Ce travail a été soutenu par le Centre national des sciences, Pologne (numéro de subvention/bourse: 2018/31/D/NZ2/03901).

1. Préparation du mélange siRNA
<ol><li>Un jour avant le début de l’expérience, les cellules de graines (par exemple, HeLa) sur une boîte de 100 mm afin qu’elles atteignent 70% à 90% de confluence le lendemain. NOTE: Toutes les opérations doivent être effectuées dans des conditions stériles dans une chambre à flux laminaire.</li>
	<li>Préparer la quantité appropriée de siRNA diluée à une concentration de 140 nM dans un milieu Opti-MEM (voir tableau des matériaux). Une plaque de 96 puits peut être utilisée comme réservoir.</li>
	<li>Ajouter 5 μL de la solution siRNA (ou du milieu Opti-MEM pour les échantillons témoins) à chaque puits d’une microplaque de culture cellulaire noire de 384 puits. REMARQUE: Selon le nombre d’échantillons de siRNA testés, une pipette électronique ou multicanal peut être utilisée.</li>
	<li>Préparer la quantité appropriée de solution de réactif de transfection RNAiMAX (voir tableau des matériaux) dans le milieu Opti-MEM. Ajouter 1 μL d’ARNiMAX pour chaque 100 μL de milieu.</li>
	<li>Ajouter 10 μL de la solution de réactif de transfection à chaque puits de la plaque de 384 puits. Le moyen le plus pratique et le plus rapide de le faire est d’utiliser un distributeur de réactifs.</li>
	<li>Incuber le siRNA avec le réactif de transfection pendant 30 min à température ambiante.</li>
</ol>2. Préparation des cellules pour la transfection
<ol><li>Pendant l’incubation (étape 1.6), aspirer le milieu à l’aide d’un dispositif d’aspiration (voir le tableau des matières) et laver les cellules avec 3 mL de PBS.</li>
	<li>Ajouter 1,5 mL de trypsine diluée 1:2 dans du PBS et incuber les cellules à 37 °C pendant 10 min.</li>
	<li>Vérifiez si les cellules se sont détachées; si c’est le cas, ajouter 3 mL de milieu DMEM avec 10% FBS. Suspendez soigneusement les cellules et transférez-les dans un tube de 15 mL. Prélevez au moins 150 μL de la suspension et comptez les cellules dans une chambre de comptage des cellules (voir le tableau des matériaux).</li>
	<li>Préparer une suspension cellulaire à la concentration appropriée (35 000/mL pour la lignée HeLa) dans un milieu DMEM avec 10 % de FBS, de pénicilline et de streptomycine.</li>
</ol>3. Transfection cellulaire
<ol><li>Ajouter 20 μL de la suspension cellulaire à chaque puits de la plaque de 384 puits à l’aide du distributeur de réactif. Cela se traduira par 700 cellules ensemencées par puits.</li>
	<li>Incuber les cellules pendant 1 h à température ambiante, puis les placer dans l’incubateur pendant 72 h (37 °C et 5% CO2).</li>
</ol>4. Constitution BrdU
<ol><li>Préparer une solution 90 μM de BrdU (voir tableau des matériaux) en milieu DMEM avec 10% de FBS.</li>
	<li>56 h après la transfection du siRNA (16 h avant la fixation de la cellule), ajouter 10 μL de solution BrdU à 90 μM à chaque puits de la plaque de 384 puits (la concentration finale de BrdU est de 20 μM). REMARQUE: L’action doit être effectuée aussi rapidement que possible; Par conséquent, il est préférable d’utiliser un distributeur de réactifs, une pipette électronique ou une pipette multi-distributeur. N’oubliez pas de préparer les puits de contrôle sans ajout de BrdU.</li>
	<li>Incuber les cellules pendant 16 h (37 °C et 5% de CO2).</li>
</ol>5. Étiquetage des mitochondries
<ol><li>Préparer une solution 20 μM de BrdU dans du DMEM avec 10% de FBS, et y ajouter la solution de colorant de suivi des mitochondries (voir Tableau des matériaux) à une concentration de 1,1 μM.</li>
	<li>15 h après le début de l’incorporation du BrdU (1 h avant la fixation cellulaire), ajouter 10 μL de la solution de colorant de suivi des mitochondries (voir le tableau des matériaux) à chaque puits de la plaque de 384 puits (la concentration finale du colorant est de 200 nM). REMARQUE: Utilisez un distributeur de réactif, une pipette électronique ou une pipette multi-distributeur. N’oubliez pas de conserver les puits de contrôle sans l’ajout de BrdU mais avec l’ajout du colorant de suivi des mitochondries.</li>
	<li>Incuber les cellules pendant 1 h (37 °C et 5% de CO2).</li>
</ol>6. Fixation cellulaire
REMARQUE: Tout le lavage est effectué plus commodément à l’aide d’une laveuse de microplaques, tandis que l’ajout de réactifs est effectué plus rapidement à l’aide d’un distributeur de réactifs.
<ol><li>À l’aide de la laveuse à microplaques (voir le tableau des matières), rincer chaque puits deux fois avec 100 μL de PBS. Après le deuxième lavage, laissez 25 μL de PBS dans le puits. REMARQUE: Laisser PBS dans le puits réduit la probabilité de décollement de la cellule lors de l’ajout de liquide à l’étape suivante. Tous les lavages sont terminés avec le PBS laissé dedans; par conséquent, la solution ajoutée à l’étape suivante doit toujours être préparée à une concentration de 2x car elle sera ajoutée dans un volume égal au PBS restant.</li>
	<li>Fixer les cellules en ajoutant 25 μL d’une solution de formaldéhyde à 8 % dans du PBS avec 0,4 % de Triton X-100 et de Hoechst 33342 à une concentration de 4 μg/mL (les concentrations finales des réactifs individuels sont de 4 %, 0,2 % et 2 μg/mL, respectivement) (voir le tableau des matériaux).</li>
	<li>Incuber la plaque dans l’obscurité à température ambiante pendant 30 min.</li>
</ol>7. Blocage
<ol><li>Rincer chaque puits quatre fois avec 100 μL de PBS. Après le dernier lavage, laissez 25 μL de PBS dans le puits.</li>
	<li>Ajouter 25 μL de BSA à 6 % dans du PBS (la concentration finale de BSA est de 3 %) à chaque puits.</li>
	<li>Incuber la plaque dans l’obscurité à température ambiante pendant 30 min.</li>
</ol>8. Ajout des anticorps primaires
<ol><li>Aspirer le BSA à l’aide d’une laveuse à microplaques et laisser 10 μL de solution dans le puits.</li>
	<li>Ajouter 10 μL de la solution d’anticorps primaires préparée dans du BSA à 3% dans du PBS. Utiliser de l’anti-BrdU à 0,8 μg/mL et de l’anti-ADN à 0,4 μg/mL (les concentrations finales d’anticorps sont de 0,4 μg/mL et 0,2 μg/mL, respectivement) (voir le tableau des matériaux).</li>
	<li>Incuber la plaque dans l’obscurité à 4 °C pendant la nuit.</li>
</ol>9. Ajout des anticorps secondaires
<ol><li>Rincer chaque puits quatre fois avec 100 μL de PBS. Après le dernier lavage, laissez 10 μL de PBS dans le puits.</li>
	<li>Ajouter 10 μL de la solution d’anticorps secondaires à 4 μg/mL préparée dans du BSA à 6 % dans du PBS (la concentration finale est de 2 μg/mL). Utiliser des anticorps spécifiques aux isotypes (IgG1 anti-souris et IgM anti-souris) conjugués à des fluorochromes tels que Alexa Fluor 488 et Alexa Fluor 555 (voir le tableau des matériaux).</li>
	<li>Incuber la plaque dans l’obscurité à température ambiante pendant 1 h.</li>
	<li>Rincer chaque puits quatre fois avec 100 μL de PBS. Après le dernier lavage, laissez 50 μL de PBS dans le puits.</li>
	<li>Scellez la plaque avec un film adhésif (voir Tableau des matériaux) et conservez-la à l’abri de l’obscurité à 4 °C. L’imagerie doit être effectuée dans les 2 semaines.</li>
</ol>10. Imagerie
REMARQUE : L’imagerie doit être réalisée à l’aide d’un microscope à grand champ automatisé; Le microscope doit être équipé d’un étage moteur alimenté par des commandes permettant d’imager automatiquement les zones individuelles de la plaque.
<ol><li>Vérifiez les réglages de l’autofocus dans les coins de la plaque (puits A1, A24, P24, P1) et au centre. NOTE: Pour l’imagerie, il est recommandé d’utiliser un objectif de courte distance de travail 20x (voir Tableau des matériaux) avec l’ouverture numérique la plus élevée possible.</li>
	<li>Sur la base des histogrammes d’intensité générés par le logiciel d’imagerie en mode Live View, sélectionnez un temps d’exposition suffisamment long pour les canaux de fluorescence individuels afin que l’image résultante ne soit pas sursaturée.</li>
	<li>Définissez le nombre approprié de plans pour l’imagerie sur l’axe z. REMARQUE: Le champ de vision à un grossissement de 20x est suffisamment grand pour que toutes les cellules ne soient pas dans le même plan de focus, de sorte que la section z doit être effectuée pour afficher toutes les cellules dans leur plan de mise au point correct. Habituellement, cinq avions suffisent. En fonction de la disponibilité de l’espace disque, des piles z individuelles ou uniquement des projections d’intensité maximale peuvent être enregistrées. L’analyse d’image présentée dans la section des résultats représentatifs est basée sur des projections d’intensité maximale.</li>
	<li>Sélectionnez le nombre approprié de champs de vision à afficher par puits. REMARQUE: Selon la confluence, environ 60-300 cellules peuvent être imagées dans un champ de vision. Typiquement, pour les cellules HeLa avec une confluence de 60% à 90%, l’imagerie à cinq champs de vision permettra d’analyser de 500 cellules à plus de 1 000 cellules.</li>
	<li>Sélectionnez les puits à imager et lancez l’imagerie.</li>
</ol>11. Analyse quantitative d’images
REMARQUE: L’analyse quantitative des images acquises peut être effectuée à l’aide d’un logiciel open source tel que Cell Profiler15. Pour la présente étude, l’analyse a été effectuée à l’aide du logiciel ScanR 3.0.0 (voir le tableau des matériaux).
<ol><li>Démarrez l’analyse en effectuant une correction d’arrière-plan pour toutes les images de tous les canaux de fluorescence. En fonction de la taille des objets analysés, sélectionnez la taille de filtre appropriée : 80 pixels pour les noyaux cellulaires et 4 pixels pour les taches BrdU et ADNmt.</li>
	<li>Commencez à segmenter l’image en créant un masque de l’objet principal basé sur le rapport de l’intensité du signal de fluorescence à l’arrière-plan du canal correspondant aux noyaux cellulaires.</li>
	<li>Créez des masques pour les sous-objets représentant respectivement les taches BrdU et ADNmt, en utilisant les canaux de fluorescence appropriés pour les structures données. Remarque : Chaque sous-objet est affecté à l’objet principal le plus proche (noyau de cellule).</li>
	<li>Définissez les paramètres à mesurer pendant l’analyse et mesurez l’intensité des pixels individuels dans chaque masque pour tous les canaux de fluorescence. NOTE: Il est également nécessaire de calculer le nombre de sous-objets affectés à un noyau cellulaire donné et l’aire de chaque sous-objet.</li>
	<li>Définissez les paramètres dérivés à calculer en fonction des données obtenues. Pour obtenir les intensités de fluorescence totales pour le canal BrdU ou ADNmt, additionnez les intensités de tous les sous-objets assignés à un noyau cellulaire donné. Pour obtenir l’intensité moyenne de fluorescence, divisez l’intensité totale de fluorescence par la somme de l’aire des sous-objets affectés à un noyau cellulaire donné. REMARQUE: Pour s’assurer que le sous-objet créé (BrdU ou tache d’ADNmt) est réellement situé dans les mitochondries, il est nécessaire de les ouvrir en fonction de l’intensité de fluorescence du colorant de suivi des mitochondries.</li>
	<li>Effectuez une analyse plus approfondie des données obtenues avec le logiciel ScanR à l’aide du logiciel statistique R 4.2.216 avec les packages suivants : dplyr 17, data.table 18, ggplot219 et ggpubr20. Cette étape est facultative.</li>
</ol>

Quantification à haut débit de la synthèse et de la distribution de l’ADNmt

<ol>
	<li>Brown, G. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+respiration+and+ATP+synthesis+in+mammalian+mitochondria+and+cells.">Control of respiration and ATP synthesis in mammalian mitochondria and cells.</a> The Biochemical Journal. 284, 1-13 (1992).</li><li>Zhang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biochemical+basis+and+metabolic+interplay+of+redox+regulation).">Biochemical basis and metabolic interplay of redox regulation).</a> Redox Biology. 26, 101284 (2019).</li><li>Pizzo, P., Drago, I., Filadi, R., Pozzan, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+Ca2++homeostasis:+Mechanism,+role,+and+tissue+specificities.">Mitochondrial Ca2+ homeostasis: Mechanism, role, and tissue specificities.</a> Pflugers Archiv: European Journal of Physiology. 464 (1), 3-17 (2012).</li><li>Shadel, G. S., Horvath, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+ROS+signaling+in+organismal+homeostasis.">Mitochondrial ROS signaling in organismal homeostasis.</a> Cell. 163 (3), 560-569 (2015).</li><li>Mart&#237;nez-Reyes, I., Chandel, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+TCA+cycle+metabolites+control+physiology+and+disease.">Mitochondrial TCA cycle metabolites control physiology and disease.</a> Nature Communications. 11 (1), 102 (2020).</li><li>Galluzzi, L., Kepp, O., Trojel-Hansen, C., Kroemer, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+control+of+cellular+life,+stress,+and+death.">Mitochondrial control of cellular life, stress, and death.</a> Circulation Research. 111 (9), 1198-1207 (2012).</li><li>Rone, M. B., Fan, J., Papadopoulos, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cholesterol+transport+in+steroid+biosynthesis:+role+of+protein-protein+interactions+and+implications+in+disease+states.">Cholesterol transport in steroid biosynthesis: role of protein-protein interactions and implications in disease states.</a> Biochimica Et Biophysica Acta. 1791 (7), 646-658 (2009).</li><li>Swenson, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+synthesis+to+utilization:+The+ins+and+outs+of+mitochondrial+heme.">From synthesis to utilization: The ins and outs of mitochondrial heme.</a> Cells. 9 (3), 579 (2020).</li><li>West, A. P., Shadel, G. S., Ghosh, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondria+in+innate+immune+responses.">Mitochondria in innate immune responses.</a> Nature Reviews. Immunology. 11 (6), 389-402 (2011).</li><li>Nunnari, J., Suomalainen, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondria:+In+sickness+and+in+health.">Mitochondria: In sickness and in health.</a> Cell. 148 (6), 1145-1159 (2012).</li><li>Pohjoism&#228;ki, J. L. O., Goffart, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Of+circles,+forks+and+humanity:+Topological+organisation+and+replication+of+mammalian+mitochondrial+DNA.">Of circles, forks and humanity: Topological organisation and replication of mammalian mitochondrial DNA.</a> BioEssays. 33 (4), 290-299 (2011).</li><li>Gustafsson, C. M., Falkenberg, M., Larsson, N. -. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maintenance+and+expression+of+mammalian+mitochondrial+DNA.">Maintenance and expression of mammalian mitochondrial DNA.</a> Annual Review of Biochemistry. 85, 133-160 (2016).</li><li>Nicholls, T. J., Gustafsson, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separating+and+segregating+the+human+mitochondrial+genome.">Separating and segregating the human mitochondrial genome.</a> Trends in Biochemical Sciences. 43 (11), 869-881 (2018).</li><li>Gratzner, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibody+to+5-bromo-+and+5-iododeoxyuridine:+A+new+reagent+for+detection+of+DNA+replication.">Monoclonal antibody to 5-bromo- and 5-iododeoxyuridine: A new reagent for detection of DNA replication.</a> Science. 218 (4571), 474-475 (1982).</li><li>Stirling, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CellProfiler+4:+Improvements+in+speed,+utility+and+usability.">CellProfiler 4: Improvements in speed, utility and usability.</a> BMC Bioinformatics. 22 (1), 433 (2021).</li><li>R Core Team. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=R:+A+Language+and+Environment+for+Statistical+Computing.">R: A Language and Environment for Statistical Computing.</a> R Foundation for Statistical Computing. , (2021).</li><li>. dplyr: A Grammar of Data Manipulation Available from: <a target="_blank" href="https://CRAN.R-project.org/package=dplyr">https://CRAN.R-project.org/package=dplyr</a> (2021)</li><li>. data.table: Extension of `data.frame Available from: <a target="_blank" href="https://CRAN.R-project.org/package=data.table">https://CRAN.R-project.org/package=data.table</a> (2020)</li><li>. ggplot2: Elegant graphics for data analysis Available from: <a target="_blank" href="https://ggplot2.tidyverse.org">https://ggplot2.tidyverse.org</a> (2016)</li><li>. ggpubr: &amp;#34;ggplot2&amp;#34; based publication ready plots Available from: <a target="_blank" href="https://CRAN.R-project.org/package=ggpubr">https://CRAN.R-project.org/package=ggpubr</a> (2020)</li><li>Hashiguchi, K., Zhang-Akiyama, Q. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+of+human+cell+lines+lacking+mitochondrial+DNA.">Establishment of human cell lines lacking mitochondrial DNA.</a> Methods in Molecular Biology. 554, 383-391 (2009).</li><li>Piechota, J., Szczesny, R., Wolanin, K., Chlebowski, A., Bartnik, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nuclear+and+mitochondrial+genome+responses+in+HeLa+cells+treated+with+inhibitors+of+mitochondrial+DNA+expression.">Nuclear and mitochondrial genome responses in HeLa cells treated with inhibitors of mitochondrial DNA expression.</a> Acta Biochimica Polonica. 53 (3), 485-495 (2006).</li><li>Spelbrink, J. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+mitochondrial+DNA+deletions+associated+with+mutations+in+the+gene+encoding+Twinkle,+a+phage+T7+gene+4-like+protein+localized+in+mitochondria.">Human mitochondrial DNA deletions associated with mutations in the gene encoding Twinkle, a phage T7 gene 4-like protein localized in mitochondria.</a> Nature Genetics. 28 (3), 223-231 (2001).</li><li>Campbell, C. T., Kolesar, J. E., Kaufman, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+transcription+factor+A+regulates+mitochondrial+transcription+initiation,+DNA+packaging,+and+genome+copy+number.">Mitochondrial transcription factor A regulates mitochondrial transcription initiation, DNA packaging, and genome copy number.</a> Biochimica et Biophysica Acta. 1819 (9-10), 921-929 (2012).</li><li>Krasich, R., Copeland, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+polymerases+in+the+mitochondria:+A+critical+review+of+the+evidence.">DNA polymerases in the mitochondria: A critical review of the evidence.</a> Frontiers in Bioscience. 22 (4), 692-709 (2017).</li><li>Kotrys, A. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+proteomics+revealed+C6orf203/MTRES1+as+a+factor+preventing+stress-induced+transcription+deficiency+in+human+mitochondria.">Quantitative proteomics revealed C6orf203/MTRES1 as a factor preventing stress-induced transcription deficiency in human mitochondria.</a> Nucleic Acids Research. 47 (14), 7502-7517 (2019).</li><li>Gratzner, H. G., Pollack, A., Ingram, D. J., Leif, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deoxyribonucleic+acid+replication+in+single+cells+and+chromosomes+by+immunologic+techniques.">Deoxyribonucleic acid replication in single cells and chromosomes by immunologic techniques.</a> Journal of Histochemistry &amp; Cytochemistry. 24 (1), 34-39 (1976).</li><li>Leif, R. C., Stein, J. H., Zucker, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+short+history+of+the+initial+application+of+anti-5-BrdU+to+the+detection+and+measurement+of+S+phase.">A short history of the initial application of anti-5-BrdU to the detection and measurement of S phase.</a> Cytometry. Part A: The Journal of the International Society for Analytical Cytology. 58 (1), 45-52 (2004).</li><li>Lentz, S. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+DNA+(mtDNA)+biogenesis:+visualization+and+duel+incorporation+of+BrdU+and+EdU+into+newly+synthesized+mtDNA+in+vitro.">Mitochondrial DNA (mtDNA) biogenesis: visualization and duel incorporation of BrdU and EdU into newly synthesized mtDNA in vitro.</a> The Journal of Histochemistry and Cytochemistry. 58 (2), 207-218 (2010).</li><li>Liu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multi-omic+measurements+of+heterogeneity+in+HeLa+cells+across+laboratories.">Multi-omic measurements of heterogeneity in HeLa cells across laboratories.</a> Nature Biotechnology. 37 (3), 314-322 (2019).</li></ol>

Les auteurs n’ont rien à divulguer.

Historiquement, le marquage de l’ADN par incorporation BrdU et la détection d’anticorps a été utilisé dans la réplication de l’ADN nucléaire et la recherche sur le cycle cellulaire 14,27,28. Jusqu’à présent, tous les protocoles de détection de l’ADN marqué BrdU ont inclus une étape de dénaturation de l’ADN (acide ou thermique) ou de digestion enzymatique (DNase ou protéinase) pour permettre l’expositio...

Pour la plupart des cellules eucaryotes, les mitochondries sont des organites essentiels, car elles jouent un rôle crucial dans de nombreux processus cellulaires. Tout d’abord, les mitochondries sont les principaux fournisseurs d’énergie des cellules1. Les mitochondries sont également impliquées dans la régulation de l’homéostasie cellulaire (par exemple, l’oxydoxintracellulaire 2 et l’équilibre calcique3), la signalisation cellulaire4,5, l’apoptose 6, la synthèse de différents composés biochimiques 7,8 et la réponse immunitaire innée9. Le dysfonctionnement mitochondrial est associé à divers états pathologiques et maladies humaines10.
Le fonctionnement des mitochondries dépend de l’information génétique située dans deux génomes distincts : le génome nucléaire et le génome mitochondrial. Le génome mitochondrial code un petit nombre de gènes par rapport au génome nucléaire, mais tous les gènes codés par l’ADNmt sont essentiels à la vie humaine. La machinerie protéique mitochondriale nécessaire au maintien de l’ADNmt est codée par l’ADNn. Les composants de base du réplisome mitochondrial, ainsi que certains facteurs de biogenèse mitochondriale, ont déjà été identifiés (examinés dans des recherches antérieures11,12). Cependant, les mécanismes de réplication et de maintien de l’ADN mitochondrial sont encore loin d’être compris. Contrairement à l’ADNn, le génome mitochondrial existe en plusieurs copies, ce qui fournit une couche supplémentaire pour réguler l’expression des gènes mitochondriaux. On en sait beaucoup moins actuellement sur la distribution et la ségrégation de l’ADNmt au sein des organites, dans quelle mesure ces processus sont régulés et, le cas échéant, quelles protéines sont impliquées13. Le schéma de ségrégation est crucial lorsque les cellules contiennent une population mixte d’ADNmt de type sauvage et muté. Leur distribution inégale peut conduire à la génération de cellules avec une quantité néfaste d’ADNmt muté.
Jusqu’à présent, les facteurs protéiques nécessaires au maintien de l’ADNmt ont été identifiés principalement par des méthodes biochimiques, des analyses bioinformatiques ou par des études associées à la maladie. Dans ce travail, afin d’assurer une forte chance d’identifier les facteurs qui ont précédemment échappé à l’identification, une stratégie différente est décrite. La méthode est basée sur le marquage de l’ADNmt pendant la réplication ou la réparation avec la 5-bromo-2'-désoxyuridine (BrdU), un analogue nucléosidique de la thymidine. BrdU est facilement incorporé dans les brins d’ADN naissants lors de la synthèse de l’ADN et, en général, est utilisé pour surveiller la réplication de l’ADN nucléaire14. Cependant, la procédure développée ici a été optimisée pour détecter BrdU incorporé dans l’ADNmt en utilisant l’immunofluorescence des anticorps anti-BrdU.
L’approche permet la quantification à haut débit de la synthèse et de la distribution de l’ADNmt dans des cellules humaines cultivées in vitro. Une stratégie à haut débit est nécessaire pour effectuer des essais dans différentes conditions expérimentales dans un temps relativement court; Par conséquent, il est proposé dans le protocole d’utiliser un format multipuits pour la culture cellulaire et la microscopie à fluorescence automatisée pour l’imagerie. Le protocole comprend la transfection de cellules HeLa humaines avec une bibliothèque de siRNA et la surveillance ultérieure de la réplication ou de la réparation de l’ADNmt à l’aide du marquage métabolique de l’ADN nouvellement synthétisé avec BrdU. Cette approche est combinée avec l’immunomarquage de l’ADN à l’aide d’anticorps anti-ADN. Les deux paramètres sont analysés à l’aide de la microscopie quantitative à fluorescence. De plus, les mitochondries sont visualisées avec un colorant spécifique. Pour démontrer la spécificité du protocole, la coloration BrdU a été testée sur des cellules dépourvues d’ADNmt (cellules rho0), sur des cellules HeLa lors du silençage de facteurs de maintenance de l’ADNmt bien connus et sur des cellules HeLa après traitement avec un inhibiteur de la réplication de l’ADNmt. Les niveaux d’ADNmt ont également été mesurés par une méthode indépendante, à savoir la qPCR.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2&#8242;,3&#8242;-Dideoxycytidine (ddC)</td>
			<td>Sigma-Aldrich</td>
			<td>D5782</td>
			<td></td>
		</tr>
		<tr>
			<td>384&#160; Well Cell Culture Microplates, black</td>
			<td>Greiner Bio-One</td>
			<td>#781946</td>
			<td></td>
		</tr>
		<tr>
			<td>5-Bromo-2&#8242;-deoxyuridine (BrdU)</td>
			<td>Sigma-Aldrich</td>
			<td>B5002-1G</td>
			<td>Dissolve BrdU powder in water to 20 mM stock solution and aliquot. Use 20 &#181;M BrdU solution for labeling.</td>
		</tr>
		<tr>
			<td>Adhesive sealing film</td>
			<td>Nerbe Plus</td>
			<td>04-095-0060</td>
			<td></td>
		</tr>
		<tr>
			<td>Alexa Fluor 488 goat anti-mouse IgG1 secondary antibody</td>
			<td>Thermo Fisher Scientific</td>
			<td>A-21121</td>
			<td></td>
		</tr>
		<tr>
			<td>Alexa Fluor 555 goat anti-mouse IgM secondary antibody</td>
			<td>Thermo Fisher Scientific</td>
			<td>A-21426</td>
			<td></td>
		</tr>
		<tr>
			<td>BioTek 405 LS microplate washer</td>
			<td>Agilent</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine Serum Albumin (BSA)</td>
			<td>Sigma-Aldrich</td>
			<td>A4503</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell counting chamber Thoma</td>
			<td>Heinz Herenz</td>
			<td>REF:1080339</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td>Cytiva</td>
			<td>SH30243.01</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td>Thermo Fisher Scientific</td>
			<td>41965-062</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Thermo Fisher Scientific</td>
			<td>10270-106</td>
			<td></td>
		</tr>
		<tr>
			<td>Formaldehyde solution</td>
			<td>Sigma-Aldrich</td>
			<td>F1635</td>
			<td>Formaldehyde is toxic; please read the safety data sheet carefully.</td>
		</tr>
		<tr>
			<td>Hoechst 33342</td>
			<td>Thermo Fisher Scientific</td>
			<td>H3570</td>
			<td></td>
		</tr>
		<tr>
			<td>IgG1 mouse monoclonal anti-BrdU (IIB5) primary antibody</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-32323</td>
			<td></td>
		</tr>
		<tr>
			<td>IgM mouse monoclonal anti-DNA (AC-30-10) primary antibody</td>
			<td>Progen</td>
			<td>#61014</td>
			<td></td>
		</tr>
		<tr>
			<td>LightCycler 480 System</td>
			<td>Roche</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Lipofectamine RNAiMAX Transfection Reagent</td>
			<td>Thermo Fisher Scientific</td>
			<td>#13778150</td>
			<td></td>
		</tr>
		<tr>
			<td>MitoTracker Deep Red FM</td>
			<td>Thermo Fisher Scientific</td>
			<td>M22426</td>
			<td>Mitochondria tracking dye&#160;</td>
		</tr>
		<tr>
			<td>Multidrop Combi Reagent Dispenser</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Opti-MEM</td>
			<td>Thermo Fisher Scientific</td>
			<td>51985-042</td>
			<td></td>
		</tr>
		<tr>
			<td>Orca-R2 (C10600) CCD Camera</td>
			<td>Hamamatsu</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>P0781-100ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate buffered saline (PBS)</td>
			<td>Sigma-Aldrich</td>
			<td>P4417-100TAB</td>
			<td></td>
		</tr>
		<tr>
			<td>PowerUp SYBR Green Master Mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>A25742</td>
			<td></td>
		</tr>
		<tr>
			<td>qPCR primer Fw B2M (reference)</td>
			<td></td>
			<td></td>
			<td>CAGGTACTCCAAAGATTCAGG&#160;</td>
		</tr>
		<tr>
			<td>qPCR primer Fw GPI (reference gene)</td>
			<td></td>
			<td></td>
			<td>GACCTTTACTACCCAGGAGA</td>
		</tr>
		<tr>
			<td>qPCR primer Fw MT-ND1&#160;</td>
			<td></td>
			<td></td>
			<td>TAGCAGAGACCAACCGAACC&#160;</td>
		</tr>
		<tr>
			<td>qPCR primer Fw POLG</td>
			<td></td>
			<td></td>
			<td>TGGAAGGCAGGCATGGTCAAACC</td>
		</tr>
		<tr>
			<td>qPCR primer Fw TFAM</td>
			<td></td>
			<td></td>
			<td>GATGAGTTCTGCCTGCTTTAT</td>
		</tr>
		<tr>
			<td>qPCR primer Fw TWNK</td>
			<td></td>
			<td></td>
			<td>GCCATGTGACACTGGTCATT</td>
		</tr>
		<tr>
			<td>qPCR primer Rev B2M (reference)</td>
			<td></td>
			<td></td>
			<td>GTCAACTTCAATGTCGGATGG&#160;</td>
		</tr>
		<tr>
			<td>qPCR primer Rev GPI (reference gene)</td>
			<td></td>
			<td></td>
			<td>AGTAGACAGGGCAACAAAGT</td>
		</tr>
		<tr>
			<td>qPCR primer Rev MT-ND1&#160;</td>
			<td></td>
			<td></td>
			<td>ATGAAGAATAGGGCGAAGGG&#160;</td>
		</tr>
		<tr>
			<td>qPCR primer Rev POLG</td>
			<td></td>
			<td></td>
			<td>GGAGTCAGAACACCTGGCTTTGG</td>
		</tr>
		<tr>
			<td>qPCR primer Rev TFAM</td>
			<td></td>
			<td></td>
			<td>GGACTTCTGCCAGCATAATA</td>
		</tr>
		<tr>
			<td>qPCR primer Rev TWNK</td>
			<td></td>
			<td></td>
			<td>AACATTGTCTGCTTCCTGGC</td>
		</tr>
		<tr>
			<td>ScanR microscope</td>
			<td>Olympus</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>siRNA Ctrl</td>
			<td>Dharmacon</td>
			<td>D-001810-10-5</td>
			<td></td>
		</tr>
		<tr>
			<td>siRNA POLG</td>
			<td>Invitrogen</td>
			<td>POLGHSS108223</td>
			<td></td>
		</tr>
		<tr>
			<td>siRNA TFAM</td>
			<td>Invitrogen</td>
			<td>TFAMHSS144252</td>
			<td></td>
		</tr>
		<tr>
			<td>siRNA TWNK</td>
			<td>Invitrogen</td>
			<td>C10orf2HSS125597</td>
			<td></td>
		</tr>
		<tr>
			<td>Suction device</td>
			<td>NeoLab</td>
			<td>2-9335</td>
			<td>Suction device for cell culture</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma-Aldrich</td>
			<td>T9284-500ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypsin</td>
			<td>Biowest</td>
			<td>L0931-500</td>
			<td></td>
		</tr>
		<tr>
			<td>UPlanSApo 20x 0.75 NA objective</td>
			<td>Olympus</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

high-throughput image-based quantification of mitochondrial dna synthesis and distribution

La grande majorité des processus cellulaires nécessitent un apport continu d’énergie, dont le porteur le plus courant est la molécule d’ATP. Les cellules eucaryotes produisent la majeure partie de leur ATP dans les mitochondries par phosphorylation oxydative. Les mitochondries sont des organites uniques parce qu’elles ont leur propre génome qui est répliqué et transmis à la génération suivante de cellules. Contrairement au génome nucléaire, il existe plusieurs copies du génome mitochondrial dans la cellule. L’étude détaillée des mécanismes responsables de la réplication, de la réparation et du maintien du génome mitochondrial est essentielle pour comprendre le bon fonctionnement des mitochondries et des cellules entières dans des conditions normales et pathologiques. Ici, une méthode qui permet la quantification à haut débit de la synthèse et de la distribution de l’ADN mitochondrial (ADNmt) dans les cellules humaines cultivées in vitro est présentée. Cette approche est basée sur la détection par immunofluorescence de molécules d’ADN synthétisées activement marquées par incorporation de 5-bromo-2'-désoxyuridine (BrdU) et la détection simultanée de toutes les molécules d’ADNmt avec des anticorps anti-ADN. De plus, les mitochondries sont visualisées avec des colorants ou des anticorps spécifiques. La culture de cellules dans un format multipuits et l’utilisation d’un microscope à fluorescence automatisé facilitent l’étude de la dynamique de l’ADNmt et de la morphologie des mitochondries dans diverses conditions expérimentales dans un temps relativement court.

For most eukaryotic cells mitochondria are essential organelles, as they play a crucial role in numerous cellular processes. First and foremost, mitochondria are the key energy suppliers of cells1. Mitochondria are also involved in regulating cellular homeostasis (for instance, intracellular redox2 and the calcium balance3), cell signaling4,5, apoptosis6, the synthesis of different biochemical compounds7,8, and the innate immune response9. Mitochondrial dysfunction is associated with various pathological states and human diseases10. 
The functioning of mitochondria depends on the genetic information located in two separate genomes: the nuclear and mitochondrial genomes. The mitochondrial genome encodes a small number of genes compared to the nuclear genome, but all the mtDNA-encoded genes are essential for human life. The mitochondrial protein machinery necessary to maintain the mtDNA is encoded by nDNA. The basic components of the mitochondrial replisome, as well as some mitochondrial biogenesis factors, have already been identified (reviewed in previous research11,12). However, mitochondrial DNA replication and maintenance mechanisms are still far from being understood. In contrast to nDNA, the mitochondrial genome exists in multiple copies, which provides an additional layer for regulating mitochondrial gene expression. Much less is currently known about the distribution and segregation of mtDNA within organelles, to what extent these processes are regulated, and if they are, which proteins are involved13. The segregation pattern is crucial when cells contain a mixed population of wild-type and mutated mtDNA. Their unequal distribution may lead to the generation of cells with a detrimental amount of mutated mtDNA.
So far, the protein factors necessary for mtDNA maintenance have been identified mainly by biochemical methods, bioinformatic analyses, or through disease-associated studies. In this work, in order to ensure a high chance of identifying factors that have previously escaped identification, a different strategy is described. The method is based on the labeling of mtDNA during replication or repair with 5-bromo-2'-deoxyuridine (BrdU), a nucleoside analog of thymidine. BrdU is readily incorporated into nascent DNA strands during DNA synthesis and, in general, is used for monitoring the replication of nuclear DNA14. However, the procedure developed here has been optimized for detecting BrdU incorporated into mtDNA using the immunofluorescence of anti-BrdU antibodies.
The approach allows for the high-throughput quantification of mtDNA synthesis and distribution in human cells cultured in vitro. A high-throughput strategy is necessary to conduct tests under different experimental conditions in a relatively short time; therefore, it is proposed in the protocol to utilize a multi-well format for cell culturing and automated fluorescence microscopy for imaging. The protocol includes the transfection of human HeLa cells with an siRNA library and the subsequent monitoring of mtDNA replication or repair using the metabolic labeling of newly synthesized DNA with BrdU. This approach is combined with immunostaining of the DNA with the help of anti-DNA antibodies. Both parameters are analyzed using quantitative fluorescence microscopy. Additionally, mitochondria are visualized with a specific dye. To demonstrate the specificity of the protocol, BrdU staining was tested on cells devoid of mtDNA (rho0 cells), on HeLa cells upon the silencing of well-known mtDNA maintenance factors, and on HeLa cells after treatment with an mtDNA replication inhibitor. The mtDNA levels were also measured by an independent method, namely qPCR.

Pleins feux sur l’auteur : Quantification à haut débit de la synthèse et de la distribution de l’ADN mitochondrial  

Quantification à haut débit basée sur l’image de la synthèse et de la distribution de l’ADN mitochondrial

The protocol aims to identify proteins with dysfunction leads to changes in the number of mitochondrial DNA molecules. This research may also reveal the factors involving the distribution of mitochondrial DNA within the mitochondria. Mitochondrial replication and maintenance mechanisms are still not fully understood.Much less is known about regulating the distribution of mitochondrial genomes within organoids and the proteins involved in it. As a result, identifying and characterizing some new players will be of great importance. The main advantage of the technique is its high-throughput and high content protocol.We can simultaneously test many experimental conditions and measure various parameters during a single experiment. In genome-wide studies, the proposed protocol provides an opportunity to outline a global picture of how nuclear encoded genetic information regulates its mitochondrial counterpart. Additionally, it has the potential to identify proteins whose dysfunction causes mitochondrial DNA stress and activates the interferon response pathway.

Un schéma de la procédure pour l’étude à haut débit de la dynamique de la synthèse et de la distribution de l’ADNmt est présenté à la figure 1. L’utilisation d’un format de plaque multipuits permet l’analyse simultanée de nombreuses conditions expérimentales différentes, telles que le silençage de différents gènes à l’aide d’une bibliothèque de siRNA. Les conditions utilisées pour le marquage des molécules d’ADN nouvellement synthétisées avec BrdU permett...

Watch this Scientific Journal Video about High-Throughput Image-Based Quantification of Mitochondrial DNA Synthesis and Distribution at JoVE.com

Une procédure d’étude de la dynamique du métabolisme de l’ADN mitochondrial (ADNmt) dans les cellules à l’aide d’un format de plaque multipuits et d’une imagerie automatisée par immunofluorescence pour détecter et quantifier la synthèse et la distribution de l’ADNmt est décrite. Cela peut être utilisé pour étudier les effets de divers inhibiteurs, stress cellulaires et silençage génique sur le métabolisme de l’ADNmt.

The vast majority of cellular processes require a continuous supply of energy, the most common carrier of which is the ATP molecule. Eukaryotic cells ...

Le protocole vise à identifier les protéines présentant un dysfonctionnement entraînant des changements dans le nombre de molécules d’ADN mitochondrial. Cette recherche peut également révéler les facteurs impliquant la distribution de l’ADN mitochondrial dans les mitochondries. Les mécanismes de réplication et de maintien mitochondriaux ne sont pas encore entièrement compris.On en sait beaucoup moins sur la régulation de la distribution des génomes mitochondriaux au sein des organoïdes et des protéines qui y sont impliquées. Par conséquent, l’identification et la caractérisation de certains nouveaux acteurs seront d’une grande importance. Le principal avantage de la technique est son protocole à haut débit et à contenu élevé.Nous pouvons tester simultanément de nombreuses conditions expérimentales et mesurer divers paramètres au cours d’une seule expérience. Dans les études à l’échelle du génome, le protocole proposé offre l’occasion de brosser un tableau global de la façon dont l’information génétique codée nucléaire régule son homologue mitochondrial. De plus, il a le potentiel d’identifier les protéines dont le dysfonctionnement provoque un stress de l’ADN mitochondrial et active la voie de réponse à l’interféron.

high-throughput-image-based-quantification-mitochondrial-dna

Research

JoVE Journal

Biochemistry

High-Throughput Image-Based Quantification of Mitochondrial DNA Synthesis and Distribution

1.5K vues.  University of Warsaw. Le protocole vise à identifier les protéines présentant un dysfonctionnement entraînant des changements dans le nombre de molécules d’ADN mitochondrial. Cette recherche peut également révéler les facteurs impliquant la distribution de l’ADN mitochondrial dans les mitochondries. Les mécanismes de réplication et de maintien mitochondriaux ne sont pas encore entièrement compris.On en sait beaucoup moins sur la régulation de la distribution des génomes mitochondriaux au se...

Vidéo: Pleins feux sur l’auteur : Quantification à haut débit de la synthèse et de la distribution de l’ADN mitochondrial  

The vast majority of cellular processes require a continuous supply of energy, the most common carrier of which is the ATP molecule. Eukaryotic cells produce most of their ATP in the mitochondria by oxidative phosphorylation. Mitochondria are unique organelles because they have their own genome that is replicated and passed on to the next generation of cells. In contrast to the nuclear genome, there are multiple copies of the mitochondrial genome in the cell. The detailed study of the mechanisms responsible for the replication, repair, and maintenance of the mitochondrial genome is essential for understanding the proper functioning of mitochondria and whole cells under both normal and disease conditions. Here, a method that allows the high-throughput quantification of the synthesis and distribution of mitochondrial DNA (mtDNA) in human cells cultured in vitro is presented. This approach is based on the immunofluorescence detection of actively synthesized DNA molecules labeled by 5-bromo-2'-deoxyuridine (BrdU) incorporation and the concurrent detection of all the mtDNA molecules with anti-DNA antibodies. Additionally, the mitochondria are visualized with specific dyes or antibodies. The culturing of cells in a multi-well format and the utilization of an automated fluorescence microscope make it easier to study the dynamics of mtDNA and the morphology of mitochondria under a variety of experimental conditions in a relatively short time.

A procedure for studying the dynamics of mitochondrial DNA (mtDNA) metabolism in cells using a multi-well plate format and automated immunofluorescence imaging to detect and quantify mtDNA synthesis and distribution is described. This can be further used to investigate the effects of various inhibitors, cellular stresses, and gene silencing on mtDNA metabolism.

Recherche

Biochimie

Preparation of siRNA Mixture for Mitochondrial DNA Synthesis

To begin, prepare a 140 nano molar mix of small interfering RNA or siRNA by diluting the siRNA in optimum medium. Add the five microliters of the diluted mix to the wells of a black 384 well cell culture microplate. Prepare the appropriate amount of RNAiMAX transfection reagent solution in optimum medium and add 10 microliters to each well of the 384 well plate with a reagent dispenser.

Préparation d’un mélange de siRNA pour la synthèse de l’ADN mitochondrial

Cell Transfection and 5-Bromo-2&#39;-Deoxyuridine (BrdU) Incorporation in HeLa Cells

Cell Transfection and 5-Bromo-2&#039;-Deoxyuridine (BrdU) Incorporation in HeLa Cells  

To begin the cell transfection, add 20 microliters of the HeLa cell suspension to the 384-well plate wells containing diluted siRNA to seed 700 HeLa cells per well. After one hour of incubation at room temperature, place the well plate in an incubator for 72 hours at 37 degrees Celsius and 5%carbon dioxide. To incorporate BrdU in the transfected cells, add 10 microliters of 90-micromolar BrdU solution to each well after 56 hours of siRNA transfection.Incubate the cells for 16 hours at 37 degrees Celsius and 5%carbon dioxide. The specificity of BrdU incorporation into the mitochondrial DNA of HeLa cells was studied using rho0 cells lacking mitochondrial DNA.

Transfection cellulaire et incorporation de 5-bromo-2&#39;-désoxyuridine (BrdU) dans les cellules HeLa

5-Bromo-2&#39;-Deoxyuridine (BrdU) Labeling of Mitochondrial DNA in HeLa Cells

5-Bromo-2&#039;-Deoxyuridine (BrdU) Labeling of Mitochondrial DNA in HeLa Cells  

To begin the mitochondria labeling prepare a 20 micromolar solution of BrdU in DMEM with 10%fetal bovine serum or FBS. Then add the mitochondria tracking dye to adjust the final concentration to 1.1 micromolar. After 15 hours add 10 microliters of the mitochondria tracking dye solution to the HeLa cell suspension containing wells.Incubate the cells for one hour. The conditions used to label newly synthesized DNA molecules with BrdU allowed the detection of BrdU labeled DNA in the mitochondria of HeLa cells. The signal obtained with anti-BrdU antibodies was specific and only observed in cells treated with BrdU.Regardless of BrdU treatment no anti-BrdU or anti-DNA antibody signal was detected in the mitochondria of row zero cells. Quantifying the fluorescent signal from the anti-BrdU antibodies indicated that row zero cells treated with BrdU showed the same low level of fluorescence as the BrdU untreated cells, while the signal for the parental lines A549 and HeLa were 50 fold higher.

5-Bromo-2&#39;-désoxyuridine (BrdU) Marquage de l&#39;ADN mitochondrial dans les cellules HeLa

HeLa Cell Fixation with Hoechst 33342 and Blocking

To begin the HeLa cell fixation, rinse the HeLa cell-containing 384-well plate two times with 100 microliters of PBS using the microplate washer. Leave 25 microliters of PBS in the well after the second wash and add 25 microliters of an 8%formaldehyde solution. Incubate the plate in the dark at room temperature for 30 minutes.Then, rinse each well four times with 100 microliters of PBS and leave 25 microliters of PBS in the well after the last wash. Add 25 microliters of 6%bovine serum albumin, or BSA, in PBS to each well and incubate the plate in the dark for 30 minutes.

Fixation des cellules HeLa avec Hoechst 33342 et blocage

Addition of Primary and Secondary Antibodies to the Transfected HeLa Cells to Monitor the mtDNA Distribution

To begin the addition of the primary antibody, aspirate the bovine serum albumin or BSA from the fixed and blocked transfected HeLa cells leaving 10 microliters of BSA solution in the well. Then add 10 microliters of the primary antibody solution prepared in 3%BSA in PBS and incubate the plate in the dark at four degrees Celsius overnight. After the incubation, rinse each well four times with 100 microliters of PBS, leaving 10 microliters after the last wash.Next, add 10 microliters of secondary antibody solution to the 384 well plate. Use isotype specific antibodies conjugated to fluorochromes, such as Alexa Fluor 488 and Alexa Fluor 555. After incubating the plate in the dark for one hour, rinse each well four times with 100 microliters of PBS and leave 50 microliters of PBS in the well after the last wash.The use of anti-DNA antibodies allowed the monitoring of the mitochondrial DNA distribution in the cell under the given experimental conditions. The downregulation of mitochondrial transcription factor A TFAM led to drastic changes in the mitochondrial DNA distribution with fewer mitochondrial DNA spots than in control cells. Quantifying the mean fluorescent signal from the anti-DNA antibody showed a several fold increase upon TFAM silencing compared to the other conditions tested.

Ajout d’anticorps primaires et secondaires aux cellules HeLa transfectées pour surveiller la distribution de l’ADNmt

Quantitative Image Analysis to Measure the mtDNA and Gene Expression Levels in the Transfected HeLa Cells

To begin the imaging of transfected HeLa cells select a sufficiently long exposure time for the individual fluorescence channels in live view mode based on the intensity histograms generated by the imaging software. Set the appropriate number of planes for imaging on the Z axis. Select the appropriate number of fields of view to display per well.To start the quantitative analysis of acquired images, perform background correction for all the images from all the fluorescence channels. Depending on the size of the analyzed objects, select the appropriate filter size. Next, start the image segmenting by creating a mask of the main object based on the ratio of the intensity of the fluorescent signal to the background for the channel corresponding to the cell nuclei.Create masks for the sub objects representing BrdU and mitochondrial DNA spots using the fluorescence channels appropriate for the given structures. Set the parameters and measure the intensity of the individual pixels within each mask for all the fluorescence channels. To obtain the total fluorescence intensities for the BrdU or mitochondrial DNA channel sum up the intensities of all the sub objects assigned to a given cell nucleus.To obtain the mean fluorescence intensity, divide the total fluorescence intensity by the sum of the area of the sub objects assigned to a given cell nucleus. The imaging results were verified by measuring the mitochondrial DNA and gene expression levels using quantitative real-time PCR. Treatment with dideoxycytidine or DDC resulted in a very strong decrease in the mitochondrial DNA levels.A weaker effect was observed in TFAM and TWINKLE helicase silencing, while the transfection of cells with mitochondrial DNA polymerase gamma or POLG siRNA had a modest effect on the mitochondrial DNA copy number. Quantifying the TFAM and TWINKLE helicase expression confirmed an efficient reduction in their mRNA expression to approximately 15 to 20%of the control levels. In POLG, the mRNA expression was reduced only to 30%which explains the unexpected modest effect on the mitochondrial DNA copy number.