Toutes les procédures d&#39;utilisation des animaux soient conformes aux lignes directrices éthiques fixées par l&#39;organe local (Regierungspräsidium de Karlsruhe, Karlsruhe, Allemagne). Une. Préparation de siRNA / PEI complexe La solution complexe siRNA / PEI est préparé en utilisant les instructions du fabricant comme suit: <ol><li> Solution A: Diluer la quantité souhaitée de siRNA avec de l&#39;eau stérile (si nécessaire) jusqu&#39;à un quart du volume final et on dilue davantage avec une solution de glucose à 10% jusqu&#39;à la moitié du volume final. Vortex doucement ou mélanger par pipetage de haut en bas. La quantité optimale de siRNA doit être déterminée de manière empirique mais 1 pg siRNA dans 10 ul solution complexe par animal est un bon point de départ pour l&#39;optimisation. </li><li> Solution B: On dilue le volume nécessaire de PEI réactif avec de l&#39;eau stérile jusqu&#39;à un quart du volume final et on dilue davantage avec une solution de glucose à 10% jusqu&#39;à la moitié du volume final. Vortex gently ou mélanger par pipetage de haut en bas. Note: la quantité de réactif PEI détermine l&#39;équilibre ionique dans le complexe qui influence l&#39;efficacité de la transfection. De même, la quantité optimale de solution de PEI doit être déterminée de façon empirique. Dans nos mains, la quantité optimale est de 0,12 pi de solution de PEI pour 1 ug siRNA. </li><li> Mélanger la solution A avec la solution B à la fois, vortex doucement. </li><li> Incuber la solution mélangée pendant 15 minutes à température ambiante avant utilisation. Ce complexe est stable pendant 2 heures à température ambiante et pendant 24 heures à 4 ° C. </li></ol> 2. Injection intrathécale <ol><li> Anesthésier la souris avec 3% d&#39;isoflurane, jusqu&#39;à ce qu&#39;il ne montre aucun signe de réflexe de redressement. En outre, vérifiez la queue et / ou patte pincée réflexe pour assurer en outre l&#39;état de l&#39;anesthésie. </li><li> Raser environ 2 cm 2 de fourrure à l&#39;extrémité postérieure de l&#39;animal près de la base de la queue afin de faciliter une meilleure visualisation lors de l&#39;insertion de l&#39;aiguille. </li><li> Placez la souris dansun cône de nez pour une administration de l&#39;isoflurane poursuivie au cours de la procédure, de réduire le isoflurane à 1,5%, et couvre les yeux de la souris avec lubrifiant oculaire. </li><li> Préparer le prêt à utiliser siRNA solution mixte en utilisant une seringue Hamilton de 25 ul attaché à un 30 G 0,5 à aiguille. </li><li> Localiser l&#39;apophyse épineuse de la L6, qui devrait être le plus important un le et fixer la colonne de vertébré autour de cette zone en appuyant doucement. </li><li> Insérez délicatement l&#39;aiguille entre la gorge de L5 et L6 vertèbres et observer une queue film que ce signe indique une entrée réussie de l&#39;aiguille dans l&#39;espace intradural. Astuce: Utilisation de l&#39;ongle, on devrait être en mesure de localiser la gorge ainsi. </li><li> Une fois la queue film est observé, immédiatement, mais attention, fixer la position de l&#39;aiguille d&#39;une main et injecter le volume souhaité de la substance avec l&#39;autre main lentement. Astuce: un volume compris entre 5-10 est ul optimale en volume inférieur à 5 et# 181; l est peu fiable et un volume plus grand que 10 pi conduit à trop de pression. </li><li> Une fois l&#39;injection est effectuée, déplacez la souris vers la cage pour remettre de l&#39;anesthésie. </li><li> Répéter cette injection au moins deux fois plus toutes les 24 h pour obtenir la sous-régulation optimale du gène ciblé. </li></ol>

<ol>
	<li>Hylden, J. L., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrathecal+morphine+in+mice:+a+new+technique.">Intrathecal morphine in mice: a new technique.</a> Eur. J. Pharmacol. 67, 313-316 (1980).</li><li>Stokes, J. A., Corr, M., Yaksh, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+tactile+allodynia+following+intrathecal+puncture+in+mouse:+contributions+of+Toll-like+receptor+signaling.">Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling.</a> Neurosci. Lett. 504, 215-218 (2011).</li><li>Goula, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyethylenimine-based+intravenous+delivery+of+transgenes+to+mouse+lung.">Polyethylenimine-based intravenous delivery of transgenes to mouse lung.</a> Gene Ther. , 1291-1295 (1998).</li><li>Fairbanks, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spinal+delivery+of+analgesics+in+experimental+models+of+pain+and+analgesia.">Spinal delivery of analgesics in experimental models of pain and analgesia.</a> Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).</li><li>Hohmann, A. G., Tsou, K., Walker, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cannabinoid+modulation+of+wide+dynamic+range+neurons+in+the+lumbar+dorsal+horn+of+the+rat+by+spinally+administered+WIN55,212-2.">Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2.</a> Neurosci. Lett. 257, 119-122 (1998).</li><li>Song, Z. H., Takemori, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+spinal+kappa+opioid+receptors+in+the+antinociception+produced+by+intrathecally+administered+corticotropin-releasing+factor+in+mice.">Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice.</a> J. Pharmacol. Exp. Ther. 254, 363-368 (1990).</li><li>Trang, T., Sutak, M., Jhamandas, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+cannabinoid+(CB1)-receptors+in+the+development+and+maintenance+of+opioid+tolerance.">Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance.</a> Neuroscience. , 1275-1288 (2007).</li><li>Yaksh, T. L., Rudy, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chronic+catheterization+of+the+spinal+subarachnoid+space.">Chronic catheterization of the spinal subarachnoid space.</a> Physiol. Behav. 17, 1031-1036 (1976).</li><li>Tappe, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synaptic+scaffolding+protein+Homer1a+protects+against+chronic+inflammatory+pain.">Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain.</a> Nat. Med. , 677-681 (2006).</li><li>Bourinet, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+of+the+Cav3.2+T-type+calcium+channel+gene+in+sensory+neurons+demonstrates+its+major+role+in+nociception.">Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception.</a> EMBO J. 24, 315-324 (2005).</li><li>Wang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+transfer+to+dorsal+root+ganglia+by+intrathecal+injection:+effects+on+regeneration+of+peripheral+nerves.">Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves.</a> Mol. Ther. 12, 314-320 (2005).</li><li>Wigdor, S., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+and+systemic+morphine-induced+antinociception+in+mice:+contribution+of+descending+serotonergic+and+noradrenergic+pathways.">Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways.</a> J. Pharmacol. Exp. Ther. 242, 90-95 (1987).</li></ol>

Les auteurs déclarent aucun intérêt financier concurrents.

Ainsi, la technique décrite ci-dessus des injections intrathécales de seringues est efficace, rapide, précisément localisée, et non destructif. Techniquement, l&#39;aspect le plus critique de cette procédure est le point d&#39;insertion de l&#39;aiguille dans la gorge. Il est essentiel que cette procédure se fait avec les mains et la patience très calme. Comme de nombreuses procédures chirurgicales, la formation améliore la vitesse d&#39;injection réussie. Cela est également important, car lors d&#39;une exp...

La moelle épinière est un centre très important dans une variété de processus biologiques clés et les fonctions physiologiques, y compris le traitement et la transmission des entrées douloureuses (nociceptives) 4-7. Diverses techniques expérimentales ont été développées pour faciliter la modulation pharmacologique de la moelle épinière, par exemple une implantation chronique de cathéter intrathécal 8, la moelle épinière de la micro-injection et l&#39;injection intrathécale de l&#39;aiguille 9. Chaque technique a ses avantages et ses inconvénients, et selon le paradigme d&#39;une expérience technique pourrait être plus appropriés que les autres. Considérant que l&#39;implantation chronique de cathéter intrathécal est facilement réalisable chez le rat, ce procédé est très difficile dans la souris, étant donné les restrictions de taille. Le taux de réussite est très faible et des déficits moteurs se produit souvent en raison de la présence encombrante d&#39;un cathéter dans l&#39;espace sous-dural sévèrement limitée dans la souris. Par ailleurs, la livraison à long terme de médicaments est rendu en raison de la coagulation fréquentesdes cathéters implantés de façon chronique. Enfin, les réactions immunitaires sont fréquentes. Ces problèmes peuvent être contournés en utilisant le procédé de l&#39;injection intrathécale aiguë par une aiguille en l&#39;absence d&#39;un cathéter preimplanted, ce qui permet une application rapide et anatomiquement limité de médicaments et de réactifs de la moelle épinière chez les souris. Cette méthode conserve tous les avantages de intrathécale sur d&#39;autres voies d&#39;administration systémiques (par exemple, orale, intraveineuse, intrapéritonéale, etc), tels que la spécificité de la modulation de la moelle, ce qui permet des doses réduites et les effets secondaires de fin de course, ainsi que la capacité à délivrer des substances ne normalement ne pas traverser la barrière hémato-encéphalique depuis lors de l&#39;injection intrathécale, l&#39;aiguille est insérée entre la dure-mère et la moelle épinière. Fait important, toutefois, par rapport à d&#39;autres méthodes d&#39;administration intrathécale, le procédé d&#39;injection de l&#39;aiguille par voie intrathécale est la moins invasive, ce qui permet de nombreuses applications dans l&#39;même animal sans causer de dommages aux tissus considérable ou évoquant la réaction immunitaire en raison de l&#39;implantation de matériel étranger. Cependant, il nécessite des compétences techniques pour un ciblage très précis de l&#39;aiguille pour permettre l&#39;efficacité. Ici, nous démontrons visuellement la méthode pour atteindre un taux optimal de réussite pour cibler spécifiquement la moelle épinière lombaire. Le site d&#39;injection qui est choisie dans cette expérience est de la rainure entre L5 et L6 colonne vertébré, à proximité de l&#39;endroit où se termine la moelle épinière, de réduire au minimum le risque d&#39;endommager la colonne vertébrale. En outre, nous démontrons l&#39;utilisation de cette technique pour abattre des gènes dans la moelle épinière en utilisant des siRNA.

<table border="0" cellpadding="0" cellspacing="0" width="1012">
	<colgroup>
		<col /> 
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:283px;">in vivo-jetPEI</td>
			<td style="width:255px;">Polyplus</td>
			<td style="width:288px;">201-10G</td>
			<td style="width:188px;"> </td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 siRNA</td>
			<td>Santa Cruz</td>
			<td>sc-36832</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Control siRNA-A</td>
			<td>Santa Cruz</td>
			<td>sc-37007</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Anti-&#223;-Tubulin III antibody</td>
			<td>Sigma</td>
			<td>T2200</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Anti-WAVE1 antibody</td>
			<td>R&#38;D Systems</td>
			<td>AF5514</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Fast green dye</td>
			<td>Sigma</td>
			<td>F-7252</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isoflurane</td>
			<td>Baxter</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isoflurane setup</td>
			<td>Dr&#228;ger L&#252;beck</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Shaver</td>
			<td>Wella</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Hamilton syringe Gastight 1702</td>
			<td>Hamilton</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">30G 1/2, 0,3 * 13mm Needle</td>
			<td>BD Microlance</td>
			<td>304000</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Microscope Leica MS5</td>
			<td>Leica</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 forward primer for qRT-PCR</td>
			<td>Sigma</td>
			<td></td>
			<td>cacagagcctcaggacagg</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 reversed primer for qRT-PCR</td>
			<td>Sigma</td>
			<td></td>
			<td>cttttcaccaacggcatctt</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">FastStart Essential DNA Green Master</td>
			<td>Roche</td>
			<td>6402712001</td>
			<td></td>
		</tr>
	</tbody>
</table>

in vivo sirna transfection and gene knockdown in spinal cord via rapid noninvasive lumbar intrathecal injections in mice

Ce rapport décrit un guide étape par étape pour la technique des injections de seringues intrathécales aigus de manière non invasive, c&#39;est à dire indépendant du cathéter implantation. La limitation de cette technique réside dans la technique chirurgicale de la finesse des aiguilles. L&#39;injection est rapide, en particulier pour un expérimentateur formé, et étant donné que la perturbation de tissu avec cette technique est minime, des injections répétées sont possibles; réaction en outre à l&#39;abri des outils étrangers (. Par exemple de cathéter) ne se produit pas, ce qui donne une meilleure et plus précise read out de modulation de la moelle épinière. Etant donné que l&#39;application de la substance est largement limitée à la région cible de la moelle épinière, les médicaments n&#39;ont pas besoin d&#39;être appliqué à des doses importantes, et des effets plus important non désirés sur d&#39;autres tissus, comme observé avec une administration systémique, peuvent être contournées 1, 2. Par ailleurs, on combine cette technique avec la transfection in vivo d&#39;acides nucléiques à l&#39;aide d&#39;polyethylenimine (PEI) réactif 3, qui fournit grande polyvalence pour l&#39;étude des fonctions de la colonne vertébrale par l&#39;intermédiaire de l&#39;administration d&#39;agents pharmacologiques, ainsi que le gène, l&#39;ARN, et des modulateurs de protéine.

Afin d&#39;illustrer une injection réussie, nous avons réalisé cette technique en utilisant rapide colorant vert FCF chez les souris C57BL6 adultes (8-10 semaines d&#39;âge). L&#39;animal a été autorisée à récupérer pendant quelques minutes après l&#39;injection de fournir assez de temps pour le colorant de se propager et ensuite tué par une overdose de CO 2. Par la suite, la colonne de vertébré a été disséqué et la moelle épinière a été exposée. Le puncta bleu correspondant au colorant...

Watch this Scientific Journal Video about In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice at JoVE.com

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

Ce rapport décrit une technique simple et rapide de intrathécale ponction à l&#39;aiguille pour une transfection de siRNA localisée dans la moelle épinière lombaire chez la souris sous anesthésie de courte durée de lumière durable.

In Vivo transfection de siRNA et Gene Knockdown dans la moelle épinière via rapide non invasive lombaire intrathécale injections chez des souris

This report describes a step-by-step guide to the technique of acute intrathecal needle injections in a noninvasive manner, i.e. independent of catheter ...

in-vivo-sirna-transfection-gene-knockdown-spinal-cord-via-rapid

Research

JoVE Journal

Biology

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

46.1K vues.  University of Heidelberg.  Ce rapport décrit une technique simple et rapide de intrathécale ponction à l'aiguille pour une transfection de siRNA localisée dans la moelle épinière lombaire chez la souris sous anesthésie de courte durée de lumière durable. 

Vidéo: In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

Noninvasive In Vivo Small Animal MRI and MRS: Basic Experimental Procedures

Small animal Magnetic Resonance (MR) research has emerged as an important element of modern biomedical research due to its non-invasive nature and the richness of biological information it provides. MR does not require any ionizing radiation and can noninvasively provide higher resolution and better signal-to-noise ratio in comparison to other tomographic or spectroscopic modalities. In this protocol, we will focus on small animal MR imaging and MR spectroscopy (MRI/MRS) to noninvasively acquire relaxation weighted 1H images of mouse and to obtain 31P spectra of mouse muscle. This work does not attempt to cover every aspect of small animal MRI/MRS but rather introduces basic procedures of mouse MRI/MRS experiments. The main goal of this work is to inform researchers of the basic procedures for in vivo MR experiments on small animals. The goal is to provide a better understanding of basic experimental procedures to allow researchers new to the MR field to better plan for non-MR components of their studies so that both MR and non-MR procedures are seamlessly integrated.

Noninvasive In Vivo Small Animal MRI and MRS: Basic Experimental Procedures

This work describes basic procedures of noninvasive small animal MRI and MRS in vivo.

Non invasive In Vivo Petits animaux IRM et SRM: base des procédures expérimentales

Small animal Magnetic Resonance (MR) research has emerged as an important element of modern biomedical research due to its non-invasive nature and the ...

Recherche

Biologie

Spinal Cord Electrophysiology

The neonatal mouse spinal cord is a model for studying the development of neural circuitries and locomotor movement. We demonstrate the spinal cord dissection and preparation of recording bath artificial cerebrospinal fluid used for locomotor studies. Once dissected, the spinal cord ventral nerve roots can be attached to a recording electrode to record the electrophysiologic signals of the central pattern generating circuitry within the lumbar cord.

A demonstration of the isolation of neonatal mouse spinal cord for electrophysiologic studies.

Spinal Cord électrophysiologie

The neonatal mouse spinal cord is a model for studying the development of neural circuitries and locomotor movement. We demonstrate the spinal cord ...

Using an Automated Cell Counter to Simplify Gene Expression Studies: siRNA Knockdown of IL-4 Dependent Gene Expression in Namalwa Cells

The use of siRNA mediated gene knockdown is continuing to be an important tool in studies of gene expression.  siRNA studies are being conducted not only to study the effects of downregulating single genes, but also to interrogate signaling pathways and other complex interaction networks.  These pathway analyses require both the use of relevant cellular models and methods that cause less perturbation to the cellular physiology.  Electroporation is increasingly being used as an effective way to introduce siRNA and other nucleic acids into difficult to transfect cell lines and primary cells without altering the signaling pathway under investigation. There are multiple critical steps to a successful siRNA experiment, and there are ways to simplify the work while improving the data quality at several experimental stages.  To help you get started with your siRNA mediated gene knockdown project, we will demonstrate how to perform a pathway study complete from collecting and counting the cells prior to electroporation through post transfection real-time PCR gene expression analysis.  The following study investigates the role of the transcriptional activator STAT6 in IL-4 dependent gene expression of CCL17 in a Burkitt lymphoma cell line (Namalwa).  The techniques demonstrated are useful for a wide range of siRNA-based experiments on both adherent and suspension cells.  We will also show how to streamline cell counting with the TC10 automated cell counter, how to electroporate multiple samples simultaneously using the MXcell electroporation system, and how to simultaneously assess RNA quality and quantity with the Experion automated electrophoresis system.

This procedure describes a quick and easy workflow to introduce siRNA into difficult to transfect cell lines and follow gene expression by real-time PCR. Use of an automated cell counter, multi-well electroporation plate, and automated electrophoresis station provide quick and reliable results without the need for expensive robotic handling.

Aide d&#39;un compteur de cellules automatisé pour simplifier les études d&#39;expression génique: Knockdown siRNA de l&#39;IL-4 dans l&#39;expression des gènes dépendant cellules Namalwa

The use of siRNA mediated gene knockdown is continuing to be an important tool in studies of gene expression.  siRNA studies are being conducted not only ...

RNAi-mediated Gene Knockdown and In Vivo Diuresis Assay in Adult Female Aedes aegypti Mosquitoes

This video protocol demonstrates an effective technique to knockdown a particular gene in an insect and conduct a novel bioassay to measure excretion rate. This method can be used to obtain a better understanding of the process of diuresis in insects and is especially useful in the study of diuresis in blood-feeding arthropods that are able to take up huge amounts of liquid in a single blood meal. 
This RNAi-mediated gene knockdown combined with an in vivo diuresis assay was developed by the Hansen lab to study the effects of RNAi-mediated knockdown of aquaporin genes on Aedes aegypti mosquito diuresis1. 
The protocol is setup in two parts: the first demonstration illustrates how to construct a simple mosquito injection device and how to prepare and inject dsRNA into the thorax of mosquitoes for RNAi-mediated gene knockdown. The second demonstration illustrates how to determine excretion rates in mosquitoes using an in vivo bioassay.

RNAi-mediated Gene Knockdown and In Vivo Diuresis Assay in Adult Female Aedes aegypti Mosquitoes

In this protocol we combine RNAi-mediated gene silencing with an in vivo diuresis assay to study the effects knockdown of genes of interest has on mosquito fluid excretion.

Inactivation génique médiée par ARNi et<em&gt; In Vivo</emEssai diurèse&gt; Femmes adultes<em&gt; Aedes aegypti</em&gt; Les moustiques

This video protocol demonstrates an effective technique to knockdown a particular gene in an insect and conduct a novel bioassay to measure excretion ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the messagefor review see 1. However, it's now widely accepted that synonymous codon usage is the primary cause of non-uniform translational elongation rates1. Synonymous codons are not used with identical frequency. A bias exists in the use of synonymous codons with some codons used more frequently than others2. Codon bias is organism as well as tissue specific2,3. Moreover, frequency of codon usage is directly proportional to the concentrations of cognate tRNAs4. Thus, a frequently used codon will have higher multitude of corresponding tRNAs, which further implies that a frequent codon will be translated faster than an infrequent one. Thus, regions on mRNA enriched in rare codons (potential pause sites) will as a rule slow down ribosome movement on the message and cause accumulation of nascent peptides of the respective sizes5-8. These pause sites can have functional impact on the protein expression, mRNA stability and protein foldingfor review see 9. Indeed, it was shown that alleviation of such pause sites can alter ribosome movement on mRNA and subsequently may affect the efficiency of co-translational (in vivo) protein folding1,7,10,11. To understand the process of protein folding in vivo, in the cell, that is ultimately coupled to the process of protein synthesis it is essential to gain comprehensive insights into the impact of codon usage/tRNA content on the movement of ribosomes along mRNA during translational elongation.
Here we describe a simple technique that can be used to locate major translation pause sites for a given mRNA translated in various cell-free systems6-8. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA. The rationale is that at low-frequency codons, the increase in the residence time of the ribosomes results in increased amounts of nascent peptides of the corresponding sizes. In vitro transcribed mRNA is used for in vitro translational reactions in the presence of radioactively labeled amino acids to allow the detection of the nascent chains. In order to isolate ribosome bound nascent polypeptide complexes the translation reaction is layered on top of 30% glycerol solution followed by centrifugation. Nascent polypeptides in polysomal pellet are further treated with ribonuclease A and resolved by SDS PAGE. This technique can be potentially used for any protein and allows analysis of ribosome movement along mRNA and the detection of the major pause sites. Additionally, this protocol can be adapted to study factors and conditions that can alter ribosome movement and thus potentially can also alter the function/conformation of the protein.

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

A technique to identify translational pause sites on mRNA is described. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA, followed by the size analysis of the nascent chains using a denaturing gel electrophoresis.

Isolement du ribosome Bound polypeptides naissants<em&gt; In vitro</em&gt; Pour identifier les sites de pause de translation le long d&#39;ARNm

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

Using SecM Arrest Sequence as a Tool to Isolate Ribosome Bound Polypeptides

Extensive research has provided ample evidences suggesting that protein folding in the cell is a co-translational process1-5. However, the exact pathway that polypeptide chain follows during co-translational folding to achieve its functional form is still an enigma. In order to understand this process and to determine the exact conformation of the co-translational folding intermediates, it is essential to develop techniques that allow the isolation of RNCs carrying nascent chains of predetermined sizes to allow their further structural analysis.
SecM (secretion monitor) is a 170 amino acid E. coli protein that regulates expression of the downstream SecA (secretion driving) ATPase in the secM-secA operon6. Nakatogawa and Ito originally found that a 17 amino acid long sequence (150-FSTPVWISQAQGIRAGP-166) in the C-terminal region of the SecM protein is sufficient and necessary to cause stalling of SecM elongation at Gly165, thereby producing peptidyl-glycyl-tRNA stably bound to the ribosomal P-site7-9. More importantly, it was found that this 17 amino acid long sequence can be fused to the C-terminus of virtually any full-length and/or truncated protein thus allowing the production of RNCs carrying nascent chains of predetermined sizes7. Thus, when fused or inserted into the target protein, SecM stalling sequence produces arrest of the polypeptide chain elongation and generates stable RNCs both in vivo in E. coli cells and in vitro in a cell-free system. Sucrose gradient centrifugation is further utilized to isolate RNCs.
The isolated RNCs can be used to analyze structural and functional features of the co-translational folding intermediates. Recently, this technique has been successfully used to gain insights into the structure of several ribosome bound nascent chains10,11. Here we describe the isolation of bovine Gamma-B Crystallin RNCs fused to SecM and generated in an in vitro translation system.

We describe here a technique that is now routinely used to isolate stably bound ribosome nascent chain complexes (RNCs). This technique takes advantage of the discovery that a 17 amino acid long SecM "arrest sequence" can halt translation elongation in a prokaryotic (E. coli) system, when inserted into (or fused to the C-terminus) of virtually any protein.

Utilisation de la séquence d&#39;arrêt SecM comme un outil pour isoler les polypeptides Ribosome Bound

Extensive research has provided ample evidences suggesting that protein folding in the cell is a co-translational process1-5. However, the exact pathway ...

Rapid Genetic Analysis of Epithelial-Mesenchymal Signaling During Hair Regeneration

Hair follicle morphogenesis, a complex process requiring interaction between epithelia-derived keratinocytes and the underlying mesenchyme, is an attractive model system to study organ development and tissue-specific signaling. Although hair follicle development is genetically tractable, fast and reproducible analysis of factors essential for this process remains a challenge. Here we describe a procedure to generate targeted overexpression or shRNA-mediated knockdown of factors using lentivirus in a tissue-specific manner. Using a modified version of a hair regeneration model 5, 6, 11, we can achieve robust gain- or loss-of-function analysis in primary mouse keratinocytes or dermal cells to facilitate study of epithelial-mesenchymal signaling pathways that lead to hair follicle morphogenesis. We describe how to isolate fresh primary mouse keratinocytes and dermal cells, which contain dermal papilla cells and their precursors, deliver lentivirus containing either shRNA or cDNA to one of the cell populations, and combine the cells to generate fully formed hair follicles on the backs of nude mice. This approach allows analysis of tissue-specific factors required to generate hair follicles within three weeks and provides a fast and convenient companion to existing genetic models.

Tissue-specific analysis of a hair follicle regeneration model using lentivirus to mediate gain- or loss-of-function.

Analyse rapide de la génétique des épithélio-mésenchymateuse signalisation lors de la régénération des cheveux

Hair follicle morphogenesis, a complex process requiring interaction between epithelia-derived keratinocytes and the underlying mesenchyme, is an ...

Intravenous Injections in Neonatal Mice

Intravenous injection is a clinically applicable manner to deliver therapeutics. For adult rodents and larger animals, intravenous injections are technically feasible and routine. However, some mouse models can have early onset of disease with a rapid progression that makes administration of potential therapies difficult. The temporal (or facial) vein is just anterior to the ear bud in mice and is clearly visible for the first two days after birth on either side of the head using a dissecting microscope. During this window, the temporal vein can be injected with volumes up to 50 &#956;l. The injection is safe and well tolerated by both the pups and the dams. A typical injection procedure is completed within 1-2 min, after which the pup is returned to the home cage. By the third postnatal day the vein is difficult to visualize and the injection procedure becomes technically unreliable. This technique has been used for delivery of adeno-associated virus (AAV) vectors, which in turn can provide almost body-wide, stable transgene expression for the life of the animal depending on the viral serotype chosen.

Animal models of pediatric disease can experience early onset and aggressive disease progression. Clinically relevant therapy delivery to young mouse models can be technically difficult. This protocol describes a non-invasive intravenous injection method for newborn mice within the first two postnatal days of life.

Les injections intraveineuses de souriceaux nouveau-nés

Intravenous injection is a clinically applicable manner to deliver therapeutics. For adult rodents and larger animals, intravenous injections are ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 &#181;l whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

We describe here a simple and rapid paper-based DNA extraction method of HIV proviral DNA from whole blood detected by quantitative PCR. This protocol can be extended for use in detecting other genetic markers or using alternative amplification methods.

Filtration Isolement des acides nucléiques: Une méthode d&#39;extraction de l&#39;ADN simple et rapide

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Cystometric and External Urethral Sphincter Measurements in Awake Rats with Implanted Catheter and Electrodes Allowing for Repeated Measurements

Lower urinary tract function is mainly assessed by means of cystometric bladder function analysis in rodents. Conventional cystometries are usually performed as terminal analysis under urethane anesthesia. It is well known that anesthetic drugs can influence bladder function. Hence, the aim of this technique is to perform cystometric measurements of the urinary bladder and external urethral sphincter in lightly restrained awake rats. For this purpose, a bladder catheter is implanted into the bladder dome. Subsequently, two electrodes are implanted bilateral to the external urethral sphincter and a ground electrode is sutured to a non-responsive skeletal muscle. The bladder catheter and the three electrodes are finally tunneled subcutaneously to the neck region and affixed to a harness. With this technique, the lower urinary tract can be measured at multiple time points in the same animal to assess lower urinary tract function. The main application of this technique is the follow-up of simultaneous urinary bladder and external urethral sphincter function in awake healthy rats and after induction of a disease or injury. Moreover, subsequent lower urinary tract monitoring can be performed during evaluation of the disease/injury and to monitor treatment efficacy.

This protocol first describes the surgical procedure of the permanent implantation of a urinary bladder catheter combined with external urethral sphincter electrodes, and second, the measurement of the function of the urinary bladder and external urethral sphincter in implanted awake animals.

Mesures de Sphincter urétral cystométriques et externe chez le rat éveillé avec cathéter implanté et électrodes permettant des mesures répétées

Lower urinary tract function is mainly assessed by means of cystometric bladder function analysis in rodents. Conventional cystometries are usually ...