This work was funded by NIH (R01GM141395) and NSF (1656736) grants to DF and NIH fellowship (F32GM136170) to AW. Figure 1 was created with the help of BioRender.com.

1. Worm synchronization
NOTE: Two methods are described below to synchronize the development of C. elegans and other rhabditid species.
<ol>
	<li>Synchronize by first larval stage (L1) arrest following alkaline hypochlorite (bleach) treatment. 
	NOTE: This method was described previously in detail19. This method relies on two features of C. elegans that are also true for several other rhabditid species: (1) The eggshell is resis...

<ol>
	<li>Haag, E. S., Fitch, D. H. A., Delattre, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+&amp;#34;the+worm&amp;#34;+to+&amp;#34;the+worms&amp;#34;+and+back+again:+the+evolutionary+developmental+biology+of+nematodes.">From &amp;#34;the worm&amp;#34; to &amp;#34;the worms&amp;#34; and back again: the evolutionary developmental biology of nematodes.</a> Genetics. 210 (2), 397-433 (2018).</li><li>Sommer, R. J., Bumbarger, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nematode+model+systems+in+evolution+and+development.">Nematode model systems in evolution and development.</a> Wiley Interdisciplinary Reviews: Developmental Biology. 1 (3), 389-400 (2012).</li><li>. WormBase Available from: <a target="_blank" href="https://wormbase.org/#012-3-6">https://wormbase.org/#012-3-6</a> (2022)</li><li>. WormAtlas Available from: <a target="_blank" href="https://wormatlas.org">https://wormatlas.org</a> (2022)</li><li>. WormBook in Genetics Available from: <a target="_blank" href="https://academic.oup.com/genetics/pages/wormbook">https://academic.oup.com/genetics/pages/wormbook</a> (2022)</li><li>Cao, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+single-cell+transcriptional+profiling+of+a+multicellular+organism.">Comprehensive single-cell transcriptional profiling of a multicellular organism.</a> Science. 357 (6352), 661-667 (2017).</li><li>Kaletsky, R., Murphy, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+profiling+of+C.+elegans+adult+cells+and+tissues+with+age.">Transcriptional profiling of C. elegans adult cells and tissues with age.</a> Methods in Molecular Biology. 2144, 177-186 (2020).</li><li>Kaletsky, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptome+analysis+of+adult+Caenorhabditis+elegans+cells+reveals+tissue-specific+gene+and+isoform+expression.">Transcriptome analysis of adult Caenorhabditis elegans cells reveals tissue-specific gene and isoform expression.</a> PLoS Genetics. 14 (8), 1007559 (2018).</li><li>Packer, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+lineage-resolved+molecular+atlas+of+C.+elegans+embryogenesis+at+single-cell+resolution.">A lineage-resolved molecular atlas of C. elegans embryogenesis at single-cell resolution.</a> Science. 365 (6459), 1971 (2019).</li><li>Kulkarni, A., Anderson, A. G., Merullo, D. P., Konopka, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beyond+bulk:+a+review+of+single+cell+transcriptomics+methodologies+and+applications.">Beyond bulk: a review of single cell transcriptomics methodologies and applications.</a> Current Opinion in Biotechnology. 58, 129-136 (2019).</li><li>Von Stetina, S. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-specific+microarray+profiling+experiments+reveal+a+comprehensive+picture+of+gene+expression+in+the+C.+elegans+nervous+system.">Cell-specific microarray profiling experiments reveal a comprehensive picture of gene expression in the C. elegans nervous system.</a> Genome Biology. 8 (7), 135 (2007).</li><li>Baugh, L. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+homeodomain+protein+PAL-1+specifies+a+lineage-specific+regulatory+network+in+the+C.+elegans+embryo.">The homeodomain protein PAL-1 specifies a lineage-specific regulatory network in the C. elegans embryo.</a> Development. 132 (8), 1843-1854 (2005).</li><li>Haenni, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+C.+elegans+intestinal+gene+expression+and+polyadenylation+by+fluorescence-activated+nuclei+sorting+and+3'-end-seq.">Analysis of C. elegans intestinal gene expression and polyadenylation by fluorescence-activated nuclei sorting and 3'-end-seq.</a> Nucleic Acids Research. 40 (13), 6304-6318 (2012).</li><li>Zhang, S., Banerjee, D., Kuhn, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+culture+of+larval+cells+from+C.+elegans.">Isolation and culture of larval cells from C. elegans.</a> PLoS One. 6 (4), 19505 (2011).</li><li>Emmert-Buck, M. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser+capture+microdissection.">Laser capture microdissection.</a> Science. 274 (5289), 998-1001 (1996).</li><li>Hashimshony, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CEL-Seq2:+sensitive+highly-multiplexed+single-cell+RNA-Seq.">CEL-Seq2: sensitive highly-multiplexed single-cell RNA-Seq.</a> Genome Biology. 17, 77 (2016).</li><li>Yanai, I., Hashimshony, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CEL-Seq2-single-cell+RNA+sequencing+by+multiplexed+linear+amplification.">CEL-Seq2-single-cell RNA sequencing by multiplexed linear amplification.</a> Methods in Molecular Biology. 1979, 45-56 (2019).</li><li>Porta-de-la-Riva, M., Fontrodona, L., Villanueva, A., Ceron, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basic+Caenorhabditis+elegans+methods:+synchronization+and+observation.">Basic Caenorhabditis elegans methods: synchronization and observation.</a> Journal of Visualized Experiments: JoVE. (64), e4019 (2012).</li><li>Baugh, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=To+grow+or+not+to+grow:+nutritional+control+of+development+during+Caenorhabditis+elegans+L1+arrest.">To grow or not to grow: nutritional control of development during Caenorhabditis elegans L1 arrest.</a> Genetics. 194 (3), 539-555 (2013).</li><li>Baugh, L. R., Hu, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Starvation+responses+throughout+the+Caenorhabditis+elegans+life+cycle.">Starvation responses throughout the Caenorhabditis elegans life cycle.</a> Genetics. 216 (4), 837-878 (2020).</li><li>Pepper, A. S., Killian, D. J., Hubbard, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+analysis+of+Caenorhabditis+elegans+glp-1+mutants+suggests+receptor+interaction+or+competition.">Genetic analysis of Caenorhabditis elegans glp-1 mutants suggests receptor interaction or competition.</a> Genetics. 163 (1), 115-132 (2003).</li><li>Mok, D. Z., Sternberg, P. W., Inoue, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphologically+defined+sub-stages+of+C.+elegans+vulval+development+in+the+fourth+larval+stage.">Morphologically defined sub-stages of C. elegans vulval development in the fourth larval stage.</a> BMC Developmental Biology. 15, 26 (2015).</li><li>Lytal, N., Ran, D., An, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Normalization+methods+on+single-cell+RNA-seq+data:+an+empirical+survey.">Normalization methods on single-cell RNA-seq data: an empirical survey.</a> Frontiers in Genetics. 11, 41 (2020).</li><li>Vieth, B., Ziegenhain, C., Parekh, S., Enard, W., Hellmann, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=powsimR:+power+analysis+for+bulk+and+single+cell+RNA-seq+experiments.">powsimR: power analysis for bulk and single cell RNA-seq experiments.</a> Bioinformatics. 33 (21), 3486-3488 (2017).</li><li>Bolkova, J., Lanctot, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+gene+expression+analysis+in+Caenorhabditis+elegans+using+single+molecule+RNA+FISH.">Quantitative gene expression analysis in Caenorhabditis elegans using single molecule RNA FISH.</a> Methods. 98, 42-49 (2016).</li><li>Ji, N., van Oudenaarden, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+molecule+fluorescent+in+situ+hybridization+(smFISH)+of+C.+elegans+worms+and+embryos.">Single molecule fluorescent in situ hybridization (smFISH) of C. elegans worms and embryos.</a> WormBook. , 1-16 (2012).</li><li>Lee, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+RNA+fluorescence+in+situ+hybridization+(smFISH)+in+Caenorhabditis+elegans.">Single-molecule RNA fluorescence in situ hybridization (smFISH) in Caenorhabditis elegans.</a> Bio-Protocol. 7 (12), 2357 (2017).</li><li>Baird, S. E., Chamberlin, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Caenorhabditis+briggsae+methods.">Caenorhabditis briggsae methods.</a> WormBook. , 1-9 (2006).</li><li>Felix, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oscheius+tipulae.">Oscheius tipulae.</a> WormBook. , 1-8 (2006).</li><li>Han, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+transgenesis+efficiency+and+CRISPR-associated+tools+through+codon+optimization+and+native+intron+addition+in+Pristionchus+nematodes.">Improving transgenesis efficiency and CRISPR-associated tools through codon optimization and native intron addition in Pristionchus nematodes.</a> Genetics. 216 (4), 947-956 (2020).</li><li>Fernandes Povoa, E. E., Ebbing, A. L. P., Betist, M. C., vander Veen, C., Korswagen, H. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+optimized+dissociation+protocol+for+FACS-based+isolation+of+rare+cell+types+from+Caenorhabditis+elegans+L1+larvae.">An optimized dissociation protocol for FACS-based isolation of rare cell types from Caenorhabditis elegans L1 larvae.</a> MethodsX. 7, 100922 (2020).</li><li>Han, M., Wei, G., McManus, C. E., Hillier, L. W., Reinke, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolated+C.+elegans+germ+nuclei+exhibit+distinct+genomic+profiles+of+histone+modification+and+gene+expression.">Isolated C. elegans germ nuclei exhibit distinct genomic profiles of histone modification and gene expression.</a> BMC Genomics. 20 (1), 500 (2019).</li><li>Steiner, F. A., Henikoff, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+type-specific+affinity+purification+of+nuclei+for+chromatin+profiling+in+whole+animals.">Cell type-specific affinity purification of nuclei for chromatin profiling in whole animals.</a> Methods in Molecular Biology. 1228, 3-14 (2015).</li><li>Ebbing, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spatial+transcriptomics+of+C.+elegans+males+and+hermaphrodites+identifies+sex-specific+differences+in+gene+expression+patterns.">Spatial transcriptomics of C. elegans males and hermaphrodites identifies sex-specific differences in gene expression patterns.</a> Developmental Cell. 47 (6), 801-813 (2018).</li><li>R&#246;delsperger, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spatial+transcriptomics+of+nematodes+identifies+sperm+cells+as+a+source+of+genomic+novelty+and+rapid+evolution.">Spatial transcriptomics of nematodes identifies sperm cells as a source of genomic novelty and rapid evolution.</a> Molecular Biology and Evolution. 38 (1), 229-243 (2021).</li><li>Amini, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+optimised+protocol+for+isolation+of+RNA+from+small+sections+of+laser-capture+microdissected+FFPE+tissue+amenable+for+next-generation+sequencing.">An optimised protocol for isolation of RNA from small sections of laser-capture microdissected FFPE tissue amenable for next-generation sequencing.</a> BMC Molecular Biology. 18 (1), 22 (2017).</li></ol>

Critical steps of the method 
If performed correctly, the method described here will obtain robust RNA profiles with a relatively small number of laser-dissected samples (70 tail tips in this example). However, for samples from developing animals, tight synchronization is critical to reducing the variability between samples. For this reason, the protocol recommends the hatch-off method for worm-synchronization. Here, the researcher can determine and precisely control the age difference between indiv...

Nematodes&#8212;particularly the rhabditid nematodes related to the model system Caenorhabditis elegans&#8212;are a wonderful group of animals for evolutionary developmental biology (EDB) for many reasons1,2. Advantages include their small number of cells, defined and consistent cell lineages, transparency, and ease of culture and husbandry. There are also many resources available, including high-quality genomes for multiple species, and for C. elegans, extensive molecular genetic tools and knowledge about development, genetics, anatomy, and physiology3,4,5,6.
As with many other organisms, the ability to characterize transcriptome dynamics in single tissues or single cells has revolutionized the analysis of development in C. elegans7,8,9,10. Being able to compare single-cell transcriptomes across nematodes would similarly transform EDB using these organisms. For example, such comparisons would provide insight into how gene regulatory networks have evolved for characters (traits) that have been conserved, for characters that have diverged, or for characters that evolved independently.

However, isolating particular tissues or cells from nematodes is one of the big challenges. For many organisms, single cells can be dissociated from tissues and harvested in an unbiased way or can be labeled with tissue-specific expression of a fluorescent protein and sorted by fluorescence-activated cell sorting (FACS)11. In C. elegans, high-throughput (HTP) isolation of cells has been limited mostly to embryos because the tough outer cuticle (and hydrostatic skeleton) has hampered cell isolation from larvae and adults. To get around this challenge, some methods have employed genetic tools in whole C. elegans worms, such as tissue-specific mRNA-tagging12, and differential expression comparisons between wild-type and mutants affecting a cell type13. More recent methods have overcome the challenge by dissolving the cuticle to isolate nuclei14 or entire cells8,9,15. Cell isolation and cell culture have the obvious disadvantages, however, that cells are removed from their natural developmental or anatomical context&#8212;e.g., away from cell-cell signaling and contact with the extracellular matrix&#8212;which are expected to impact the gene expression profile15. Moreover, the genetic tools and tissue-specific markers are species-specific (i.e., they can only be used in C. elegans).
LMD provides an alternative method for isolating tissues without disrupting the natural context of cells. Significantly for EDB, LMD also allows transcriptomes from homologous tissues of different species to be compared without the need for species-specific genetic toolkits if genome or whole transcriptome sequences of these species are available. LMD involves targeting tissues by direct microscopical observation and using a laser microbeam&#8212;integrated into the microscope&#39;s optics&#8212;to cut out and harvest (capture) the tissue of interest16. Limitations of LMD are that it is not conducive to very HTP approaches (although the transcription profiles for tail tips, as described in this protocol, were robust with ~70 samples), certain samples might be difficult to dissect out, and cuts are limited to the precision of the laser and what can be visualized in the microscope.
The purpose of the present protocol is to describe how LMD, followed by single-tissue RNA-Seq, can be used to obtain stage- and tissue-specific transcriptome data from nematodes. Specifically, it demonstrates LMD for isolating tail tips from fourth-stage larvae (L4) of C. elegans. However, this method can be adapted to other tissues and, of course, different species.
In C. elegans, there are 4 cells that make the tail tip in both males and hermaphrodites. During the L4 stage in males&#8212;but not in hermaphrodites&#8212;the tail tip cells change their shape and migrate anteriorly and inwardly. This process also occurs in some but not all other rhabditid nematode species. Therefore, the tail tip is a good model for the evolution of sexual dimorphic morphogenesis. Because of its position, the tail tip is also easy to isolate by LMD.
To obtain transcriptome profiles from tail tips, the present protocol uses CEL-Seq2, an RNA-seq method developed for single cells17,18. This method has several advantages for LMD-derived tissues. CEL-Seq2 is highly sensitive and efficient, using unique molecular identifiers (UMIs) to allow straightforward quantification of mRNA reads, in vitro transcription to ensure linear amplification, and barcoding that allows multiplexing of individual tissue samples. The only limitation of CEL-Seq2 is that recovered reads are biased to the 3&#39; end of mRNAs, and most isoforms thus cannot be distinguished.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>&#160;0.5 &#181;M PEN membrane glass slides RNase free</td>
			<td>Leica</td>
			<td>11600288</td>
			<td>for LMD</td>
		</tr>
		<tr>
			<td>500 &#181;L PCR tubes (nuclease-free)</td>
			<td>Axygen</td>
			<td>732-0675</td>
			<td>to cut the tail tips into</td>
		</tr>
		<tr>
			<td>Compound microscope with 40x objective and DIC</td>
			<td>any</td>
			<td></td>
			<td>to check age of worms</td>
		</tr>
		<tr>
			<td>Desktop humidifier</td>
			<td>any</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Dissection microscope with transmitted light base</td>
			<td>any</td>
			<td></td>
			<td>for all worm work</td>
		</tr>
		<tr>
			<td>glass pasteur pipets</td>
			<td>any</td>
			<td></td>
			<td>handle of worm pick</td>
		</tr>
		<tr>
			<td>glass slides and coverslips</td>
			<td>any</td>
			<td></td>
			<td>to check age of worms</td>
		</tr>
		<tr>
			<td>LMD6 microdissection system</td>
			<td>Leica</td>
			<td>multiple</td>
			<td>to cut tail tips</td>
		</tr>
		<tr>
			<td>LoBind tubes 0.5 mL</td>
			<td>Eppendorf</td>
			<td>22431005</td>
			<td></td>
		</tr>
		<tr>
			<td>M9 Buffer</td>
			<td></td>
			<td></td>
			<td>Recipe in WormBook</td>
		</tr>
		<tr>
			<td>Methanol 99.8%</td>
			<td>Sigma</td>
			<td>322415</td>
			<td>to fix worms</td>
		</tr>
		<tr>
			<td>NGM growth medium</td>
			<td>US Biological</td>
			<td>N1000</td>
			<td>Buffers and salts need to be added: Recipe in WormBook</td>
		</tr>
		<tr>
			<td>P10 pipette variablle volume</td>
			<td>e.g. Gilson</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>P1000 pipette variable volume</td>
			<td>e.g. Gilson</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>P2 pipette variable volume</td>
			<td>e.g. Gilson</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Pipette tips 1,000 &#181;L</td>
			<td>any</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Pipette tips 1-10 &#181;L filtered</td>
			<td>any</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>platinum iridium wire</td>
			<td>Tritech</td>
			<td>PT-9010</td>
			<td>to make worm pick</td>
		</tr>
		<tr>
			<td>sterile and nuclease-free 1 mL centrfuge tubes</td>
			<td>any</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Tween 20</td>
			<td>Sigma</td>
			<td>P9416</td>
			<td>Add a very small amount to M9 buffer to prevent worms from sticking to the pipet tips</td>
		</tr>
		<tr>
			<td>vented 6 mm plastic Petri dishes</td>
			<td>any</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>For CEL-Seq2</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>4200 TapeStation System with reagents for high-sensitivity RNA and DNA detection</td>
			<td>Aligent</td>
			<td></td>
			<td>automated electrophoresis system</td>
		</tr>
		<tr>
			<td>AMPure XP beads</td>
			<td>Beckman Coulter</td>
			<td>A63880</td>
			<td>DNA cleanup beads</td>
		</tr>
		<tr>
			<td>Bead binding buffer&#160; 20% PEG8000, 2.5 M NaCl</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>CEL-Seq2 primers (see Table S1)</td>
			<td>Sigma Genosys Mastercycler Nexus GX2 Eppendorf</td>
			<td>6335000020</td>
			<td>Thermal cycler with programmable lid and block for 200 &#181;l tubes.</td>
		</tr>
		<tr>
			<td>DNA Polymerase I (E. coli)</td>
			<td>Invitrogen</td>
			<td>18052-025</td>
			<td></td>
		</tr>
		<tr>
			<td>dNTP mix 10 mM</td>
			<td>any</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>E. coli DNA ligase</td>
			<td>Invitrogen</td>
			<td>18052-019</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>ExoSAP-IT For PCR Product Clean-Up</td>
			<td>Affymetrix</td>
			<td>78200</td>
			<td>exonuclease solution</td>
		</tr>
		<tr>
			<td>MEGAscript T7 Transcription Kit</td>
			<td>Ambion</td>
			<td>AM1334</td>
			<td>For step 4.6.1</td>
		</tr>
		<tr>
			<td>Nuclease-free water</td>
			<td>any</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Phusion High-Fidelity PCR Master Mix with HF Buffer</td>
			<td>NEB</td>
			<td>M0531</td>
			<td>PCR mix step 4.9.7</td>
		</tr>
		<tr>
			<td>random hexamer RT primer GCCTTGGCACCCGAGAATTCCA 
			NNNNNN</td>
			<td>IDT</td>
			<td></td>
			<td>a primer with 6 nucleotides that are random</td>
		</tr>
		<tr>
			<td>RNA Fragmentation buffer</td>
			<td>NEB</td>
			<td>E6150S</td>
			<td></td>
		</tr>
		<tr>
			<td>RNA Fragmentation stop buffer</td>
			<td>NEB</td>
			<td>E6150S</td>
			<td></td>
		</tr>
		<tr>
			<td>RNA PCR Index Primers (RPI1&#8211;RPI48)</td>
			<td>Illumina, NEB, or IDT</td>
			<td></td>
			<td>RPIX in protocol step 4.9.7, sequences available from Illumina</td>
		</tr>
		<tr>
			<td>RNAClean XP beads</td>
			<td>Beckman Coulter</td>
			<td>A63987</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase AWAY Surface Decontaminant</td>
			<td>Thermo Scientific</td>
			<td>7000TS1</td>
			<td>or any other similar product</td>
		</tr>
		<tr>
			<td>RNaseH (E. coli)</td>
			<td>Invitrogen</td>
			<td>18021-071</td>
			<td></td>
		</tr>
		<tr>
			<td>RNaseOUT Recombinant Ribonuclease Inhibitor</td>
			<td>Invitrogen</td>
			<td>10777-019</td>
			<td></td>
		</tr>
		<tr>
			<td>Second strand buffer</td>
			<td>Invitrogen</td>
			<td>10812-014</td>
			<td></td>
		</tr>
		<tr>
			<td>Superscripit II</td>
			<td>Invitrogen</td>
			<td>18064-014</td>
			<td>reverse transcriptase</td>
		</tr>
	</tbody>
</table>

laser microdissection for species-agnostic single-tissue applications

Single-cell methodologies have revolutionized the analysis of the transcriptomes of specific cell types. However, they often require species-specific genetic &#34;toolkits,&#34; such as promoters driving tissue-specific expression of fluorescent proteins. Further, protocols that disrupt tissues to isolate individual cells remove cells from their native environment (e.g., signaling from neighbors) and may result in stress responses or other differences from native gene expression states. In the present protocol, laser microdissection (LMD) is optimized to isolate individual nematode tail tips for the study of gene expression during male tail tip morphogenesis.
LMD allows the isolation of a portion of the animal without the need for cellular disruption or species-specific toolkits and is thus applicable to any species. Subsequently, single-cell RNA-seq library preparation protocols such as CEL-Seq2 can be applied to LMD-isolated single tissues and analyzed using standard pipelines, given that a well-annotated genome or transcriptome is available for the species. Such data can be used to establish how conserved or different the transcriptomes are that underlie the development of that tissue in different species.
Limitations include the ability to cut out the tissue of interest and the sample size. A power analysis shows that as few as 70 tail tips per condition are required for 80% power. Tight synchronization of development is needed to obtain this number of animals at the same developmental stage. Thus, a method to synchronize animals at 1 h intervals is also described.

Following laser capture microdissection, individual tail tips of males and hermaphrodites at 4 time points (L3 22 h after hatch; L4 24, 26, and 28 h after hatch) were prepared for RNA sequencing using the CEL-Seq2 protocol. CEL-Seq2 primers contain unique barcodes that enable sequencing reads from a particular sample (in this case an individual tail tip) to be identified bioinformatically. Sequencing data were generated with this method for a total of 557 tail tips (266 hermaphrodites and 291 males across 4 developmental...

Watch this Scientific Journal Video about Laser Microdissection for Species-Agnostic Single-Tissue Applications at JoVE.com

Laser Microdissection for Species-Agnostic Single-Tissue Applications

A protocol is described that uses laser microdissection to isolate individual nematode tissues for RNA-sequencing. The protocol does not require species-specific genetic toolkits, allowing gene expression profiles to be compared between different species at the level of single-tissue samples.

Single-cell methodologies have revolutionized the analysis of the transcriptomes of specific cell types. However, they often require species-specific ...

We combine laser capture microdissection with a single cell RNA seek protocol called CEL-Seq2 to generate transcriptomic data sets for small individual tissue samples. This technique lets us study gene expression in tissues or species that cannot be studied using traditional cell sorting methods. Additionally, it provides more specificity than a bulk RNA-seq approach.Here we demonstrated this technique for the four celled tail tips of C.elegans fourth larval stage males and hermaphrodites. But the beauty of this approach is that it can even be applied to non-model species. Demonstrating the procedure will be Ms.Raya Jallad, PhD student from my laboratory and Dr.Antonio Herrera, currently lead biomedical scientist at the Baylor school in Chattanooga, Tennessee.Begin by gently pipetting one to two milliliters of M9 buffer against the wall of the plate without squirting. Swirl the plate to dislodge the worms. Remove and discard all the liquid and the worms by placing the pipette tip against the wall of the plate at the edge of the agar to avoid poking holes.This video shows the plate before mothers and larva are removed. Only embryos should be left after the mothers and larva are removed. L1 larva will start appearing after incubation for an hour or so.Then place the plate at 25 degrees Celsius. After one hour, remove the plate from the incubator. Carefully drop one milliliter of M9 buffer onto the agar and swirl the plate to dislodge the L1s but not the embryos.Centrifuge the tube and pipette the L1s directly onto the bacterial lawn of a seeded plate. Keep the worms at 25 degrees Celsius. Under a dissection microscope at 30 to 50 X magnification, begin picking the males and the hermaphrodites from the synchronization plates onto separate unseated plates.Males are distinguished from hermaphrodites by the bulged shape and lighter color of the male tails compared to the pointed shape and darker color of the hermaphrodite tails. Wash the worms off the plate with one to two milliliters of M9 buffer using a pipette tip pre-washed with M9 buffer containing 0.01%detergent. Transfer the worms to a one milliliter centrifuge tube, spin for one minute and add one milliliter of M9 buffer.Again, spin for one minute. Add one milliliter of ice cold 70%methanol and mix well. Repeat the wash with one milliliter methanol, mix well.Spin it for one minute and add 500 microliters of 70%methanol. Mix it and store it at four degrees Celsius for one hour to overnight. Pipette 20 microliters of the fixed worms onto the coated side of a polyethylene naphthalate or PEN-membrane glass slide.Wait for the methanol to evaporate. Remove the plastic shield over the stage and click the unload button with the upward arrow for loading the membrane slides. Make sure the slide is completely dry, flip so that the membrane is facing down and insert the slide.Click continue in the change specimen window. The slide holder will move. Then replace the plastic shield, on the bottom of the screen, choose which slide holder contains the slide and click the unload button with the downward arrow to load the tubes.Pull the tray out and remove the tube block. Insert the tube caps of four 500 microliter PCR tubes into the holder and fold the tube under. Return the block to the tray and slide the tray back into the microscope stage.In the change collector device popup window, select PCR tubes, and click okay. Click on the empty tube location on the bottom left of the screen under collector device tube caps and in the microscope control panel select TLBF for transmitted light bright field illumination. Using the 2.5X lens, adjust the focus until the worms and the surface structure of the PEN-membrane are visible.Switch to the 20X lens and move the stage to a region without worms. Adjust the focus such that the bubble like structures in the membrane have a yellowish color to focus the laser on the correct focal plane then set the laser parameters. For the tail tips, start with power 45 aperture 30 in speed 20.In the laser control panel, select calibrate and follow the instructions. Next, on the bottom of the screen at collector device tube caps click on position A, on the right side of the screen select single shape, followed by draw and cut. Then select point to point and draw a line.Click start cut so that the laser cuts through the membrane. Find a worm and switch to move and cut. Use the mouse to cut through the tail.To collect the sample, switch to the draw and cut setting with the point to point function and draw shape to complete the cut of a membrane section. Select the next tube at collector device tube cap on the bottom of the screen and cut the next tail tip. Once four tails are cut, unload the tube rack by clicking unload with the downward arrow.Find the membrane sections under a dissecting microscope and continue with the downstream sample processing. Here RNA sequencing with CEL-Seq2. Pipette 1.2 microliters of a CEL-Seq2 primer master mix directly on top of the sample and close the tube.Label with the primer number and immediately place the tube cap directly on a piece of dry ice to flash freeze the sample thus preventing RNA degradation. Repeat until all samples have been collected. Finally store the tubes at minus 70 degrees Celsius.C.elegans L3 hermaphrodites and males at 21 to 23 hours after hatch can be distinguished under a dissection microscope by the morphology of their tails. The tale of hermaphrodite is narrow while that of males is swollen and appears clear. The appearance of the PEN-membrane slide structure and worm tail is shown in these images.Here the focus is correct for the 20X and 40X lenses at the microscope. The dissected tail impartially cut out PEN-membrane are visible here. After closing the gap in the cut, the membrane piece will drop into the tube cap below the slide.A tube cap with a PEN-membrane section containing a dissected tail tip is shown here. The graphical image represents the natural log transformed unique molecular identifier or UMI counts per individual tail tip for different time points and sexes. The powsimR software is used to determine how many independent samples are required to detect differential expressed or DE genes at various expression levels.The graphical image here represents the true positive rate to detect the DE genes between two conditions for four different simulations incorporating different sample sizes per condition. The dashed line indicates an 80%true positive rate. The false discovery rate and the same four simulations is shown here.The dashed line indicates a 10%false discovery rate. The graphs showed that a sample size of 70 tail tips per condition is sufficient for detecting the DE genes except for the genes with very low expression levels. For proper synchronization, ensure that only embryos are present on the plate.To ensure against sample loss, pipette the primer mix directly onto the PEN-membrane section in the cap and be extremely gentle in closing the cap. Because it's species agnostic, we can use this protocol to explore how gene regulatory networks have evolved for homologous structures in different species.

laser-microdissection-for-species-agnostic-single-tissue-applications

Research

JoVE Journal

Biology

2.1K ビュー.  New York University. レーザーキャプチャマイクロダイセクションとCEL-Seq2と呼ばれる単一細胞RNAシークプロトコルを組み合わせて、小さな個々の組織サンプルのトランスクリプトームデータセットを生成します。この技術により、従来の細胞選別法では研究できない組織や種における遺伝子発現を研究することができます。さらに、バルクRNA-seqアプローチよりも特異性を提供します。?...

ビデオ: Laser Microdissection for Species-Agnostic Single-Tissue Applications

Laser Capture Microdissection of Mammalian Tissue

Laser capture microscopy, also known as laser microdissection (LMD), enables the user to isolate small numbers of cells or tissues from frozen or formalin-fixed, paraffin-embedded tissue sections. LMD techniques rely on a thermo labile membrane placed either on top of, or underneath, the tissue section. In one method, focused laser energy is used to melt the membrane onto the underlying cells, which can then be lifted out of the tissue section. In the other, the laser energy vaporizes the foil along a path "drawn" on the tissue, allowing the selected cells to fall into a collection device. Each technique allows the selection of cells with a minimum resolution of several microns. DNA, RNA, protein, and lipid samples may be isolated and analyzed from micro-dissected samples. In this video, we demonstrate the use of the Leica AS-LMD laser microdissection instrument in seven segments, including an introduction to the principles of LMD, initializing the instrument for use, general considerations for sample preparation, mounting the specimen and setting up capture tubes, aligning the microscope, adjusting the capture controls, and capturing tissue specimens. Laser-capture micro-dissection enables the investigator to isolate samples of pure cell populations as small as a few cell-equivalents. This allows the analysis of cells of interest that are free of neighboring contaminants, which may confound experimental results.

Laser capture microscopy, also known as laser microdissection (LMD), enables the user to isolate small numbers of cells or tissues from frozen or ...

Microfluidic Applications for Disposable Diagnostics

In this interview, Dr. Klapperich discusses the fabrication of thermoplastic microfluidic devices and their application for development of new diagnostics.

In this interview, Dr. Klapperich discusses the fabrication of thermoplastic microfluidic devices and their application for development of new diagnostics.

In this interview, Dr. Klapperich discusses the fabrication of thermoplastic microfluidic devices and their application for development of new ...

Laser Microdissection Applied to Gene Expression Profiling of Subset of Cells from the Drosophila Wing Disc

Heterogeneous nature of tissues has proven to be a limiting factor in the amount of information that can be generated from biological samples, compromising downstream analyses. Considering the complex and dynamic cellular associations existing within many tissues, in order to recapitulate the in vivo interactions thorough molecular analysis one must be able to analyze specific cell populations within their native context. Laser-mediated microdissection can achieve this goal, allowing unambiguous identification and successful harvest of cells of interest under direct microscopic visualization while maintaining molecular integrity. We have applied this technology to analyse gene expression within defined areas of the developing Drosophila wing disc, which represents an advantageous model system to study growth control, cell differentiation and organogenesis. Larval imaginal discs are precociously subdivided into anterior and posterior, dorsal and ventral compartments by lineage restriction boundaries. Making use of the inducible GAL4-UAS binary expression system, each of these compartments can be specifically labelled in transgenic flies expressing an UAS-GFP transgene under the control of the appropriate GAL4-driver construct. In the transgenic discs, gene expression profiling of discrete subsets of cells can precisely be determined after laser-mediated microdissection, using the fluorescent GFP signal to guide laser cut. 
Among the variety of downstream applications, we focused on RNA transcript profiling after localised RNA interference (RNAi). With the advent of RNAi technology, GFP labelling can be coupled with localised knockdown of a given gene, allowing to determinate the transcriptional response of a discrete cell population to the specific gene silencing. To validate this approach, we dissected equivalent areas of the disc from the posterior (labelled by GFP expression), and the anterior (unlabelled) compartment upon regional silencing in the P compartment of an otherwise ubiquitously expressed gene. RNA was extracted from microdissected silenced and unsilenced areas and comparative gene expression profiling determined by quantitative real-time RT-PCR. We show that this method can effectively be applied for accurate transcriptomics of subsets of cells within the Drosophila imaginal discs. Indeed, while massive disc preparation as source of RNA generally assumes cell homogeneity, it is well known that transcriptional expression can vary greatly within these structures in consequence of positional information. Using localized fluorescent GFP signal to guide laser cut, more accurate transcriptional analyses can be performed and profitably applied to disparate applications, including transcript profiling of distinct cell lineages within their native context.

Laser Microdissection Applied to Gene Expression Profiling of Subset of Cells from the Drosophila Wing Disc

Laser microdissection was applied to analyse gene expression profiling in specific compartments of Drosophila wing disc subjected to localised RNAi in vivo. RNA extracted from equivalent areas of silenced and unsilenced compartments was analysed by quantitative RT-PCR to determine comparative gene expression profiling within the context of native tissue microecology.

Heterogeneous nature of tissues has proven to be a limiting factor in the amount of information that can be generated from biological samples, ...

Microdissection of Zebrafish Embryonic Eye Tissues

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post fertilization (dpf), the larvae will show the first visual response. Many genes have been identified to control a proper eye development, but we are far from a complete understanding of the underlying genetic architecture. Whole genome gene expression profiling is a useful tool to elucidate genetic regulatory network for eye development. However, the small size of the embryonic eye in zebrafish makes it challenging to obtain intact and pure eye tissues for expression analysis. For example, the anterior-posterior length of the eye between day 2 and 3 is only approximately 200-300 &mu;m, while the diameter of the lens is less 100 &mu;m. Also, the retinal pigment epithelium (RPE) underlying the retina is just a single-layer epithelium. While gene expression profiles can be obtained from the whole embryo, they do not accurately represent the expression of these tissues. Therefore pure tissue must be obtained for a successful gene expression profiling of eye development. To address this issue, we have developed an approach to microdissect intact retina and retina with RPE attached from 1-3 dpf, which cover major stages of eye morphogenesis. All procedures can be done with fine forceps and general laboratory supplies under standard stereomicroscopes. For retinal dissection, the single-layer RPE is removed and peeled off by brushing action and the preferential adherence of the RPE remnants to the surface of the culture plate for dissection. For RPE-attached retinal dissection, the adherence of RPE to the dissection plate is removed before the dissection so that the RPE can be completely preserved with the retina. A careful lifting action of this tissue can efficiently separate the presumptive choroid and sclera. The lens can be removed in both cases by a chemically etched tungsten needle. In short, our approach can obtain intact eye tissues and has been successfully utilized to study tissue-specific expression profiles of zebrafish retina1, 2 and retinal pigment epithelium3.

This article describes an approach to microdissect zebrafish retinas with and without retinal pigment epithelium attached, from one to three days postfertilization embryos.

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post ...

Absolute Quantum Yield Measurement of Powder Samples

Measurement of fluorescence quantum yield has become an important tool in the search for new solutions in the development, evaluation, quality control and research of illumination, AV equipment, organic EL material, films, filters and fluorescent probes for bio-industry.
Quantum yield is calculated as the ratio of the number of photons absorbed, to the number of photons emitted by a material. The higher the quantum yield, the better the efficiency of the fluorescent material.
For the measurements featured in this video, we will use the Hitachi F-7000 fluorescence spectrophotometer equipped with the Quantum Yield measuring accessory and Report Generator program. All the information provided applies to this system. 
Measurement of quantum yield in powder samples is performed following these steps:
<ol>
 <li>Generation of instrument correction factors for the excitation and emission monochromators. This is an important requirement for the correct measurement of quantum yield. It has been performed in advance for the full measurement range of the instrument and will not be shown in this video due to time limitations.</li>
 <li>Measurement of integrating sphere correction factors. The purpose of this step is to take into consideration reflectivity characteristics of the integrating sphere used for the measurements.</li>
 <li>Reference and Sample measurement using direct excitation and indirect excitation.</li>
 <li>Quantum Yield calculation using Direct and Indirect excitation. Direct excitation is when the sample is facing directly the excitation beam, which would be the normal measurement setup. However, because we use an integrating sphere, a portion of the emitted photons resulting from the sample fluorescence are reflected by the integrating sphere and will re-excite the sample, so we need to take into consideration indirect excitation. This is accomplished by measuring the sample placed in the port facing the emission monochromator, calculating indirect quantum yield and correcting the direct quantum yield calculation.</li>
 <li>Corrected quantum yield calculation.</li>
 <li>Chromaticity coordinates calculation using Report Generator program.</li>
</ol>
The Hitachi F-7000 Quantum Yield Measurement System offer advantages for this
application, as follows:
<ul>
 <li>High sensitivity (S/N ratio 800 or better RMS). Signal is the Raman band of water measured under the following conditions: Ex wavelength 350 nm, band pass Ex and Em 5 nm, response 2 sec), noise is measured at the maximum of the Raman peak. High sensitivity allows measurement of samples even with low quantum yield. Using this system we have measured quantum yields as low as 0.1 for a sample of salicylic acid and as high as 0.8 for a sample of magnesium tungstate.</li>
 <li>Highly accurate measurement with a dynamic range of 6 orders of magnitude allows for measurements of both sharp scattering peaks with high intensity, as well as broad fluorescence peaks of low intensity under the same conditions. </li>
 <li>High measuring throughput and reduced light exposure to the sample, due to a high scanning speed of up to 60,000 nm/minute and automatic shutter function. </li>
 <li>Measurement of quantum yield over a wide wavelength range from 240 to 800 nm.</li>
 <li>Accurate quantum yield measurements are the result of collecting instrument spectral response and integrating sphere correction factors before measuring the sample.</li>
 <li>Large selection of calculated parameters provided by dedicated and easy to use software.
</li>
</ul> 
During this video we will measure sodium salicylate in powder form which is known to have a quantum yield value of 0.4 to 0.5.

In this video we will demonstrate measuring and calculating absolute quantum yield and chromaticity coordinates directly in powder samples using the Hitachi F-7000 Quantum Yield Measuring System.

Measurement of fluorescence quantum yield has become an important tool in the search for new solutions in the development, evaluation, quality control and ...

RNA Isolation from Cell Specific Subpopulations Using Laser-capture Microdissection Combined with Rapid Immunolabeling

Laser capture microdissection (LCM) allows the isolation of specific cells from thin tissue sections with high spatial resolution. Effective LCM requires precise identification of cells subpopulations from a heterogeneous tissue. Identification of cells of interest for LCM is usually based on morphological criteria or on fluorescent protein reporters. The combination of LCM and rapid immunolabeling offers an alternative and efficient means to visualize specific cell types and to isolate them from surrounding tissue. High-quality RNA can then be extracted from a pure cell population and further processed for downstream applications, including RNA-sequencing, microarray or qRT-PCR. This approach has been previously performed and briefly described in few publications. The goal of this article is to illustrate how to perform rapid immunolabeling of a cell population while keeping RNA integrity, and how to isolate these specific cells using LCM. Herein, we illustrated this multi-step procedure by immunolabeling and capturing dopaminergic cells in brain tissue from one-day-old mice. We highlight key critical steps that deserve special consideration. This protocol can be adapted to a variety of tissues and cells of interest. Researchers from different fields will likely benefit from the demonstration of this approach.

Gene expression analysis of a subset of cells in a specific tissue represents a major challenge. This article describes how to isolate high-quality total RNA from a specific cell population by combining a rapid immunolabeling method with laser capture microdissection.

Laser capture microdissection (LCM) allows the isolation of specific cells from thin tissue sections with high spatial resolution. Effective LCM requires ...

Cryosectioning Method for Microdissection of Murine Colonic Mucosa

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The colonic epithelium is dynamically turned over and epithelial cells are generated in the stem cell containing crypts of Lieberk&#252;hn. Progenitor cells produced in the crypt-bases migrate toward the luminal surface, undergoing a process of cellular differentiation before being shed into the gut lumen. In order to study these processes at the molecular level, we have developed a simple method for the microdissection of two spatially distinct regions of the colonic mucosa; the proliferative crypt zone, and the differentiated surface epithelial cells. Our objective is to isolate specific crypt and surface epithelial cell populations from mouse colonic mucosa for the isolation of RNA and protein.

Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The ...

Laser-assisted Microdissection (LAM) as a Tool for Transcriptional Profiling of Individual Cell Types

The understanding of developmental processes at the molecular level requires insights into transcriptional regulation, and thus the transcriptome, at the level of individual cell types. While the methods described here are generally applicable to a wide range of species and cell types, our research focuses on plant reproduction. Plant cultivation and seed production is of crucial importance for human and animal nutrition. A detailed understanding of the regulatory networks that govern the formation of the reproductive lineage (germline) and ultimately of seeds is a precondition for the targeted manipulation of plant reproduction. In particular, the engineering of apomixis (asexual reproduction through seeds) into crop plants promises great improvements, as it leads to the formation of clonal seeds that are genetically identical to the mother plant. Consequently, the cell types of the female germline are of major importance for the understanding and engineering of apomixis. However, as the corresponding cells are deeply embedded within the floral tissues, they are very difficult to access for experimental analyses, including cell-type specific transcriptomics. To overcome this limitation, sections of individual cells can be isolated by laser-assisted microdissection (LAM). While LAM in combination with transcriptional profiling allows the identification of genes and pathways active in any cell type with high specificity, establishing a suitable protocol can be challenging. Specifically, the quality of RNA obtained after LAM can be compromised, especially when small, single cells are targeted. To circumvent this problem, we have established a workflow for LAM that reproducibly results in high RNA quality that is well suitable for transcriptomics, as exemplified here by the isolation of cells of the female germline in apomictic Boechera. In this protocol, procedures are described for tissue preparation and LAM, also with regard to RNA extraction and quality control.

Laser-assisted Microdissection LAM as a Tool for Transcriptional Profiling of Individual Cell Types

Here we present a protocol for laser-assisted microdissection of specific plant cell types for transcriptional profiling. While the protocol is suitable for different species and cell types, the focus is on highly inaccessible cells of the female germline important for sexual and apomictic reproduction in the crucifer genus Boechera.

The understanding of developmental processes at the molecular level requires insights into transcriptional regulation, and thus the transcriptome, at the ...

Laser Capture Microdissection of Highly Pure Trabecular Meshwork from Mouse Eyes for Gene Expression Analysis

Laser capture microdissection (LCM) has allowed gene expression analysis of single cells and enriched cell populations in tissue sections. LCM is a great tool for the study of the molecular mechanisms underlying cell differentiation and the development and progression of various diseases, including glaucoma. Glaucoma, which comprises a family of progressive optic neuropathies, is the most common cause of irreversible blindness worldwide. Structural changes and damage within the trabecular meshwork (TM) can result in increased intraocular pressure (IOP), which is a major risk factor for developing glaucoma. However, the precise molecular mechanisms involved are still poorly understood. The ability to perform gene expression analysis will be crucial in obtaining further insights into the function of these cells and its role in the regulation of IOP and glaucoma development. To achieve this, a reproducible method for isolating highly enriched TM from frozen sections of mouse eyes and a method for downstream gene expression analysis, such as RT-qPCR and RNA-Seq is needed. The method described herein is developed to isolate highly pure TM from mouse eyes for downstream digital PCR and microarray analysis. In addition, this technique can be easily adapted for the isolation of other highly enriched ocular cells and cell compartments that have been difficult to isolate from mouse eyes. The combination of LCM and RNA analysis can contribute to a more comprehensive understanding of the cellular events underlying glaucoma.

Here, we describe a protocol for a reproducible laser capture microdissection (LCM) for isolating trabecular meshwork (TM) for downstream RNA analysis. The ability to analyze changes in gene expression in the TM will help in understanding the underlying molecular mechanisms of TM-related ocular diseases.

Laser capture microdissection (LCM) has allowed gene expression analysis of single cells and enriched cell populations in tissue sections. LCM is a great ...

A Laser Capture Microdissection Protocol That Yields High Quality RNA from Fresh-frozen Mouse Bones

RNA yield and integrity are decisive for RNA analysis. However, it is often technically challenging to maintain RNA integrity throughout the entire laser capture microdissection (LCM) procedure. Since LCM studies work with low amounts of material, concerns about limited RNA yields are also important. Therefore, an LCM protocol was developed to obtain sufficient quantity of high-quality RNA for gene expression analysis in bone cells. The effect of staining protocol, thickness of cryosections, microdissected tissue quantity, RNA extraction kit, and LCM system used on RNA yield and integrity obtained from microdissected bone cells was evaluated. Eight-&#181;m-thick frozen bone sections were made using an adhesive film and stained using a rapid protocol for a commercial LCM stain. The sample was sandwiched between a polyethylene terephthalate (PET) membrane and the adhesive film. An LCM system that uses gravity for sample collection and a column-based RNA extraction method were used to obtain high quality RNAs of sufficient yield. The current study focusses on mouse femur sections. However, the LCM protocol reported here can be used to study in situ gene expression in cells of any hard tissue in both physiological conditions and disease processes.

A laser capture microdissection (LCM) protocol was developed to obtain sufficient quantity of high-quality RNA for gene expression analysis in bone cells. The current study focusses on mouse femur sections. However, the LCM protocol reported here can be used to study gene expression in cells of any hard tissue.

RNA yield and integrity are decisive for RNA analysis. However, it is often technically challenging to maintain RNA integrity throughout the entire laser ...