JoVE.com

Ultrasound-Guided Induced Pluripotent Stem Cell-Derived Cardiomyocyte Implantation in Myocardial Infarcted Mice

Ultrasound-guided cell delivery around the site of myocardial infarction in mice is a safe, effective, and convenient way of cell transplantation.

The key objective of cell therapy after myocardial infarction (MI) is to effectively enhance the cell grafted rate, and human induced pluripotent stem ...

This is the first report demonstrating that echocardiography-guided, percutaneous intramyocardial injection of cardiomyocytes significantly enhance the reparative property of human iPS-derived cardiomyocytes. This method is feasible, satisfactory, repeatable less invasive and effective procedure for delivering human iPS-derived cardiomyocytes therapy. We believe that percutaneous intramyocardial delivery is a safe and efficient method for local drug delivery for diseases including ischemic heart disease, myocardial infarction, and heart failure.This project is supervised by Professor Jinfu Yang and Professor Jun Peng. demonstrating the procedure will be Xun Wu, Kele Qin, and Kun Xiang, MD PhDs from my laboratory and Di Wang, a PhD from Hunan Provincial Key Laboratory of Cardiovascular Research. To begin, vacuum aspirate the culture supernatant from a 60-day culture of hiPSC-CMs.Wash the cells with PBS thrice. Then dissociate the hiPSC-CMs into individual cells using the cell detachment enzyme mixture at 37 degrees Celsius for three to five minutes. Collect the cells in a 15 milliliter tube containing five milliliters of RPMI plus B27 medium and mix.Count the cells and calculate the total number of cells. Centrifuge the cell suspension at 300G for two minutes at room temperature. Discard the supernatant and resuspend the pellet in cardiomyocyte support medium to a concentration of 6 x 10 of the 4th cells per microliter.Place the tube at 37 degrees Celsius til the injection step. After the mouse is sufficiently anesthetized, fix the limbs and tail with tape. Then, fix the mouse incisors with a 2/0 silk thread and tape.Sterilize the median neck and left chest with three alternating rounds of betaine followed by alcohol. Make a median neck incision using fine anatomical scissors and fine dissecting forceps. Cut off a few anterior cervical muscles to stabilize and fully expose the trachea.Insert a 20-gauge catheter puncture needle as a tracheal tube through the mouth. Connect the tracheal tube to the ventilator and check for thoracic movement to ensure both lungs are well-ventilated. Adjust the breathing parameters.Next, refix the left hind limb to the lower-right side and loosen the tape around the left upper limb. With fine dissecting scissors and forceps, perform a thoracotomy at the three to four intercostal space of the left thorax. Using forceps, peel off the pericardium and locate the left anterior descending coronary artery.Use a 6/0 silk thread to ligate the proximal end of the artery. To ensure that the acute myocardial infarction model is established, wait till the distal side of the artery at the ligation site changes from red to white. Close the chest layer by layer and suture the skin with 4/0 thread.For the sham group of animals, perform all the surgical procedures except for ligation. In the first two weeks following myocardial infarction, place the mice in an anesthesia box connected with 5%isofluorane and perform tracheal intubation. Three days before administering hiPSC-CMs, inject cyclosporine A into the intraperitoneal cavity at a dose of 10 milligrams per kilogram per day.Remove the hair from the chest and upper abdomen of the mouse with depilatory cream. Supply inhalation isofluorane til the heart rate is maintained at 400 to 500 beats per minute. Fix the mouse limbs and tail with tape on the detection console and set the platform temperature at 37 degrees Celsius.Apply the ultrasound jelly on the upper abdomen. Using a high resolution veterinary ultrasound probe, obtain mouse liver images. Using a five microliter micro syringe, draw approximately 3 x 10 to the 5th hiPSC-CMs.Hold the syringe and insert a three millimeter needle at the left paraxiphoid process. Under ultrasound guidance, follow the upper edge of the diaphragm. Observe the respiratory rhythm and range.Enter the pericardium at the end of the expiratory circle, avoiding damage to the liver and lung. Then acquire the parasternal long axis image of the mouse heart by B-mode echocardiography. Under ultrasonic guidance, inject 1 x 10 to the 5th hiPSC-CMs cells into each of the three marginal areas of the infarct site.Remove the ultrasound probe and rinse off the jelly. Wean the mouse off the anesthesia and return it to its cage. Inject cyclosporine A continuously for one month after transplantation.Echocardiogram of the left ventricle showed that the injuries due to myocardial infarction were reversed in the multiple dose group. Transplantation of hiPSC-CMs also resulted in increased ejection fraction and fraction shortening. Measurement of cardiac parameters using Sirius Red and Fast Green staining showed that the infarct size and collagen volume fraction decreased, whereas the left ventricular anterior wall thickness increased after transplantation.Labeling for non-specific alpha actin in green, DAPI in blue, and human-specific troponin T in red showed the presence of transplanted cells in infarct and marginal infarct area. The number and percentage of transplanted cells were higher in the multiple dose group compared to single dose. 28 days after myocardial infarction, the multiple dose group showed an increase in the number of cells expressing the endothelial cell marker, I-B4.Wheat germ agglutinin and sarcomeric alpha actinin staining on cardiomyocytes showed a reduction in the minimum fiber diameter. Lower number of tunnel positive cardiomyocyte nuclei in the multiple dose group indicated reduced apoptosis. PCR analysis detected the human mitochondrial DNA only in the heart, showing specific transplantation.When inserting the needle, make sure it enters the pericardial cavity along with the upper margin of diaphragm and at the end of the expiratory circle to avoid the injury to the liver or the lung.

ultrasound-guided-induced-pluripotent-stem-cell-derived-cardiomyocyte

Research

JoVE Journal

Medicine

Implantation of a Carotid Cuff for Triggering Shear-stress Induced Atherosclerosis in Mice

It is widely accepted that alterations in vascular shear stress trigger the expression of inflammatory genes in endothelial cells and thereby induce atherosclerosis (reviewed in 1 and 2). The role of shear stress has been extensively studied in vitro investigating the influence of flow dynamics on cultured endothelial cells 1,3,4 and in vivo in larger animals and humans 1,5,6,7,8. However, highly reproducible small animal models allowing systematic investigation of the influence of shear stress on plaque development are rare. Recently, Nam et al. 9 introduced a mouse model in which the ligation of branches of the carotid artery creates a region of low and oscillatory flow. Although this model causes endothelial dysfunction and rapid formation of atherosclerotic lesions in hyperlipidemic mice, it cannot be excluded that the observed inflammatory response is, at least in part, a consequence of endothelial and/or vessel damage due to ligation.
In order to avoid such limitations, a shear stress modifying cuff has been developed based upon calculated fluid dynamics, whose cone shaped inner lumen was selected to create defined regions of low, high and oscillatory shear stress within the common carotid artery 10. By applying this model in Apolipoprotein E (ApoE) knockout mice fed a high cholesterol western type diet, vascular lesions develop upstream and downstream from the cuff. Their phenotype is correlated with the regional flow dynamics 11 as confirmed by in vivo Magnetic Resonance Imaging (MRI) 12: Low and laminar shear stress upstream of the cuff causes the formation of extensive plaques of a more vulnerable phenotype, whereas oscillatory shear stress downstream of the cuff induces stable atherosclerotic lesions 11. In those regions of high shear stress and high laminar flow within the cuff, typically no atherosclerotic plaques are observed.
 
In conclusion, the shear stress-modifying cuff procedure is a reliable surgical approach to produce phenotypically different atherosclerotic lesions in ApoE-deficient mice.

The constricting cuff presented in this article is designed to induce atherosclerosis in the murine common carotid artery. Due to the conical shape of its inner lumen the implanted cuff generates well-defined regions of low, high and oscillatory shear stress triggering the development of atherosclerotic lesions of different inflammatory phenotypes.

It is widely accepted that alterations in vascular shear stress trigger the expression of inflammatory genes in endothelial cells and thereby induce ...

Isolation of Cardiomyocyte Nuclei from Post-mortem Tissue

Identification of cardiomyocyte nuclei has been challenging in tissue sections as most strategies rely only on cytoplasmic marker proteins1. Rare events in cardiac myocytes such as proliferation and apoptosis require an accurate identification of cardiac myocyte nuclei to analyze cellular renewal in homeostasis and in pathological conditions2. Here, we provide a method to isolate cardiomyocyte nuclei from post mortem tissue by density sedimentation and immunolabeling with antibodies against pericentriolar material 1 (PCM-1) and subsequent flow cytometry sorting. This strategy allows a high throughput analysis and isolation with the advantage of working equally well on fresh tissue and frozen archival material. This makes it possible to study material already collected in biobanks. This technique is applicable and tested in a wide range of species and suitable for multiple downstream applications such as carbon-14 dating3, cell-cycle analysis4, visualization of thymidine analogues (e.g. BrdU and IdU)4, transcriptome and epigenetic analysis.

Cardiac nuclei are isolated via density sedimentation and immunolabeled with antibodies against pericentriolar material 1 (PCM-1) to identify and sort cardiomyocyte nuclei by flow cytometry.

Identification of cardiomyocyte nuclei has been challenging in tissue sections as most strategies rely only on cytoplasmic marker proteins1. Rare events ...

Ultrasound-guided Transthoracic Intramyocardial Injection in Mice

Murine models of cardiovascular disease are important for investigating pathophysiological mechanisms and exploring potential regenerative therapies. Experiments involving myocardial injection are currently performed by direct surgical access through a thoracotomy. While convenient when performed at the time of another experimental manipulation such as coronary artery ligation, the need for an invasive procedure for intramyocardial delivery limits potential experimental designs. With ever improving ultrasound resolution and advanced noninvasive imaging modalities, it is now feasible to routinely perform ultrasound-guided, percutaneous intramyocardial injection. This modality efficiently and reliably delivers agents to a targeted region of myocardium. Advantages of this technique include the avoidance of surgical morbidity, the facility to target regions of myocardium selectively under ultrasound guidance, and the opportunity to deliver injectate to the myocardium at multiple, predetermined time intervals. With practiced technique, complications from intramyocardial injection are rare, and mice quickly return to normal activity on recovery from anesthetic. Following the steps outlined in this protocol, the operator with basic echocardiography experience can quickly become competent in this versatile, minimally invasive technique.

Echocardiography-guided percutaneous intramyocardial injection represents an efficient, reliable, and targetable modality for the delivery of gene transfer agents or cells into the murine heart. Following the steps outlined in this protocol, the operator can quickly become competent in this versatile, minimally invasive technique.

Murine models of cardiovascular disease are important for investigating pathophysiological mechanisms and exploring potential regenerative therapies. ...

Substernal Thyroid Biopsy Using Endobronchial Ultrasound-guided Transbronchial Needle Aspiration

Substernal thyroid goiter (STG) represents about 5.8% of all mediastinal lesions1. There is a wide variation in the published incidence rates due to the lack of a standardized definition for STG. Biopsy is often required to differentiate benign from malignant lesions. Unlike cervical thyroid, the overlying sternum precludes ultrasound-guided percutaneous fine needle aspiration of STG. Consequently, surgical mediastinoscopy is performed in the majority of cases, causing significant procedure related morbidity and cost to healthcare. Endobronchial Ultrasound-guided Transbronchial Needle Aspiration (EBUS-TBNA) is a frequently used procedure for diagnosis and staging of non-small cell lung cancer (NSCLC). Minimally invasive needle biopsy for lesions adjacent to the airways can be performed under real-time ultrasound guidance using EBUS. Its safety and efficacy is well established with over 90% sensitivity and specificity. The ability to perform EBUS as an outpatient procedure with same-day discharges offers distinct morbidity and financial advantages over surgery. As physicians performing EBUS gained procedural expertise, they have attempted to diversify its role in the diagnosis of non-lymph node thoracic pathologies. We propose here a role for EBUS-TBNA in the diagnosis of substernal thyroid lesions, along with a step-by-step protocol for the procedure.

Substernal thyroid lesions are common, and need to be differentiated from malignancy. Obtaining percutaneous fine needle biopsy is not possible due to its retrosternal location. This article proposes a protocol for biopsy of substernal thyroid lesions using Endobronchial Ultrasound-guided Transbronchial Needle Aspiration (EBUS-TBNA).

Substernal thyroid goiter (STG) represents about 5.8% of all mediastinal lesions1. There is a wide variation in the published incidence rates due to the ...

Targeted and Selective Treatment of Pluripotent Stem Cell-derived Teratomas Using External Beam Radiation in a Small-animal Model

The growing number of victims of &#34;stem cell tourism,&#34; the unregulated transplantation of stem cells worldwide, has raised concerns about the safety of stem cell transplantation. Although the transplantation of differentiated rather than undifferentiated cells is common practice, teratomas can still arise from the presence of residual undifferentiated stem cells at the time of transplant or from spontaneous mutations in differentiated cells. Because stem cell therapies are often delivered into anatomically sensitive sites, even small tumors can be clinically devastating, resulting in blindness, paralysis, cognitive abnormalities, and cardiovascular dysfunction. Surgical access to these sites may also be limited, leaving patients with few therapeutic options. Controlling stem cell misbehavior is, therefore, critical for the clinical translation of stem cell therapy.
External beam radiation offers an effective means of delivering targeted therapy to decrease the teratoma burden while minimizing injury to surrounding organs. Additionally, this method avoids genetic manipulation or viral transduction of stem cells-which are associated with additional clinical safety and efficacy concerns. Here, we describe a protocol to create pluripotent stem cell-derived teratomas in mice and to apply external beam radiation therapy to selectively ablate these tumors in vivo.

Research on treatment strategies for pluripotent stem cell-derived teratomas is important for the clinical translation of stem cell therapy. Here, we describe a protocol to, first, generate stem cell-derived teratomas in mice and, then, to selectively target and treat these tumors in vivo using a small-animal irradiator.

The growing number of victims of &#34;stem cell tourism,&#34; the unregulated transplantation of stem cells worldwide, has raised concerns about the ...

A Cryoinjury Model to Study Myocardial Infarction in the Mouse

The use of animal models is essential for developing new therapeutic strategies for acute coronary syndrome and its complications. In this article, we demonstrate a murine cryoinjury infarct model that generates precise infarct sizes with high reproducibility and replicability. In brief, after intubation and sternotomy of the animal, the heart is lifted from the thorax. The probe of a handheld liquid nitrogen delivery system is applied onto the myocardial wall to induce cryoinjury. Impaired ventricular function and electrical conduction can be monitored with echocardiography or optical mapping. Transmural myocardial remodeling of the infarcted area is characterized by collagen deposition and loss of cardiomyocytes. Compared to other models (e.g., LAD-ligation), this model utilizes a handheld liquid nitrogen delivery system to generate more uniform infarct sizes.

This article demonstrates a model to study cardiac remodeling after myocardial cryoinjury in mice.

The use of animal models is essential for developing new therapeutic strategies for acute coronary syndrome and its complications. In this article, we ...

Sarcomere Shortening of Pluripotent Stem Cell-Derived Cardiomyocytes using Fluorescent-Tagged Sarcomere Proteins.

Pluripotent stem cell-derived cardiomyocytes (PSC-CMs) can be produced from both embryonic and induced pluripotent stem (ES/iPS) cells. These cells provide promising sources for cardiac disease modeling. For cardiomyopathies, sarcomere shortening is one of the standard physiological assessments that are used with adult cardiomyocytes to examine their disease phenotypes. However, the available methods are not appropriate to assess the contractility of PSC-CMs, as these cells have underdeveloped sarcomeres that are invisible under phase-contrast microscopy. To address this issue and to perform sarcomere shortening with PSC-CMs, fluorescent-tagged sarcomere proteins and fluorescent live-imaging were used. Thin Z-lines and an M-line reside at both ends and the center of a sarcomere, respectively. Z-line proteins &#8212;&#160;&#945;-Actinin (ACTN2), Telethonin (TCAP), and actin-associated LIM protein (PDLIM3) &#8212; and one M-line protein &#8212; Myomesin-2 (Myom2) &#8212;&#160;were tagged with fluorescent proteins. These tagged proteins can be expressed from endogenous alleles as knock-ins or from adeno-associated viruses (AAVs). Here, we introduce the methods to differentiate mouse and human pluripotent stem cells to cardiomyocytes, to produce AAVs, and to perform and analyze live-imaging. We also describe the methods for producing polydimethylsiloxane (PDMS) stamps for a patterned culture of PSC-CMs, which facilitates the analysis of sarcomere shortening with fluorescent-tagged proteins. To assess sarcomere shortening, time-lapse images of the beating cells were recorded at a high framerate (50-100 frames per second) under electrical stimulation (0.5-1 Hz). To analyze sarcomere length over the course of cell contraction, the recorded time-lapse images were subjected to SarcOptiM, a plug-in for ImageJ/Fiji. Our strategy provides a simple platform for investigating cardiac disease phenotypes in PSC-CMs.

This method can be used to examine sarcomere shortening using pluripotent stem cell-derived cardiomyocytes with fluorescent-tagged sarcomere proteins.

Pluripotent stem cell-derived cardiomyocytes (PSC-CMs) can be produced from both embryonic and induced pluripotent stem (ES/iPS) cells. These cells ...

Endoscopic Ultrasound-Guided Biliary Drainage: Endoscopic Ultrasound-Guided Hepaticogastrostomy in Malignant Biliary Obstruction

Patients with unresectable malignant biliary obstruction often require biliary drainage to decompress the biliary system. Endoscopic Retrograde Cholangiopancreatography (ERCP) is the primary biliary drainage method whenever possible. Percutaneous Transhepatic Biliary Drainage (PTBD) is used as a salvage method if ERCP fails. Endoscopic Ultrasound-Guided Biliary Drainage (EUS-BD) provides a feasible alternative biliary drainage method where one of the methods is EUS guided Hepaticogastrostomy (EUS-HGS). Here we describe the EUS-HGS technique in a case of unresectable malignant hilar biliary obstruction to achieve biliary drainage.
Presented here is the case of a 71-year-old female with painless jaundice and weight loss for 2 weeks. Computed Tomography (CT) imaging showed a 4 x 5 cm hilar tumor with lymphadenopathy and liver metastasis. EUS fine needle biopsy (FNB) of the lesion was consistent with cholangiocarcinoma. Her bilirubin levels were 212 &#181;mol/L (&lt;15) during presentation.
A linear echoendoscope was used to locate the left dilated intrahepatic ducts (IHD) of the liver. The segment 3 dilated IHD was identified and punctured using a 19 G needle. Contrast was used to opacify the IHDs under fluoroscopic guidance. The IHD was cannulated using a 0.025-inch guidewire. This was followed by the dilation of the fistula tract using a 6 Fr electrocautery dilator along with a 4 mm biliary balloon dilator. A partially covered metallic stent of 10 cm in length was deployed under fluoroscopic guidance. The distal part opens in the IHD and the proximal part was deployed within the working channel of the echoendoscope that subsequently released into the stomach. The patient was discharged three days after the procedure. Follow up performed in the second and fourth weeks showed that the bilirubin levels were 30 &#181;mol/L and 14 &#181;mol/L, respectively. This indicates that EUS-HGS is a safe method for biliary drainage in unresectable malignant biliary obstruction.

Endoscopic Ultrasound-Guided Biliary Drainage (EUS-BD) is an alternative method of biliary decompression in malignant biliary obstruction. Here we describe the technique of EUS guided-Hepaticogastrostomy (EUS-HGS) in a case of unresectable malignant hilar biliary obstruction.

Patients with unresectable malignant biliary obstruction often require biliary drainage to decompress the biliary system. Endoscopic Retrograde ...

Induction of Myocardial Infarction and Myocardial Ischemia-Reperfusion Injury in Mice

Acute myocardial infarction is a common cardiovascular disease with high mortality. Myocardial reperfusion injury can counteract the beneficial effects of heart reflow and induce secondary myocardial injury. A simple and reproducible model of myocardial infarction and myocardial ischemia-reperfusion injury is a good tool for researchers. Here, a customizable method to create a myocardial infarction (MI) model and MIRI by precision ligation of the left anterior descending coronary artery (LAD) through micromanipulation is described. Accurate and reproducible ligature positioning of the LAD helps obtain consistent results for heart injury. ST-segment changes can help to identify model accuracy. The serum level of cardiac troponin T (cTnT) is used to assess the myocardial injury, cardiac ultrasound is employed to evaluate the myocardial systolic function, and Evans-Blue/triphenyl tetrazolium chloride staining is used to measure infarct size. In general, this protocol reduces procedure duration, ensures controllable infarct size, and improves mouse survival.

Here we describe a simple and reproducible method that can induce myocardial infarction or myocardial ischemia-reperfusion injury in mice by precision ligation of the left anterior descending coronary artery through micromanipulation.

Acute myocardial infarction is a common cardiovascular disease with high mortality. Myocardial reperfusion injury can counteract the beneficial effects of ...

Generation and Characterization of Right Ventricular Myocardial Infarction Induced by Permanent Ligation of the Right Coronary Artery in Mice

Right ventricular infarction (RVI) is a common presentation in clinical practice. Severe RVI can lead to fatal hemodynamic dysfunction and arrhythmia. In contrast to the extensively used mouse myocardial infarction (MI) model generated by left coronary artery ligation, the RVI mouse model is rarely employed due to the difficulty associated with model generation. Research on the mechanisms and treatment of RVI-induced RV remodeling and dysfunction requires animal models to mimic the pathophysiology of RVI in patients. This study introduces a feasible procedure for RVI model generation in C57BL/6J mice. Further, this model was characterized based on the following: infarct size evaluation at 24 h after MI, assessment of cardiac remodeling and function with echocardiography, RV hemodynamics assessment, and histology of the infarct zone at 4 weeks after RVI. In addition, a coronary vasculature cast was performed to observe the coronary arterial arrangement in RV. This mouse model of RVI would facilitate the research on mechanisms of right heart failure and seek new therapeutic targets of RV remodeling.

There are several differences between the right and left ventricles. However, the pathophysiology of right ventricular infarction (RVI) has not been clarified. In the present protocol, a reproducible method for RVI mouse model generation is introduced, which may provide a means to explain the mechanism of RVI.

Right ventricular infarction (RVI) is a common presentation in clinical practice. Severe RVI can lead to fatal hemodynamic dysfunction and arrhythmia. In ...