This work was funded by NIH (R01GM141395) and NSF (1656736) grants to DF and NIH fellowship (F32GM136170) to AW. Figure 1 was created with the help of BioRender.com.

1. Worm synchronization
NOTE: Two methods are described below to synchronize the development of C. elegans and other rhabditid species.
<ol>
	<li>Synchronize by first larval stage (L1) arrest following alkaline hypochlorite (bleach) treatment. 
	NOTE: This method was described previously in detail19. This method relies on two features of C. elegans that are also true for several other rhabditid species: (1) The eggshell is resis...

<ol>
	<li>Haag, E. S., Fitch, D. H. A., Delattre, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+&amp;#34;the+worm&amp;#34;+to+&amp;#34;the+worms&amp;#34;+and+back+again:+the+evolutionary+developmental+biology+of+nematodes.">From &amp;#34;the worm&amp;#34; to &amp;#34;the worms&amp;#34; and back again: the evolutionary developmental biology of nematodes.</a> Genetics. 210 (2), 397-433 (2018).</li><li>Sommer, R. J., Bumbarger, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nematode+model+systems+in+evolution+and+development.">Nematode model systems in evolution and development.</a> Wiley Interdisciplinary Reviews: Developmental Biology. 1 (3), 389-400 (2012).</li><li>. WormBase Available from: <a target="_blank" href="https://wormbase.org/#012-3-6">https://wormbase.org/#012-3-6</a> (2022)</li><li>. WormAtlas Available from: <a target="_blank" href="https://wormatlas.org">https://wormatlas.org</a> (2022)</li><li>. WormBook in Genetics Available from: <a target="_blank" href="https://academic.oup.com/genetics/pages/wormbook">https://academic.oup.com/genetics/pages/wormbook</a> (2022)</li><li>Cao, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+single-cell+transcriptional+profiling+of+a+multicellular+organism.">Comprehensive single-cell transcriptional profiling of a multicellular organism.</a> Science. 357 (6352), 661-667 (2017).</li><li>Kaletsky, R., Murphy, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+profiling+of+C.+elegans+adult+cells+and+tissues+with+age.">Transcriptional profiling of C. elegans adult cells and tissues with age.</a> Methods in Molecular Biology. 2144, 177-186 (2020).</li><li>Kaletsky, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptome+analysis+of+adult+Caenorhabditis+elegans+cells+reveals+tissue-specific+gene+and+isoform+expression.">Transcriptome analysis of adult Caenorhabditis elegans cells reveals tissue-specific gene and isoform expression.</a> PLoS Genetics. 14 (8), 1007559 (2018).</li><li>Packer, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+lineage-resolved+molecular+atlas+of+C.+elegans+embryogenesis+at+single-cell+resolution.">A lineage-resolved molecular atlas of C. elegans embryogenesis at single-cell resolution.</a> Science. 365 (6459), 1971 (2019).</li><li>Kulkarni, A., Anderson, A. G., Merullo, D. P., Konopka, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beyond+bulk:+a+review+of+single+cell+transcriptomics+methodologies+and+applications.">Beyond bulk: a review of single cell transcriptomics methodologies and applications.</a> Current Opinion in Biotechnology. 58, 129-136 (2019).</li><li>Von Stetina, S. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-specific+microarray+profiling+experiments+reveal+a+comprehensive+picture+of+gene+expression+in+the+C.+elegans+nervous+system.">Cell-specific microarray profiling experiments reveal a comprehensive picture of gene expression in the C. elegans nervous system.</a> Genome Biology. 8 (7), 135 (2007).</li><li>Baugh, L. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+homeodomain+protein+PAL-1+specifies+a+lineage-specific+regulatory+network+in+the+C.+elegans+embryo.">The homeodomain protein PAL-1 specifies a lineage-specific regulatory network in the C. elegans embryo.</a> Development. 132 (8), 1843-1854 (2005).</li><li>Haenni, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+C.+elegans+intestinal+gene+expression+and+polyadenylation+by+fluorescence-activated+nuclei+sorting+and+3'-end-seq.">Analysis of C. elegans intestinal gene expression and polyadenylation by fluorescence-activated nuclei sorting and 3'-end-seq.</a> Nucleic Acids Research. 40 (13), 6304-6318 (2012).</li><li>Zhang, S., Banerjee, D., Kuhn, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+culture+of+larval+cells+from+C.+elegans.">Isolation and culture of larval cells from C. elegans.</a> PLoS One. 6 (4), 19505 (2011).</li><li>Emmert-Buck, M. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser+capture+microdissection.">Laser capture microdissection.</a> Science. 274 (5289), 998-1001 (1996).</li><li>Hashimshony, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CEL-Seq2:+sensitive+highly-multiplexed+single-cell+RNA-Seq.">CEL-Seq2: sensitive highly-multiplexed single-cell RNA-Seq.</a> Genome Biology. 17, 77 (2016).</li><li>Yanai, I., Hashimshony, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CEL-Seq2-single-cell+RNA+sequencing+by+multiplexed+linear+amplification.">CEL-Seq2-single-cell RNA sequencing by multiplexed linear amplification.</a> Methods in Molecular Biology. 1979, 45-56 (2019).</li><li>Porta-de-la-Riva, M., Fontrodona, L., Villanueva, A., Ceron, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basic+Caenorhabditis+elegans+methods:+synchronization+and+observation.">Basic Caenorhabditis elegans methods: synchronization and observation.</a> Journal of Visualized Experiments: JoVE. (64), e4019 (2012).</li><li>Baugh, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=To+grow+or+not+to+grow:+nutritional+control+of+development+during+Caenorhabditis+elegans+L1+arrest.">To grow or not to grow: nutritional control of development during Caenorhabditis elegans L1 arrest.</a> Genetics. 194 (3), 539-555 (2013).</li><li>Baugh, L. R., Hu, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Starvation+responses+throughout+the+Caenorhabditis+elegans+life+cycle.">Starvation responses throughout the Caenorhabditis elegans life cycle.</a> Genetics. 216 (4), 837-878 (2020).</li><li>Pepper, A. S., Killian, D. J., Hubbard, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+analysis+of+Caenorhabditis+elegans+glp-1+mutants+suggests+receptor+interaction+or+competition.">Genetic analysis of Caenorhabditis elegans glp-1 mutants suggests receptor interaction or competition.</a> Genetics. 163 (1), 115-132 (2003).</li><li>Mok, D. Z., Sternberg, P. W., Inoue, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphologically+defined+sub-stages+of+C.+elegans+vulval+development+in+the+fourth+larval+stage.">Morphologically defined sub-stages of C. elegans vulval development in the fourth larval stage.</a> BMC Developmental Biology. 15, 26 (2015).</li><li>Lytal, N., Ran, D., An, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Normalization+methods+on+single-cell+RNA-seq+data:+an+empirical+survey.">Normalization methods on single-cell RNA-seq data: an empirical survey.</a> Frontiers in Genetics. 11, 41 (2020).</li><li>Vieth, B., Ziegenhain, C., Parekh, S., Enard, W., Hellmann, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=powsimR:+power+analysis+for+bulk+and+single+cell+RNA-seq+experiments.">powsimR: power analysis for bulk and single cell RNA-seq experiments.</a> Bioinformatics. 33 (21), 3486-3488 (2017).</li><li>Bolkova, J., Lanctot, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+gene+expression+analysis+in+Caenorhabditis+elegans+using+single+molecule+RNA+FISH.">Quantitative gene expression analysis in Caenorhabditis elegans using single molecule RNA FISH.</a> Methods. 98, 42-49 (2016).</li><li>Ji, N., van Oudenaarden, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+molecule+fluorescent+in+situ+hybridization+(smFISH)+of+C.+elegans+worms+and+embryos.">Single molecule fluorescent in situ hybridization (smFISH) of C. elegans worms and embryos.</a> WormBook. , 1-16 (2012).</li><li>Lee, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+RNA+fluorescence+in+situ+hybridization+(smFISH)+in+Caenorhabditis+elegans.">Single-molecule RNA fluorescence in situ hybridization (smFISH) in Caenorhabditis elegans.</a> Bio-Protocol. 7 (12), 2357 (2017).</li><li>Baird, S. E., Chamberlin, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Caenorhabditis+briggsae+methods.">Caenorhabditis briggsae methods.</a> WormBook. , 1-9 (2006).</li><li>Felix, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oscheius+tipulae.">Oscheius tipulae.</a> WormBook. , 1-8 (2006).</li><li>Han, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+transgenesis+efficiency+and+CRISPR-associated+tools+through+codon+optimization+and+native+intron+addition+in+Pristionchus+nematodes.">Improving transgenesis efficiency and CRISPR-associated tools through codon optimization and native intron addition in Pristionchus nematodes.</a> Genetics. 216 (4), 947-956 (2020).</li><li>Fernandes Povoa, E. E., Ebbing, A. L. P., Betist, M. C., vander Veen, C., Korswagen, H. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+optimized+dissociation+protocol+for+FACS-based+isolation+of+rare+cell+types+from+Caenorhabditis+elegans+L1+larvae.">An optimized dissociation protocol for FACS-based isolation of rare cell types from Caenorhabditis elegans L1 larvae.</a> MethodsX. 7, 100922 (2020).</li><li>Han, M., Wei, G., McManus, C. E., Hillier, L. W., Reinke, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolated+C.+elegans+germ+nuclei+exhibit+distinct+genomic+profiles+of+histone+modification+and+gene+expression.">Isolated C. elegans germ nuclei exhibit distinct genomic profiles of histone modification and gene expression.</a> BMC Genomics. 20 (1), 500 (2019).</li><li>Steiner, F. A., Henikoff, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+type-specific+affinity+purification+of+nuclei+for+chromatin+profiling+in+whole+animals.">Cell type-specific affinity purification of nuclei for chromatin profiling in whole animals.</a> Methods in Molecular Biology. 1228, 3-14 (2015).</li><li>Ebbing, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spatial+transcriptomics+of+C.+elegans+males+and+hermaphrodites+identifies+sex-specific+differences+in+gene+expression+patterns.">Spatial transcriptomics of C. elegans males and hermaphrodites identifies sex-specific differences in gene expression patterns.</a> Developmental Cell. 47 (6), 801-813 (2018).</li><li>R&#246;delsperger, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spatial+transcriptomics+of+nematodes+identifies+sperm+cells+as+a+source+of+genomic+novelty+and+rapid+evolution.">Spatial transcriptomics of nematodes identifies sperm cells as a source of genomic novelty and rapid evolution.</a> Molecular Biology and Evolution. 38 (1), 229-243 (2021).</li><li>Amini, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+optimised+protocol+for+isolation+of+RNA+from+small+sections+of+laser-capture+microdissected+FFPE+tissue+amenable+for+next-generation+sequencing.">An optimised protocol for isolation of RNA from small sections of laser-capture microdissected FFPE tissue amenable for next-generation sequencing.</a> BMC Molecular Biology. 18 (1), 22 (2017).</li></ol>

All authors declare that they have no conflicts of interest.

Critical steps of the method 
If performed correctly, the method described here will obtain robust RNA profiles with a relatively small number of laser-dissected samples (70 tail tips in this example). However, for samples from developing animals, tight synchronization is critical to reducing the variability between samples. For this reason, the protocol recommends the hatch-off method for worm-synchronization. Here, the researcher can determine and precisely control the age difference between indiv...

Nematodes&#8212;particularly the rhabditid nematodes related to the model system Caenorhabditis elegans&#8212;are a wonderful group of animals for evolutionary developmental biology (EDB) for many reasons1,2. Advantages include their small number of cells, defined and consistent cell lineages, transparency, and ease of culture and husbandry. There are also many resources available, including high-quality genomes for multiple species, and for C. elegans, extensive molecular genetic tools and knowledge about development, genetics, anatomy, and physiology3,4,5,6.
As with many other organisms, the ability to characterize transcriptome dynamics in single tissues or single cells has revolutionized the analysis of development in C. elegans7,8,9,10. Being able to compare single-cell transcriptomes across nematodes would similarly transform EDB using these organisms. For example, such comparisons would provide insight into how gene regulatory networks have evolved for characters (traits) that have been conserved, for characters that have diverged, or for characters that evolved independently.

However, isolating particular tissues or cells from nematodes is one of the big challenges. For many organisms, single cells can be dissociated from tissues and harvested in an unbiased way or can be labeled with tissue-specific expression of a fluorescent protein and sorted by fluorescence-activated cell sorting (FACS)11. In C. elegans, high-throughput (HTP) isolation of cells has been limited mostly to embryos because the tough outer cuticle (and hydrostatic skeleton) has hampered cell isolation from larvae and adults. To get around this challenge, some methods have employed genetic tools in whole C. elegans worms, such as tissue-specific mRNA-tagging12, and differential expression comparisons between wild-type and mutants affecting a cell type13. More recent methods have overcome the challenge by dissolving the cuticle to isolate nuclei14 or entire cells8,9,15. Cell isolation and cell culture have the obvious disadvantages, however, that cells are removed from their natural developmental or anatomical context&#8212;e.g., away from cell-cell signaling and contact with the extracellular matrix&#8212;which are expected to impact the gene expression profile15. Moreover, the genetic tools and tissue-specific markers are species-specific (i.e., they can only be used in C. elegans).
LMD provides an alternative method for isolating tissues without disrupting the natural context of cells. Significantly for EDB, LMD also allows transcriptomes from homologous tissues of different species to be compared without the need for species-specific genetic toolkits if genome or whole transcriptome sequences of these species are available. LMD involves targeting tissues by direct microscopical observation and using a laser microbeam&#8212;integrated into the microscope&#39;s optics&#8212;to cut out and harvest (capture) the tissue of interest16. Limitations of LMD are that it is not conducive to very HTP approaches (although the transcription profiles for tail tips, as described in this protocol, were robust with ~70 samples), certain samples might be difficult to dissect out, and cuts are limited to the precision of the laser and what can be visualized in the microscope.
The purpose of the present protocol is to describe how LMD, followed by single-tissue RNA-Seq, can be used to obtain stage- and tissue-specific transcriptome data from nematodes. Specifically, it demonstrates LMD for isolating tail tips from fourth-stage larvae (L4) of C. elegans. However, this method can be adapted to other tissues and, of course, different species.
In C. elegans, there are 4 cells that make the tail tip in both males and hermaphrodites. During the L4 stage in males&#8212;but not in hermaphrodites&#8212;the tail tip cells change their shape and migrate anteriorly and inwardly. This process also occurs in some but not all other rhabditid nematode species. Therefore, the tail tip is a good model for the evolution of sexual dimorphic morphogenesis. Because of its position, the tail tip is also easy to isolate by LMD.
To obtain transcriptome profiles from tail tips, the present protocol uses CEL-Seq2, an RNA-seq method developed for single cells17,18. This method has several advantages for LMD-derived tissues. CEL-Seq2 is highly sensitive and efficient, using unique molecular identifiers (UMIs) to allow straightforward quantification of mRNA reads, in vitro transcription to ensure linear amplification, and barcoding that allows multiplexing of individual tissue samples. The only limitation of CEL-Seq2 is that recovered reads are biased to the 3&#39; end of mRNAs, and most isoforms thus cannot be distinguished.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>&#160;0.5 &#181;M PEN membrane glass slides RNase free</td>
			<td>Leica</td>
			<td>11600288</td>
			<td>for LMD</td>
		</tr>
		<tr>
			<td>500 &#181;L PCR tubes (nuclease-free)</td>
			<td>Axygen</td>
			<td>732-0675</td>
			<td>to cut the tail tips into</td>
		</tr>
		<tr>
			<td>Compound microscope with 40x objective and DIC</td>
			<td>any</td>
			<td></td>
			<td>to check age of worms</td>
		</tr>
		<tr>
			<td>Desktop humidifier</td>
			<td>any</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Dissection microscope with transmitted light base</td>
			<td>any</td>
			<td></td>
			<td>for all worm work</td>
		</tr>
		<tr>
			<td>glass pasteur pipets</td>
			<td>any</td>
			<td></td>
			<td>handle of worm pick</td>
		</tr>
		<tr>
			<td>glass slides and coverslips</td>
			<td>any</td>
			<td></td>
			<td>to check age of worms</td>
		</tr>
		<tr>
			<td>LMD6 microdissection system</td>
			<td>Leica</td>
			<td>multiple</td>
			<td>to cut tail tips</td>
		</tr>
		<tr>
			<td>LoBind tubes 0.5 mL</td>
			<td>Eppendorf</td>
			<td>22431005</td>
			<td></td>
		</tr>
		<tr>
			<td>M9 Buffer</td>
			<td></td>
			<td></td>
			<td>Recipe in WormBook</td>
		</tr>
		<tr>
			<td>Methanol 99.8%</td>
			<td>Sigma</td>
			<td>322415</td>
			<td>to fix worms</td>
		</tr>
		<tr>
			<td>NGM growth medium</td>
			<td>US Biological</td>
			<td>N1000</td>
			<td>Buffers and salts need to be added: Recipe in WormBook</td>
		</tr>
		<tr>
			<td>P10 pipette variablle volume</td>
			<td>e.g. Gilson</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>P1000 pipette variable volume</td>
			<td>e.g. Gilson</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>P2 pipette variable volume</td>
			<td>e.g. Gilson</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Pipette tips 1,000 &#181;L</td>
			<td>any</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Pipette tips 1-10 &#181;L filtered</td>
			<td>any</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>platinum iridium wire</td>
			<td>Tritech</td>
			<td>PT-9010</td>
			<td>to make worm pick</td>
		</tr>
		<tr>
			<td>sterile and nuclease-free 1 mL centrfuge tubes</td>
			<td>any</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Tween 20</td>
			<td>Sigma</td>
			<td>P9416</td>
			<td>Add a very small amount to M9 buffer to prevent worms from sticking to the pipet tips</td>
		</tr>
		<tr>
			<td>vented 6 mm plastic Petri dishes</td>
			<td>any</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>For CEL-Seq2</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>4200 TapeStation System with reagents for high-sensitivity RNA and DNA detection</td>
			<td>Aligent</td>
			<td></td>
			<td>automated electrophoresis system</td>
		</tr>
		<tr>
			<td>AMPure XP beads</td>
			<td>Beckman Coulter</td>
			<td>A63880</td>
			<td>DNA cleanup beads</td>
		</tr>
		<tr>
			<td>Bead binding buffer&#160; 20% PEG8000, 2.5 M NaCl</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>CEL-Seq2 primers (see Table S1)</td>
			<td>Sigma Genosys Mastercycler Nexus GX2 Eppendorf</td>
			<td>6335000020</td>
			<td>Thermal cycler with programmable lid and block for 200 &#181;l tubes.</td>
		</tr>
		<tr>
			<td>DNA Polymerase I (E. coli)</td>
			<td>Invitrogen</td>
			<td>18052-025</td>
			<td></td>
		</tr>
		<tr>
			<td>dNTP mix 10 mM</td>
			<td>any</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>E. coli DNA ligase</td>
			<td>Invitrogen</td>
			<td>18052-019</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>ExoSAP-IT For PCR Product Clean-Up</td>
			<td>Affymetrix</td>
			<td>78200</td>
			<td>exonuclease solution</td>
		</tr>
		<tr>
			<td>MEGAscript T7 Transcription Kit</td>
			<td>Ambion</td>
			<td>AM1334</td>
			<td>For step 4.6.1</td>
		</tr>
		<tr>
			<td>Nuclease-free water</td>
			<td>any</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Phusion High-Fidelity PCR Master Mix with HF Buffer</td>
			<td>NEB</td>
			<td>M0531</td>
			<td>PCR mix step 4.9.7</td>
		</tr>
		<tr>
			<td>random hexamer RT primer GCCTTGGCACCCGAGAATTCCA 
			NNNNNN</td>
			<td>IDT</td>
			<td></td>
			<td>a primer with 6 nucleotides that are random</td>
		</tr>
		<tr>
			<td>RNA Fragmentation buffer</td>
			<td>NEB</td>
			<td>E6150S</td>
			<td></td>
		</tr>
		<tr>
			<td>RNA Fragmentation stop buffer</td>
			<td>NEB</td>
			<td>E6150S</td>
			<td></td>
		</tr>
		<tr>
			<td>RNA PCR Index Primers (RPI1&#8211;RPI48)</td>
			<td>Illumina, NEB, or IDT</td>
			<td></td>
			<td>RPIX in protocol step 4.9.7, sequences available from Illumina</td>
		</tr>
		<tr>
			<td>RNAClean XP beads</td>
			<td>Beckman Coulter</td>
			<td>A63987</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase AWAY Surface Decontaminant</td>
			<td>Thermo Scientific</td>
			<td>7000TS1</td>
			<td>or any other similar product</td>
		</tr>
		<tr>
			<td>RNaseH (E. coli)</td>
			<td>Invitrogen</td>
			<td>18021-071</td>
			<td></td>
		</tr>
		<tr>
			<td>RNaseOUT Recombinant Ribonuclease Inhibitor</td>
			<td>Invitrogen</td>
			<td>10777-019</td>
			<td></td>
		</tr>
		<tr>
			<td>Second strand buffer</td>
			<td>Invitrogen</td>
			<td>10812-014</td>
			<td></td>
		</tr>
		<tr>
			<td>Superscripit II</td>
			<td>Invitrogen</td>
			<td>18064-014</td>
			<td>reverse transcriptase</td>
		</tr>
	</tbody>
</table>

laser microdissection for species-agnostic single-tissue applications

Single-cell methodologies have revolutionized the analysis of the transcriptomes of specific cell types. However, they often require species-specific genetic &#34;toolkits,&#34; such as promoters driving tissue-specific expression of fluorescent proteins. Further, protocols that disrupt tissues to isolate individual cells remove cells from their native environment (e.g., signaling from neighbors) and may result in stress responses or other differences from native gene expression states. In the present protocol, laser microdissection (LMD) is optimized to isolate individual nematode tail tips for the study of gene expression during male tail tip morphogenesis.
LMD allows the isolation of a portion of the animal without the need for cellular disruption or species-specific toolkits and is thus applicable to any species. Subsequently, single-cell RNA-seq library preparation protocols such as CEL-Seq2 can be applied to LMD-isolated single tissues and analyzed using standard pipelines, given that a well-annotated genome or transcriptome is available for the species. Such data can be used to establish how conserved or different the transcriptomes are that underlie the development of that tissue in different species.
Limitations include the ability to cut out the tissue of interest and the sample size. A power analysis shows that as few as 70 tail tips per condition are required for 80% power. Tight synchronization of development is needed to obtain this number of animals at the same developmental stage. Thus, a method to synchronize animals at 1 h intervals is also described.

Following laser capture microdissection, individual tail tips of males and hermaphrodites at 4 time points (L3 22 h after hatch; L4 24, 26, and 28 h after hatch) were prepared for RNA sequencing using the CEL-Seq2 protocol. CEL-Seq2 primers contain unique barcodes that enable sequencing reads from a particular sample (in this case an individual tail tip) to be identified bioinformatically. Sequencing data were generated with this method for a total of 557 tail tips (266 hermaphrodites and 291 males across 4 developmental...

Watch this Scientific Journal Video about Laser Microdissection for Species-Agnostic Single-Tissue Applications at JoVE.com

Laser Microdissection for Species-Agnostic Single-Tissue Applications

A protocol is described that uses laser microdissection to isolate individual nematode tissues for RNA-sequencing. The protocol does not require species-specific genetic toolkits, allowing gene expression profiles to be compared between different species at the level of single-tissue samples.

Single-cell methodologies have revolutionized the analysis of the transcriptomes of specific cell types. However, they often require species-specific ...

We combine laser capture microdissection with a single cell RNA seek protocol called CEL-Seq2 to generate transcriptomic data sets for small individual tissue samples. This technique lets us study gene expression in tissues or species that cannot be studied using traditional cell sorting methods. Additionally, it provides more specificity than a bulk RNA-seq approach.Here we demonstrated this technique for the four celled tail tips of C.elegans fourth larval stage males and hermaphrodites. But the beauty of this approach is that it can even be applied to non-model species. Demonstrating the procedure will be Ms.Raya Jallad, PhD student from my laboratory and Dr.Antonio Herrera, currently lead biomedical scientist at the Baylor school in Chattanooga, Tennessee.Begin by gently pipetting one to two milliliters of M9 buffer against the wall of the plate without squirting. Swirl the plate to dislodge the worms. Remove and discard all the liquid and the worms by placing the pipette tip against the wall of the plate at the edge of the agar to avoid poking holes.This video shows the plate before mothers and larva are removed. Only embryos should be left after the mothers and larva are removed. L1 larva will start appearing after incubation for an hour or so.Then place the plate at 25 degrees Celsius. After one hour, remove the plate from the incubator. Carefully drop one milliliter of M9 buffer onto the agar and swirl the plate to dislodge the L1s but not the embryos.Centrifuge the tube and pipette the L1s directly onto the bacterial lawn of a seeded plate. Keep the worms at 25 degrees Celsius. Under a dissection microscope at 30 to 50 X magnification, begin picking the males and the hermaphrodites from the synchronization plates onto separate unseated plates.Males are distinguished from hermaphrodites by the bulged shape and lighter color of the male tails compared to the pointed shape and darker color of the hermaphrodite tails. Wash the worms off the plate with one to two milliliters of M9 buffer using a pipette tip pre-washed with M9 buffer containing 0.01%detergent. Transfer the worms to a one milliliter centrifuge tube, spin for one minute and add one milliliter of M9 buffer.Again, spin for one minute. Add one milliliter of ice cold 70%methanol and mix well. Repeat the wash with one milliliter methanol, mix well.Spin it for one minute and add 500 microliters of 70%methanol. Mix it and store it at four degrees Celsius for one hour to overnight. Pipette 20 microliters of the fixed worms onto the coated side of a polyethylene naphthalate or PEN-membrane glass slide.Wait for the methanol to evaporate. Remove the plastic shield over the stage and click the unload button with the upward arrow for loading the membrane slides. Make sure the slide is completely dry, flip so that the membrane is facing down and insert the slide.Click continue in the change specimen window. The slide holder will move. Then replace the plastic shield, on the bottom of the screen, choose which slide holder contains the slide and click the unload button with the downward arrow to load the tubes.Pull the tray out and remove the tube block. Insert the tube caps of four 500 microliter PCR tubes into the holder and fold the tube under. Return the block to the tray and slide the tray back into the microscope stage.In the change collector device popup window, select PCR tubes, and click okay. Click on the empty tube location on the bottom left of the screen under collector device tube caps and in the microscope control panel select TLBF for transmitted light bright field illumination. Using the 2.5X lens, adjust the focus until the worms and the surface structure of the PEN-membrane are visible.Switch to the 20X lens and move the stage to a region without worms. Adjust the focus such that the bubble like structures in the membrane have a yellowish color to focus the laser on the correct focal plane then set the laser parameters. For the tail tips, start with power 45 aperture 30 in speed 20.In the laser control panel, select calibrate and follow the instructions. Next, on the bottom of the screen at collector device tube caps click on position A, on the right side of the screen select single shape, followed by draw and cut. Then select point to point and draw a line.Click start cut so that the laser cuts through the membrane. Find a worm and switch to move and cut. Use the mouse to cut through the tail.To collect the sample, switch to the draw and cut setting with the point to point function and draw shape to complete the cut of a membrane section. Select the next tube at collector device tube cap on the bottom of the screen and cut the next tail tip. Once four tails are cut, unload the tube rack by clicking unload with the downward arrow.Find the membrane sections under a dissecting microscope and continue with the downstream sample processing. Here RNA sequencing with CEL-Seq2. Pipette 1.2 microliters of a CEL-Seq2 primer master mix directly on top of the sample and close the tube.Label with the primer number and immediately place the tube cap directly on a piece of dry ice to flash freeze the sample thus preventing RNA degradation. Repeat until all samples have been collected. Finally store the tubes at minus 70 degrees Celsius.C.elegans L3 hermaphrodites and males at 21 to 23 hours after hatch can be distinguished under a dissection microscope by the morphology of their tails. The tale of hermaphrodite is narrow while that of males is swollen and appears clear. The appearance of the PEN-membrane slide structure and worm tail is shown in these images.Here the focus is correct for the 20X and 40X lenses at the microscope. The dissected tail impartially cut out PEN-membrane are visible here. After closing the gap in the cut, the membrane piece will drop into the tube cap below the slide.A tube cap with a PEN-membrane section containing a dissected tail tip is shown here. The graphical image represents the natural log transformed unique molecular identifier or UMI counts per individual tail tip for different time points and sexes. The powsimR software is used to determine how many independent samples are required to detect differential expressed or DE genes at various expression levels.The graphical image here represents the true positive rate to detect the DE genes between two conditions for four different simulations incorporating different sample sizes per condition. The dashed line indicates an 80%true positive rate. The false discovery rate and the same four simulations is shown here.The dashed line indicates a 10%false discovery rate. The graphs showed that a sample size of 70 tail tips per condition is sufficient for detecting the DE genes except for the genes with very low expression levels. For proper synchronization, ensure that only embryos are present on the plate.To ensure against sample loss, pipette the primer mix directly onto the PEN-membrane section in the cap and be extremely gentle in closing the cap. Because it's species agnostic, we can use this protocol to explore how gene regulatory networks have evolved for homologous structures in different species.

laser-microdissection-for-species-agnostic-single-tissue-applications

Research

JoVE Journal

Biology

2.1K vistas.  New York University. Combinamos la microdisección de captura láser con un protocolo de búsqueda de ARN de una sola célula llamado CEL-Seq2 para generar conjuntos de datos transcriptómicos para pequeñas muestras de tejido individuales. Esta técnica nos permite estudiar la expresión génica en tejidos o especies que no pueden ser estudiadas utilizando métodos tradicionales de clasificación celular. Además, proporciona más especificidad que un enfoque de ARN-seq a granel.Aquí demostramos esta té...