This work was supported by the Major Research Plan of the National Natural Science Foundation of China (No. 91539111to JY), Key Project of Science and Technology of Hunan Province (No. 2020SK53420 to JY) and The Science and Technology Innovation Program of Hunan Province (2021RC2106 to CF).

All animal experiments in this study were reviewed and approved by the ethics committee of the Second Xiangya Hospital of Central South University. See the Table of Materials for details regarding all the materials and equipment used in this protocol. The timelines for cell injection, imaging and euthansia are as follows: t0- induce infarction, t1 week- image and implant cells, t2 weeks- image and implant cells, t4 weeks- final imaging, euthanasia and tissue collection.&#160;
<s...

<ol>
	<li>Leuschner, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+monocyte+kinetics+in+acute+myocardial+infarction+are+sustained+by+extramedullary+monocytopoiesis.">Rapid monocyte kinetics in acute myocardial infarction are sustained by extramedullary monocytopoiesis.</a> The Journal of Experimental Medicine. 209 (1), 123-137 (2012).</li><li>L&#225;z&#225;r, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiomyocyte+renewal+in+the+human+heart:+insights+from+the+fall-out.">Cardiomyocyte renewal in the human heart: insights from the fall-out.</a> European Heart Journal. 38 (30), 2333-2342 (2017).</li><li>Davis, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=State+of+the+art:+cardiac+transplantation.">State of the art: cardiac transplantation.</a> Trends in Cardiovascular Medicine. 24 (8), 341-349 (2014).</li><li>Mancini, D., Colombo, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Left+ventricular+assist+devices:+A+rapidly+evolving+alternative+to+transplant.">Left ventricular assist devices: A rapidly evolving alternative to transplant.</a> Journal of the American College of Cardiology. 65 (23), 2542-2555 (2015).</li><li>Zimmermann, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translating+myocardial+remuscularization.">Translating myocardial remuscularization.</a> Circulation Research. 120 (2), 278-281 (2017).</li><li>Hu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+large-scale+investigation+of+hypoxia-preconditioned+allogeneic+mesenchymal+stem+cells+for+myocardial+repair+in+nonhuman+primates:+Paracrine+activity+without+remuscularization.">A large-scale investigation of hypoxia-preconditioned allogeneic mesenchymal stem cells for myocardial repair in nonhuman primates: Paracrine activity without remuscularization.</a> Circulation Research. 118 (6), 970-983 (2016).</li><li>Kempf, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiac+differentiation+of+human+pluripotent+stem+cells+in+scalable+suspension+culture.">Cardiac differentiation of human pluripotent stem cells in scalable suspension culture.</a> Nature Protocols. 10 (9), 1345-1361 (2015).</li><li>Chong, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+embryonic-stem-cell-derived+cardiomyocytes+regenerate+non-human+primate+hearts.">Human embryonic-stem-cell-derived cardiomyocytes regenerate non-human primate hearts.</a> Nature. 510 (7504), 273-277 (2014).</li><li>Shiba, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allogeneic+transplantation+of+iPS+cell-derived+cardiomyocytes+regenerates+primate+hearts.">Allogeneic transplantation of iPS cell-derived cardiomyocytes regenerates primate hearts.</a> Nature. 538 (7625), 388-391 (2016).</li><li>Nguyen, P. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potential+strategies+to+address+the+major+clinical+barriers+facing+stem+cell+regenerative+therapy+for+cardiovascular+disease:+A+review.">Potential strategies to address the major clinical barriers facing stem cell regenerative therapy for cardiovascular disease: A review.</a> JAMA Cardiology. 1 (8), 953-962 (2016).</li><li>Zimmermann, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Remuscularization+of+the+failing+heart.">Remuscularization of the failing heart.</a> The Journal of Physiology. 595 (12), 3685-3690 (2017).</li><li>Hu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transplantation+of+hypoxia-preconditioned+mesenchymal+stem+cells+improves+infarcted+heart+function+via+enhanced+survival+of+implanted+cells+and+angiogenesis.">Transplantation of hypoxia-preconditioned mesenchymal stem cells improves infarcted heart function via enhanced survival of implanted cells and angiogenesis.</a> The Journal of Thoracic and Cardiovascular Surgery. 135 (4), 799-808 (2008).</li><li>Feng, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heat+shock+improves+Sca-1++stem+cell+survival+and+directs+ischemic+cardiomyocytes+toward+a+prosurvival+phenotype+via+exosomal+transfer:+a+critical+role+for+HSF1/miR-34a/HSP70+pathway.">Heat shock improves Sca-1+ stem cell survival and directs ischemic cardiomyocytes toward a prosurvival phenotype via exosomal transfer: a critical role for HSF1/miR-34a/HSP70 pathway.</a> Stem Cells. 32 (2), 462-472 (2014).</li><li>Fan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiomyocytes+from+CCND2-overexpressing+human+induced-pluripotent+stem+cells+repopulate+the+myocardial+scar+in+mice:+A+6-month+study.">Cardiomyocytes from CCND2-overexpressing human induced-pluripotent stem cells repopulate the myocardial scar in mice: A 6-month study.</a> Journal of Molecular and Cellular Cardiology. 137, 25-33 (2019).</li><li>Lou, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-cadherin+overexpression+enhances+the+reparative+potency+of+human-induced+pluripotent+stem+cell-derived+cardiac+myocytes+in+infarcted+mouse+hearts.">N-cadherin overexpression enhances the reparative potency of human-induced pluripotent stem cell-derived cardiac myocytes in infarcted mouse hearts.</a> Cardiovascular Research. 116 (3), 671-685 (2020).</li><li>Sun, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transplanted+microvessels+improve+pluripotent+stem+cell-derived+cardiomyocyte+engraftment+and+cardiac+function+after+infarction+in+rats.">Transplanted microvessels improve pluripotent stem cell-derived cardiomyocyte engraftment and cardiac function after infarction in rats.</a> Science Translational Medicine. 12 (562), (2020).</li><li>Wu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiac+repair+with+echocardiography-guided+multiple+percutaneous+left+ventricular+intramyocardial+injection+of+hiPSC-CMs+after+myocardial+infarction.">Cardiac repair with echocardiography-guided multiple percutaneous left ventricular intramyocardial injection of hiPSC-CMs after myocardial infarction.</a> Frontiers in Cardiovascular Medicine. 8, 768873 (2021).</li><li>Kannappan, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functionally+competent+DNA+damage-free+induced+pluripotent+stem+cell-derived+cardiomyocytes+for+myocardial+repair.">Functionally competent DNA damage-free induced pluripotent stem cell-derived cardiomyocytes for myocardial repair.</a> Circulation. 140 (6), 520-522 (2019).</li><li>Lou, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-cadherin+overexpression+enhances+the+reparative+potency+of+human-induced+pluripotent+stem+cell-derived+cardiac+myocytes+in+infarcted+mouse+hearts.">N-cadherin overexpression enhances the reparative potency of human-induced pluripotent stem cell-derived cardiac myocytes in infarcted mouse hearts.</a> Cardiovascular Research. 116 (3), 671-685 (2020).</li><li>Zhao, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Y-27632+preconditioning+enhances+transplantation+of+human-induced+pluripotent+stem+cell-derived+cardiomyocytes+in+myocardial+infarction+mice.">Y-27632 preconditioning enhances transplantation of human-induced pluripotent stem cell-derived cardiomyocytes in myocardial infarction mice.</a> Cardiovascular Research. 115 (2), 343-356 (2019).</li><li>Zhao, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancing+the+engraftment+of+human+induced+pluripotent+stem+cell-derived+cardiomyocytes+via+a+transient+inhibition+of+rho+kinase+activity.">Enhancing the engraftment of human induced pluripotent stem cell-derived cardiomyocytes via a transient inhibition of rho kinase activity.</a> Journal of Visualized Experiments: JoVE. (149), e59452 (2019).</li><li>O'Brien, J., Hayder, H., Peng, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Automated+quantification+and+analysis+of+cell+counting+procedures+using+ImageJ+plugins.">Automated quantification and analysis of cell counting procedures using ImageJ plugins.</a> Journal of Visualized Experiments: JoVE. (117), e54719 (2016).</li><li>Kain, V., Prabhu, S. D., Halade, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammation+revisited:+inflammation+versus+resolution+of+inflammation+following+myocardial+infarction.">Inflammation revisited: inflammation versus resolution of inflammation following myocardial infarction.</a> Basic Research in Cardiology. 109 (6), 444 (2014).</li><li>Rainer, P. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiomyocyte-specific+transforming+growth+factor+&#946;+suppression+blocks+neutrophil+infiltration,+augments+multiple+cytoprotective+cascades,+and+reduces+early+mortality+after+myocardial+infarction.">Cardiomyocyte-specific transforming growth factor &#946; suppression blocks neutrophil infiltration, augments multiple cytoprotective cascades, and reduces early mortality after myocardial infarction.</a> Circulation Research. 114 (8), 1246-1257 (2014).</li><li>Yu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+embryonic+stem+cell-derived+cardiomyocyte+therapy+in+mouse+permanent+ischemia+and+ischemia-reperfusion+models.">Human embryonic stem cell-derived cardiomyocyte therapy in mouse permanent ischemia and ischemia-reperfusion models.</a> Stem Cell Research &amp; Therapy. 10 (1), 167 (2019).</li><li>Iwanaga, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+G-CSF+on+cardiac+remodeling+after+acute+myocardial+infarction+in+swine.">Effects of G-CSF on cardiac remodeling after acute myocardial infarction in swine.</a> Biochemical and Biophysical Research Communications. 325 (4), 1353-1359 (2004).</li></ol>

The authors have nothing to disclose.

The critical steps of this study include hiPSC culture, cardiomyocyte differentiation, hiPSC-CM purification, and hiPSC-CM transplantation into the mouse myocardial infarction site. The key is to use cardiac ultrasound to transcutaneously guide treatment toward the infarct site at the edge of the infarction where hiPSC-CMs were injected into the area.
With the prolongation of culture time, the hiPSC-CM phenotype changes in morphology (larger cell size), structure (muscle, fibril density, arran...

When acute MI occurs, myocardial cells in the infarcted area die quickly due to ischemia and hypoxia. Several inflammatory factors are released after cell death and rupture, while inflammatory cells infiltrate the infarcted site to cause inflammation1. Significantly, fibroblasts and collagen, both without contractility and electrical conductivity, replace the myocardial cells in the infarcted site to form scar tissue. Due to the limited regeneration capacity of cardiomyocytes in adult mammals, viable tissue formed after a large area of infarction is usually not adequate for maintaining sufficient cardiac output2. MI causes heart failure, and in severe cases of heart failure, patients can only rely on heart transplants or ventricular assist devices to maintain normal heart functions3,4.
After MI, the ideal treatment strategy is to replace the dead cardiomyocytes with newly formed cardiomyocytes, forming electromechanical coupling with healthy tissues. However, treatment options have typically adopted myocardial salvage rather than replacement. Currently, stem cell- and progenitor cell-based therapies are among the most promising strategies to promote myocardial repair after MI5. However, the transplantation of these cells has several issues, primarily the inability of adult stem cells to differentiate into cardiomyocytes and their short life span6.
The ethical issues related to the use of embryonic stem (ES) cells can be circumvented by iPSCs, which are a promising source of cells. In addition, iPSCs possess strong self-renewal capabilities and can differentiate into cardiomyocytes7. Studies have shown that hiPSC-CMs transplanted into the MI site can survive and form gap junctions with host cells8,9. However, because these transplanted cells are located in the microenvironment of ischemia and inflammation, their survival rate is extremely low10,11.
Several methods have been established to improve the survival rate of transplanted cells, such as hypoxia and heat shock pretreatment of transplanted cells12,13, genetic modification14,15, and the simultaneous transplantation of cells and capillaries16. Unfortunately, most methods are limited by complexity and high cost. Hence, the present study proposes a reproducible, convenient, relatively invasive, and effective hiPSC-CM delivery method.
Ultrasound-guided intramyocardial cell injection can be carried out with only a high-resolution small veterinary ultrasound machine and a microinjector, regardless of the site. Under ultrasound guidance, directly delivering cells under the xiphoid process from the pericardium into the myocardium in mice is a safe protocol that avoids liver and lung damage. This method can be combined simultaneously with other technologies to significantly improve the survival rate of transplanted cells.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Antibody</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Cardiac troponin T</td>
			<td>Abcam</td>
			<td>ab8295</td>
			<td></td>
		</tr>
		<tr>
			<td>Donkey Anti-Mouse IgG H&#38;L (Alexa Fluor 488)</td>
			<td>Abcam</td>
			<td>ab150105</td>
			<td></td>
		</tr>
		<tr>
			<td>Donkey Anti-Mouse IgG H&#38;L (Alexa Fluor 555)</td>
			<td>Abcam</td>
			<td>ab150110</td>
			<td></td>
		</tr>
		<tr>
			<td>Donkey Anti-Rabbit IgG H&#38;L (Alexa Fluor 488)</td>
			<td>Abcam</td>
			<td>ab150073</td>
			<td></td>
		</tr>
		<tr>
			<td>Donkey Anti-Rabbit IgG H&#38;L (Alexa Fluor 555)</td>
			<td>Abcam</td>
			<td>ab150062</td>
			<td></td>
		</tr>
		<tr>
			<td>Human cardiac troponin T</td>
			<td>Abcam</td>
			<td>ab91605</td>
			<td></td>
		</tr>
		<tr>
			<td>Isolectin B4</td>
			<td>Vector</td>
			<td>FL-1201</td>
			<td></td>
		</tr>
		<tr>
			<td>Sarcomeric alpha actinin</td>
			<td>Abcam</td>
			<td>ab9465</td>
			<td></td>
		</tr>
		<tr>
			<td>Wheat germ agglutinin</td>
			<td>Thermo Fisher Scientific</td>
			<td>W11261</td>
			<td></td>
		</tr>
		<tr>
			<td>Reagent</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Accutase</td>
			<td>Thermo Fisher Scientific</td>
			<td>00-4555-56</td>
			<td></td>
		</tr>
		<tr>
			<td>B27 Supplement(minus insulin)</td>
			<td>Thermo Fisher Scientific</td>
			<td>A1895601</td>
			<td></td>
		</tr>
		<tr>
			<td>B27 Supplement(serum free)</td>
			<td>Thermo Fisher Scientific</td>
			<td>17&#8211;504-044</td>
			<td></td>
		</tr>
		<tr>
			<td>Bouin&#39;s solution</td>
			<td>Thermo Fisher Scientific</td>
			<td>SDHT10132</td>
			<td></td>
		</tr>
		<tr>
			<td>CHIR99021</td>
			<td>Selleck</td>
			<td>CT99021</td>
			<td></td>
		</tr>
		<tr>
			<td>cyclosporin A</td>
			<td>Medchemexpress</td>
			<td>HY-B0579</td>
			<td></td>
		</tr>
		<tr>
			<td>DIRECT RED</td>
			<td>Sigma-Aldrich</td>
			<td>365548-25G</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM/F12</td>
			<td>Thermo Fisher Scientific</td>
			<td>11320033</td>
			<td></td>
		</tr>
		<tr>
			<td>DNeasy Blood &#38; Tissue Kit</td>
			<td>Qiagen</td>
			<td>69504</td>
			<td></td>
		</tr>
		<tr>
			<td>FAST GREEN FCF</td>
			<td>Sigma-Aldrich</td>
			<td>&#160;F7252-5G</td>
			<td></td>
		</tr>
		<tr>
			<td>Glucose-free RPMI 1640</td>
			<td>Thermo Fisher Scientific</td>
			<td>11879020</td>
			<td></td>
		</tr>
		<tr>
			<td>IWR1</td>
			<td>Selleck</td>
			<td>S7086</td>
			<td></td>
		</tr>
		<tr>
			<td>lactic acid</td>
			<td>Sigma-Aldrich</td>
			<td>L6661</td>
			<td></td>
		</tr>
		<tr>
			<td>Matrigel</td>
			<td>BD Biosciences</td>
			<td>BD356234</td>
			<td></td>
		</tr>
		<tr>
			<td>mTeSR1</td>
			<td>Stem Cell Technologies</td>
			<td>72562</td>
			<td></td>
		</tr>
		<tr>
			<td>O.C.T. Compound</td>
			<td>SAKURA</td>
			<td>4583</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraformaldehyde</td>
			<td>Sigma-Aldrich</td>
			<td>158127</td>
			<td></td>
		</tr>
		<tr>
			<td>PowerUP SYBR Green MasterMix kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>A25742</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI1640</td>
			<td>Thermo Fisher Scientific</td>
			<td>11875119</td>
			<td></td>
		</tr>
		<tr>
			<td>STEMdif Cardiomyocyte Freezing Medium/STEMdiff</td>
			<td>Stem Cell Technologies</td>
			<td>5030</td>
			<td></td>
		</tr>
		<tr>
			<td>STEMdiff Cardiomyocyte Support Medium</td>
			<td>Stem Cell Technologies</td>
			<td>5027</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma-Aldrich</td>
			<td>T8787</td>
			<td></td>
		</tr>
		<tr>
			<td>ultrasound coupling agent</td>
			<td>CARENT</td>
			<td>22396269389</td>
			<td></td>
		</tr>
		<tr>
			<td>Y-27632</td>
			<td>Selleck</td>
			<td>S6390</td>
			<td></td>
		</tr>
		<tr>
			<td>Equipment and Supplies</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Applied Biosystems</td>
			<td>Thermo Fisher Scientific</td>
			<td>7500 Real-Time PCR</td>
			<td></td>
		</tr>
		<tr>
			<td>cryostat</td>
			<td>Leica</td>
			<td>CM1950</td>
			<td></td>
		</tr>
		<tr>
			<td>fluoresence microscope</td>
			<td>Olympus</td>
			<td>IX83</td>
			<td></td>
		</tr>
		<tr>
			<td>fine anatomical scissors</td>
			<td>Fine Science Tools</td>
			<td>15000-08</td>
			<td></td>
		</tr>
		<tr>
			<td>fine dissecting forceps</td>
			<td>Fine Science Tools</td>
			<td>11255-20</td>
			<td></td>
		</tr>
		<tr>
			<td>Micro syringe</td>
			<td>Hamilton</td>
			<td>7633</td>
			<td></td>
		</tr>
		<tr>
			<td>Small animal anesthesia machine</td>
			<td>MATRX</td>
			<td>VMR</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultra-high resolution small animal ultrasound imaging system</td>
			<td>VisualSonics</td>
			<td>Vevo 2100</td>
			<td></td>
		</tr>
		<tr>
			<td>Software</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Statistical Product and Service Solutions</td>
			<td>IBM</td>
			<td>21</td>
			<td></td>
		</tr>
		<tr>
			<td>Image J</td>
			<td>NIH</td>
			<td>1.48</td>
			<td></td>
		</tr>
		<tr>
			<td>Human mitochondrial DNA primers</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>the forward primer sequence</td>
			<td>CCGCTACCATAATCATCGCTAT</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>the reverse primer sequence</td>
			<td>TGCTAATACAATGCCAGTCAGG</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

ultrasound-guided induced pluripotent stem cell-derived cardiomyocyte implantation in myocardial infarcted mice

The key objective of cell therapy after myocardial infarction (MI) is to effectively enhance the cell grafted rate, and human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) are a promising cell source for cardiac repair after ischemic damage. However, a low grafted rate is a significant obstacle for effective cardiac tissue regeneration after transplantation. This protocol shows that multiple hiPSC-CM ultrasound-guided percutaneous injections into an MI area effectively increase cell transplantation rates. The study also describes the entire hiPSC-CM culture process, pretreatment, and ultrasound-guided percutaneous delivery methods. In addition, the use of human mitochondrial DNA help detect the absence of hiPSC-CMs in other mouse organs. Lastly, this paper describes the changes in cardiac function, angiogenesis, cell size, and apoptosis at the infarcted border zone in mice 4 weeks after cell delivery. It can be concluded that echocardiography-guided percutaneous injection of the left ventricular myocardium is a feasible, relatively invasive, satisfactory, repeatable, and effective cellular therapy.

Echocardiography for evaluation of the left ventricular function of the mice in each group revealed that the MI injuries were effectively reversed in the MD group (Figure 2A). Compared with the MI group, the SD group showed increased ejection fraction (EF) (from 30% to 35%; Figure 2B) and fraction shortening (FS) (from 18% to 22%; Figure 2C) after MI. However, it is even more crucial to note that multiple injections of the hiPSC-CMs...

Watch this Scientific Journal Video about Ultrasound-Guided Induced Pluripotent Stem Cell-Derived Cardiomyocyte Implantation in Myocardial Infarcted Mice at JoVE.com

Ultrasound-Guided Induced Pluripotent Stem Cell-Derived Cardiomyocyte Implantation in Myocardial Infarcted Mice

Ultrasound-guided cell delivery around the site of myocardial infarction in mice is a safe, effective, and convenient way of cell transplantation.

The key objective of cell therapy after myocardial infarction (MI) is to effectively enhance the cell grafted rate, and human induced pluripotent stem ...

This is the first report demonstrating that echocardiography-guided, percutaneous intramyocardial injection of cardiomyocytes significantly enhance the reparative property of human iPS-derived cardiomyocytes. This method is feasible, satisfactory, repeatable less invasive and effective procedure for delivering human iPS-derived cardiomyocytes therapy. We believe that percutaneous intramyocardial delivery is a safe and efficient method for local drug delivery for diseases including ischemic heart disease, myocardial infarction, and heart failure.This project is supervised by Professor Jinfu Yang and Professor Jun Peng. demonstrating the procedure will be Xun Wu, Kele Qin, and Kun Xiang, MD PhDs from my laboratory and Di Wang, a PhD from Hunan Provincial Key Laboratory of Cardiovascular Research. To begin, vacuum aspirate the culture supernatant from a 60-day culture of hiPSC-CMs.Wash the cells with PBS thrice. Then dissociate the hiPSC-CMs into individual cells using the cell detachment enzyme mixture at 37 degrees Celsius for three to five minutes. Collect the cells in a 15 milliliter tube containing five milliliters of RPMI plus B27 medium and mix.Count the cells and calculate the total number of cells. Centrifuge the cell suspension at 300G for two minutes at room temperature. Discard the supernatant and resuspend the pellet in cardiomyocyte support medium to a concentration of 6 x 10 of the 4th cells per microliter.Place the tube at 37 degrees Celsius til the injection step. After the mouse is sufficiently anesthetized, fix the limbs and tail with tape. Then, fix the mouse incisors with a 2/0 silk thread and tape.Sterilize the median neck and left chest with three alternating rounds of betaine followed by alcohol. Make a median neck incision using fine anatomical scissors and fine dissecting forceps. Cut off a few anterior cervical muscles to stabilize and fully expose the trachea.Insert a 20-gauge catheter puncture needle as a tracheal tube through the mouth. Connect the tracheal tube to the ventilator and check for thoracic movement to ensure both lungs are well-ventilated. Adjust the breathing parameters.Next, refix the left hind limb to the lower-right side and loosen the tape around the left upper limb. With fine dissecting scissors and forceps, perform a thoracotomy at the three to four intercostal space of the left thorax. Using forceps, peel off the pericardium and locate the left anterior descending coronary artery.Use a 6/0 silk thread to ligate the proximal end of the artery. To ensure that the acute myocardial infarction model is established, wait till the distal side of the artery at the ligation site changes from red to white. Close the chest layer by layer and suture the skin with 4/0 thread.For the sham group of animals, perform all the surgical procedures except for ligation. In the first two weeks following myocardial infarction, place the mice in an anesthesia box connected with 5%isofluorane and perform tracheal intubation. Three days before administering hiPSC-CMs, inject cyclosporine A into the intraperitoneal cavity at a dose of 10 milligrams per kilogram per day.Remove the hair from the chest and upper abdomen of the mouse with depilatory cream. Supply inhalation isofluorane til the heart rate is maintained at 400 to 500 beats per minute. Fix the mouse limbs and tail with tape on the detection console and set the platform temperature at 37 degrees Celsius.Apply the ultrasound jelly on the upper abdomen. Using a high resolution veterinary ultrasound probe, obtain mouse liver images. Using a five microliter micro syringe, draw approximately 3 x 10 to the 5th hiPSC-CMs.Hold the syringe and insert a three millimeter needle at the left paraxiphoid process. Under ultrasound guidance, follow the upper edge of the diaphragm. Observe the respiratory rhythm and range.Enter the pericardium at the end of the expiratory circle, avoiding damage to the liver and lung. Then acquire the parasternal long axis image of the mouse heart by B-mode echocardiography. Under ultrasonic guidance, inject 1 x 10 to the 5th hiPSC-CMs cells into each of the three marginal areas of the infarct site.Remove the ultrasound probe and rinse off the jelly. Wean the mouse off the anesthesia and return it to its cage. Inject cyclosporine A continuously for one month after transplantation.Echocardiogram of the left ventricle showed that the injuries due to myocardial infarction were reversed in the multiple dose group. Transplantation of hiPSC-CMs also resulted in increased ejection fraction and fraction shortening. Measurement of cardiac parameters using Sirius Red and Fast Green staining showed that the infarct size and collagen volume fraction decreased, whereas the left ventricular anterior wall thickness increased after transplantation.Labeling for non-specific alpha actin in green, DAPI in blue, and human-specific troponin T in red showed the presence of transplanted cells in infarct and marginal infarct area. The number and percentage of transplanted cells were higher in the multiple dose group compared to single dose. 28 days after myocardial infarction, the multiple dose group showed an increase in the number of cells expressing the endothelial cell marker, I-B4.Wheat germ agglutinin and sarcomeric alpha actinin staining on cardiomyocytes showed a reduction in the minimum fiber diameter. Lower number of tunnel positive cardiomyocyte nuclei in the multiple dose group indicated reduced apoptosis. PCR analysis detected the human mitochondrial DNA only in the heart, showing specific transplantation.When inserting the needle, make sure it enters the pericardial cavity along with the upper margin of diaphragm and at the end of the expiratory circle to avoid the injury to the liver or the lung.

ultrasound-guided-induced-pluripotent-stem-cell-derived-cardiomyocyte

Research

JoVE Journal

Medicine

1.4K vues.  Central South University. Il s’agit du premier rapport démontrant que l’injection intramyocardique percutanée de cardiomyocytes guidée par échocardiographie améliore significativement la propriété réparatrice des cardiomyocytes humains dérivés de l’iPS. Cette méthode est une procédure réalisable, satisfaisante, reproductible, moins invasive et efficace pour administrer un traitement des cardiomyocytes dérivés des iPS humaines. Nous croyons que l’administration intramyocardique percutanée est un...