אנו מודים רון דייויס, אדם Deutschbauer, ואת HIP HOP כולו במעבדה באוניברסיטת טורונטו לדיונים וייעוץ. CN הוא נתמך על ידי מענקים הלאומי לחקר הגנום האנושי (מספר גרנט HG000205), RO1 HG003317, CIHR MOP-84305, ו - סרטן האגודה הקנדית (# 020380). JO נתמך על ידי תוכנית סטנפורד הדרכה הגנום (מספר גרנט T32 HG00044 מן הלאומי לחקר הגנום האנושי) לבין המכון הלאומי לבריאות (מספר גרנט P01 GH000205). ג&quot;ג נתמך על ידי RO1 NHGRI HG003317 והחברה הקנדית למלחמה בסרטן, גרנט # 020380, TD ואת סידור דונלי המרכז נתמך בחלקו על ידי מענקי הקרן הקנדית חדשנות לד&quot;ר. ברנדה אנדרוז וג&#39;ק גרינבלט. AMS נתמך על ידי האוניברסיטה של ​​אחוות פתח טורונטו.

<ol>
	<li>Giaever, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+profiling+of+the+Saccharomyces+cerevisiae+genome.">Functional profiling of the Saccharomyces cerevisiae genome.</a> Nature. 418, 387-391 (2002).</li><li>Baba, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Molecular systems biology. 2, 2006.0008-2006.0008 (2006).</li><li>Claus, H., Frosch, M., Vogel, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+hotspot+for+transformation+of+Neisseria+meningitidis+by+shuttle+mutagenesis+using+signature-tagged+transposons.">Identification of a hotspot for transformation of Neisseria meningitidis by shuttle mutagenesis using signature-tagged transposons.</a> Mol Gen Genet. 259, 363-371 (1998).</li><li>Hava, D. L., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-scale+identification+of+serotype+4+Streptococcus+pneumoniae+virulence+factors.">Large-scale identification of serotype 4 Streptococcus pneumoniae virulence factors.</a> Molecular microbiology. 45, 1389-1406 (2002).</li><li>Costanzo, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Genetic+Landscape+of+a+Cell.">The Genetic Landscape of a Cell.</a> Science. 327, 425-431 (2010).</li><li>Tong, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+genetic+analysis+with+ordered+arrays+of+yeast+deletion+mutants.">Systematic genetic analysis with ordered arrays of yeast deletion mutants.</a> Science. 294, 2364-2368 (2001).</li><li>Pan, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+robust+toolkit+for+functional+profiling+of+the+yeast+genome.">A robust toolkit for functional profiling of the yeast genome.</a> Molecular cell. 16, 487-496 (2004).</li><li>Schuldiner, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploration+of+the+Function+and+Organization+of+the+Yeast+Early+Secretory+Pathway+through+an+Epistatic+Miniarray+Profile.">Exploration of the Function and Organization of the Yeast Early Secretory Pathway through an Epistatic Miniarray Profile.</a> Cell. 123, 507-519 (2005).</li><li>Deutschbauer, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+haploinsufficiency+revealed+by+genome-wide+profiling+in+yeast.">Mechanisms of haploinsufficiency revealed by genome-wide profiling in yeast.</a> Genetics. 169, 1915-1925 (2005).</li><li>Giaever, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemogenomic+profiling:+identifying+the+functional+interactions+of+small+molecules+in+yeast.">Chemogenomic profiling: identifying the functional interactions of small molecules in yeast.</a> Proceedings of the National Academy of Sciences of the United States of America. 101, 793-798 (2004).</li><li>Lum, P. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovering+modes+of+action+for+therapeutic+compounds+using+a+genome-wide+screen+of+yeast+heterozygotes.">Discovering modes of action for therapeutic compounds using a genome-wide screen of yeast heterozygotes.</a> Cell. 116, 121-137 (2004).</li><li>Hillenmeyer, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+chemical+genomic+portrait+of+yeast:+uncovering+a+phenotype+for+all+genes.">The chemical genomic portrait of yeast: uncovering a phenotype for all genes.</a> Science. 320, 362-365 (2008).</li><li>Oh, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+universal+TagModule+collection+for+parallel+genetic+analysis+of+microorganisms.">A universal TagModule collection for parallel genetic analysis of microorganisms.</a> Nucleic acids research. 38, e146-e146 (2010).</li><li>Oh, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+annotation+and+drug+target+discovery+in+Candida+albicans+with+a+tagged+transposon+mutant+collection.">Gene annotation and drug target discovery in Candida albicans with a tagged transposon mutant collection.</a> PLoS pathogens. 6, (2010).</li><li>Nislow, C., Giaever, G., Stark, I., Stansfields, M. J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chapter+387.">Chapter 387.</a> Yeast Gene Analysis. , 387-414 (2007).</li><li>Pierce, S. E., Davis, R. W., Nislow, C., Giaever, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+of+barcoded+Saccharomyces+cerevisiae+gene-deletion+mutants+in+pooled+cultures.">Genome-wide analysis of barcoded Saccharomyces cerevisiae gene-deletion mutants in pooled cultures.</a> Nature protocols. 2, 2958-2974 (2007).</li><li>Sambrook, J., Russell, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning : a laboratory manual. , (2001).</li><li>Smith, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+phenotyping+via+deep+barcode+sequencing.">Quantitative phenotyping via deep barcode sequencing.</a> Genome Res. , (2009).</li><li>Hamady, M., Walker, J. J., Harris, J. K., Gold, N. J., Knight, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Error-correcting+barcoded+primers+for+pyrosequencing+hundreds+of+samples+in+multiplex.">Error-correcting barcoded primers for pyrosequencing hundreds of samples in multiplex.</a> Nature. 5, 235-237 (2008).</li><li>Gresham, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=System-Level+Analysis+of+Genes+and+Functions+Affecting+Survival+During+Nutrient+Starvation+in+Saccharomyces+cerevisiae.">System-Level Analysis of Genes and Functions Affecting Survival During Nutrient Starvation in Saccharomyces cerevisiae.</a> Genetics. 187, 299-317 (2011).</li></ol>

אין ניגודי אינטרסים הכריז.

כאן, אנו התווה פרוטוקול, עם שינוי צנוע, יכול בקלות להיות מותאמים למגוון רחב של אוספים קיימים אוספים מוטציה המינימרקטים של מיקרואורגניזמים שונים על מנת ליצור קולקציות מוטציה מתויג. אנו מדגישים כי בעוד אנו מדווחים על פרוטוקול mutagenesis transposon מתוייגים עבור שמרים פתוגניים ג אלביקנס, פרוטוקול דומה מאוד יכול להתאים למגוון רחב של פטריות unicellular. השתנה, פרוטוקול זה עובד היטב בחיידקים 13, וכיום אוספים במשך מספר הגנום פטריות וחיידקים נוספים בבנייה. נכון לעכשיו, assay זה מספק מקיף בלבד, הגנום כולו מסך משוחדת עבור גנים קטנים אינטראקציות מולקולה. תכונה אחת משכנעת במיוחד של assay הוא לא ידע קודם של הגן או מולקולה קטנה נדרשת. למרות ההיקף והעוצמה של מבחני אלה, עבירות שלהם במעבדות אחרות כבר הפריע במקצת על ידי השקעות ההון הראשוני אינפורמטיקה וכלים לניתוח התוצאות. עם אימוץ של readout רצף הדור הבא בשילוב עם כלים חזקים לניתוח, אנו מצפים להגדיל את האימוץ שלהם.

<table border="1" style=";text-align:right;direction:rtl"><tbody><tr><td> אנטיביוטיקה </td><td> הספק וקטלוג מספרים </td></tr><tr><td> Carbenicillin </td><td> סיגמא, חלק # C1613 </td></tr><tr><td> Kanamycin </td><td> סיגמא, חלק # K1876 </td></tr><tr><td> spectinomycin </td><td> סיגמא, חלק # S0692 </td></tr><tr><td> Chloramphenicol </td><td> סיגמא, חלק # C0378 </td></tr><tr><td> ה-DNA לנקות וערכות ריכוז </td><td></td></tr><tr><td> QIAprep ספין Miniprep Kit </td><td> Qiagen, חלק # 27106 </td></tr><tr><td> HiSpeed ​​מקסי פלסמיד Kit </td><td> Qiagen, חלק # 12663 </td></tr><tr><td> QIAquick PCR ערכת טיהור </td><td> Qiagen, חלק # 28106 </td></tr><tr><td> QIAquick ג&#39;ל הפקת Kit </td><td> Qiagen, חלק # 28704 </td></tr><tr><td> PCR ו ריאגנטים אלקטרופורזה </td><td></td></tr><tr><td> תקי פולימראז ה-DNA (Mg-free) הצפת </td><td> ניו אינגלנד Biolabs, חלק # M0320L </td></tr><tr><td> הפתרון Deoxynucleotide Mix </td><td> ניו אינגלנד Biolabs, חלק # N0447L </td></tr><tr><td> 25 מ&quot;מ MgCl 2 </td><td> סיגמא, חלק # 63036 </td></tr><tr><td> Agarose, טוען לצבוע, וגם חומצות גרעין כתם מתאים ג&#39;ל אלקטרופורזה </td><td> שונים </td></tr><tr><td> חיץ 10X טה </td><td> סיגמא, חלק # T8280 </td></tr><tr><td> 1 Kb פלוס סולם DNA </td><td> Invitrogen, חלק # 10787026 </td></tr><tr><td> YPD מרק </td><td></td></tr><tr><td> 10 גרם של תמצית שמרים </td><td> סיגמא, חלק # Y1625 </td></tr><tr><td> 20 גרם Bacto peptone </td><td> BD Biosciences, חלק # 211677 </td></tr><tr><td> 20 גרם דקסטרוז </td><td> סיגמא, חלק # D9434 </td></tr><tr><td> Labware </td><td></td></tr><tr><td> רב pipettes (1000, 200, ו - 20 μL) </td><td> שונים </td></tr><tr><td> מאגרי pipetting פנויה </td><td> שונים </td></tr><tr><td> 15 ו 50 צנטריפוגות צינורות מ&quot;ל </td><td> שונים </td></tr><tr><td> 96 - ו 384, באר עמוקה צלחות טוב </td><td> Axygen מדעי, חלק # P-2ml-SQ-CS &amp; P-384240SQCS </td></tr><tr><td> 96-384-היטב היטב PCR צלחות הסרט חותם </td><td> שונים </td></tr><tr><td> פלייט רולר עבור רב גם צלחות איטום </td><td> סיגמא, חלק # R1275 </td></tr><tr><td> 30 ° C ו 37 ° C רועד חממות לגידול חיידקים ושמרים על הצלחות ועל צינורות </td><td> שונים </td></tr><tr><td> במבחנה transposon mutagenesis </td><td></td></tr><tr><td> EZ-Tn5 Transposase </td><td> Epicentre ביוטכנולוגיות, חלק # TNP92110 </td></tr><tr><td> תפוקה גבוהה טרנספורמציה </td><td></td></tr><tr><td> Seqprep 96 HT ערכת הכנה פלסמיד </td><td> אדג&#39; Biosystems, חלק # 84359 </td></tr><tr><td> פוליאתילן גליקול, משקל מולקולרי 3350 </td><td> שונים </td></tr><tr><td> ליתיום אצטט </td><td> סיגמא, חלק # 517992 </td></tr><tr><td> 6 צלחות, טוב, סטרילי </td><td> קורנינג, חלק # 3335 </td></tr><tr><td> 50 מ&quot;ג / מ&quot;ל ​​uridine </td><td> סיגמא, חלק # U3750 </td></tr><tr><td> 100x טריס-EDTA חיץ פתרון </td><td> סיגמא, חלק # T9285 </td></tr><tr><td> 1X TE/0.1M LiOAc </td><td> שונים </td></tr><tr><td> סלמון testis-DNA </td><td> סיגמא, חלק # 1626 </td></tr><tr><td> צמיחה של אוספים המינימרקטים </td><td></td></tr><tr><td> 48 גם הצלחות, אם גדל תרבויות צלחות </td><td> גריינר, חלק # M9437 </td></tr><tr><td> צלחת חותמות דבק </td><td> ABgene, חלק # AB-0580 </td></tr><tr><td> 200 מ&quot;ל צלוחיות תרבות </td><td> שונים </td></tr><tr><td> יכולת ספיגת ספקטרופוטומטר </td><td> שונים </td></tr><tr><td> טמפרטורה מבוקרת שייקר עבור 250 מ&quot;ל צלוחיות או ספקטרופוטומטר רועד </td><td> שונים </td></tr><tr><td> Safe-Lock Tube Microcentrifuge, 2 מ&quot;ל </td><td> Eppendorf, חלק # 0030 120.094 </td></tr><tr><td> הכלאה ציוד </td><td></td></tr><tr><td> הכלאה תנור 640 </td><td> Affymetrix, חלק # 800138 </td></tr><tr><td> GeneChip Fluidic תחנה 450 </td><td> Affymetrix, חלק # 00-0079 </td></tr><tr><td> GeneArray סורק 3000 </td><td> Affymetrix, חלק # 00-0212 </td></tr><tr><td> מי האמבט רתיחה עם מתלה צף </td><td> שונים </td></tr><tr><td> הכלאה מתכלים </td><td></td></tr><tr><td> Genflex תג 16K מערך v2 </td><td> Affymetrix, חלק # 511331 </td></tr><tr><td> Denhardt של פתרון, להתרכז 50X </td><td> סיגמא, חלק # D2532 </td></tr><tr><td> Streptavidin, R-phycoerythrin המצומד (SAPE) </td><td> Invitrogen, חלק # S866 </td></tr><tr><td> Safe-Lock Tube Microcentrifuge, 0.5 מ&quot;ל </td><td> Eppendorf, חלק # 0030 123.301 </td></tr><tr><td> קטנטן קשוח כתמים </td><td> מגוונים ביוטק, חלק # LTTM-1000 </td></tr><tr><td> 0.5 M EDTA </td><td> BioRad, חלק # 161-0729 </td></tr><tr><td> 10% Tween </td><td> סיגמא, חלק # T2700 </td></tr><tr><td> MES monohydrate חומצה חינם </td><td> סיגמא, חלק # M5287 </td></tr><tr><td> MES מלח נתרן </td><td> סיגמא, חלק # M5057 </td></tr><tr><td> 5 M NaCl </td><td> סיגמא, חלק # 71386 </td></tr><tr><td> 20X SSPE </td><td> סיגמא, חלק # S2015 </td></tr><tr><td> ביולוגיה מולקולרית כיתה מים </td><td> סיגמא, חלק # W4502 </td></tr><tr><td> הכלאה primers </td><td> ספקים שונים (desalting רגילה) </td></tr><tr><td> Uptag </td><td> 5 &quot;GATGTCCACGAGGTCTCT 3&quot; </td></tr><tr><td> Buptagkanmx4 </td><td> 5 &quot;ביוטין GTCGACCTGCAGCGTACG-3&quot; </td></tr><tr><td> Dntag </td><td> 5 &quot;CGGTGTCGGTCTCGTAG 3&quot; </td></tr><tr><td> Bdntagkanmx4 </td><td> 5 &quot;ביוטין GAAAACGAGCTCGAATTCATCG-3&quot; </td></tr><tr><td> B213 </td><td> 5 &quot;ביוטין CTGAACGGTAGCATCTTGAC-3&quot; </td></tr><tr><td> Uptagkanmx </td><td> 5 &quot;GTCGACCTGCAGCGTACG 3&quot; </td></tr><tr><td> Dntagkanmx </td><td> 5&#39;GAAAACGAGCTCGAATTCATCG 3 &quot; </td></tr><tr><td> Uptagcomp </td><td> 5&#39;AGAGACCTCGTGGACATC 3 &quot; </td></tr><tr><td> Dntagcomp </td><td> 5&#39;CTACGAGACCGACACCG 3 &quot; </td></tr><tr><td> Upkancomp </td><td> 5&#39;CGTACGCTGCAGGTCGAC 3 &quot; </td></tr><tr><td> Dnkancomp </td><td> 5&#39;CGATGAATTCGAGCTCGTTTTC 3 &quot; </td></tr><tr><td> סידור primers: פלטפורמה Illumina </td><td> ספקים שונים </td></tr><tr><td> UpTag קדימה (100uM) </td><td> 5 &quot;CAA GCA GAA GAC GGC ATA CGA GCT CTT CCG ATC T גת GTC CAC GAG GTC TCT 3&quot; </td></tr><tr><td> UpTag הפוך (100uM) </td><td> 5 &quot;AAT גת ACG מהפקולטה לרוקחות אוכלים ACC ACC GAC ACT CTT TCC CTA CAC GAC GCT CTT CCG ATC T אננננן GTC GAC CTG החטיבה CGT ACG 3&quot; </td></tr><tr><td> DownTag קדימה (100uM) </td><td> 5 &quot;CAA GCA GAA GAC GGC ATA CGA GCT CTT CCG ATC T GAA AAC GAG CTC GAA TTC ATC G 3&quot; </td></tr><tr><td> DownTag הפוך (100uM) </td><td> 5 &quot;AAT גת ACG מהפקולטה לרוקחות אוכלים ACC ACC GAC ACT CTT TCC CTA CAC GAC GCT CTT CCG ATC T אננננן CGG CGG TGT TCT CGT AG 3` </td></tr><tr><td> קראו 1 UP-תג seq פריימר (100uM) </td><td> 5 &quot;GTC GAC CTG החטיבה CGT ACG 3&quot; </td></tr><tr><td> קראו 1 למטה תג פריימר seq (100uM) </td><td> 5 &quot;CGG CGG TGT TCT CGT AG 3&quot; </td></tr><tr><td> קראו 2 סידור אינדקס פריימר (פריימר תקן Illumina R1) (100uM) </td><td> 5 &quot;AC ACT CTT TCC CTA CAC GAC GCT CTT CCG ATC-T 3&quot; </td></tr><tr><td> סידור ריאגנטים נוספים / ציוד </td><td></td></tr><tr><td> Qiagen MinElute 96 UF-PCR ערכת טיהור </td><td> Qiagen, חלק # 29051 </td></tr><tr><td> לשאוב אבק </td><td> כל ספק </td></tr><tr><td> Macherey-נגל אבק סעפת </td><td> Macherey-נגל, חלק # 740 681 </td></tr><tr><td> Invitrogen קוואנט-IT dsDNA BR Assay Kit </td><td> Invitrogen, חלק # Q32853 </td></tr><tr><td> Invitrogen קיוביט צינורות assay </td><td> Invitrogen, חלק # Q32856 </td></tr><tr><td> 40% acrylamide N פלוס 1%, N&#39;-מתילן-bis-acrylamide, 37.5:1 </td><td> ביו רד, חלק # 161-0148 </td></tr><tr><td> מאגר טריס </td><td> סיגמא, חלק # T1503-1 ק&quot;ג </td></tr><tr><td> בור Acid </td><td> סיגמא, חלק # B6768-500 גרם </td></tr><tr><td> EDTA 0.5m, pH 8.0 </td><td> Teknova, חלק # E0306 </td></tr><tr><td> אמוניום Persulfate </td><td> סיגמא, חלק # A3678-25 גרם </td></tr><tr><td> TEMED </td><td> Bioshop, חלק # TEM001.25 </td></tr><tr><td> Ethidium פתרון ברומיד </td><td> Bioshop, חלק # ETB444.10 </td></tr><tr><td> אמוניום אצטט 0.5m </td><td> Teknova, חלק # A2000 </td></tr><tr><td> מגנזיום 10mm אצטט tetrahydrate </td><td> סיגמא, חלק # M0631-100 גרם </td></tr><tr><td> 1mm EDTA, pH 8.0 </td><td> ראה EDTA 0.5m, pH 8.0 </td></tr><tr><td> אתנול </td><td> שונים </td></tr><tr><td> נתרן אצטט, pH 5.2 </td><td> Teknova, חלק # S0297 </td></tr><tr><td> מהירות בריק </td><td> שונים </td></tr><tr><td> יחיד קרא הדור Cluster Kit </td><td> Illumina, חלק # GD-300-1001 </td></tr><tr><td> 36 ג סידור v4 Kit </td><td>Illumina, חלק # FC-104-4002 </td></tr><tr><td></td><td></td></tr></tbody></table> TBE 10X המתכון <table border="1" style=";text-align:right;direction:rtl"><tbody><tr><td> סכומים </td><td> ריאגנטים </td></tr><tr><td> 108 גרם </td><td> מאגר טריס </td></tr><tr><td> 55 גרם </td><td> בור Acid </td></tr><tr><td> 40mL </td><td> 0.5m EDTA (pH 8.0) </td></tr><tr><td colspan="2"> הוסף DH 2 O ל 1L סימן </td></tr></tbody></table> 12% ג&#39;ל polyacrylamide מתכון <table border="1" style=";text-align:right;direction:rtl"><tbody><tr><td> כרכים </td><td> ריאגנטים </td></tr><tr><td> 5.8 מ&quot;ל </td><td> 40% acrylamide N פלוס 1%, N&#39;-מתילן-bis-acrylamide, 37.5:1 </td></tr><tr><td> 12 מ&quot;ל </td><td> DH 2 O </td></tr><tr><td> 2 מ&quot;ל </td><td> 10X TBE </td></tr><tr><td> 140 μl </td><td> 10% אמוניום Persulfate </td></tr><tr><td> נפח כולל: 20ml </td><td></td></tr></tbody></table> Uptag תערובת פריימר: Resuspend Uptag ו Buptagkanmx4 כל DDH 2 O ב 100 מיקרומטר, ואז לערבב ביחס של 1:1 עבור ריכוז סופי של 50 מיקרומטר אחד. חנות ב -20 ° C. Downtag תערובת פריימר: Resuspend Dntag ו Bdntagkanmx4 כל DDH 2 O ב 100 מיקרומטר, ואז לערבב ביחס של 1:1 עבור ריכוז סופי של 50 מיקרומטר אחד. חנות ב -20 ° C. מעורב oligonucleotides: Resuspend כל אחת משמונה oligos הבאים (תקן desalted) ב DDH 2 O ב 100 מיקרומטר: Uptag, Dntag, Uptagkanmx, Dntagkanmx, Uptagcomp, Dntagcomp, Upkancomp, Dnkancomp. מערבבים נפח שווה של שמונה oligonucleotides ריכוז סופי של 12.5 מיקרומטר אחד. 12X מניות MES: במשך 10 מ&quot;ל, 0.7 גרם להמיס monohydrate MES חומצה חופשית 1.93 גרם מלח MES נתרן 8 מ&quot;ל מים הביולוגיה המולקולרית כיתה. לאחר ערבוב טוב, pH לבדוק ולהתאים במידת הצורך עד pH 6.5-6.7. מוסיפים מים כדי בהיקף כולל של 10 מ&quot;ל. סנן לעקר ולאחסן ב 4 ° C מוגן מפני האור (למשל, לעטוף את צינור בנייר כסף). החלף אם הפתרון הופך צהוב בעליל או אחרי 6 חודשים. הכלאה 2X חיץ: במשך 50 מ&quot;ל, מערבבים 8.3 מ&quot;ל של 12X MES מניות (מ 2.9.14), 17.7 מ&quot;ל של 5 M NaCl, 4.0 מ&quot;ל EDTA M 0.5, 0.1 מ&quot;ל של 10% Tween 20 (כרך / כרך), ו - 19.9 מ&quot;ל מסוננים DDH 2 O. סנן לעקר. שטפי: מערבבים 300 מ&quot;ל 20X SSPE, 1 מ&quot;ל Tween 10% (כרך / כרך א), 699 מ&quot;ל DDH 2 O. סנן לעקר. לשטוף B: מערבבים 150 מ&quot;ל 20X SSPE, 1 מ&quot;ל Tween 10% (כרך / כרך), 849 מ&quot;ל DDH 2 O. סנן לעקר. רצף ברקוד primers ב UP-תג רצפים פריימר הזנב &#39;5 (מודגש) הם Illumina רצפים מתאם מסוים שולבו פריימר F ו-R. רצף משתנה (הדגשה שלי) מייצג את תג 5-mer לאינדקס בשימוש ריבוב / מדד לקריאה החוצה. הזנב &#39;3 (קו תחתון) מייצג את פריימר משותף לאגף את הברקוד uptag והוא נדרש להגביר את ברקודים שמרים. בשנת תג מטה פריימר רצפים 5 &quot;זנב זהה 5&quot; זנב של UP-תג primers (רצף ספציפי Illumina), לעומת זאת, הזנב &#39;3 (קו תחתון) מוחלף עם פריימרים משותפים המשמשים להגביר את למטה תג ברקודים.

competitive genomic screens of barcoded yeast libraries

בזכות ההתקדמות בטכנולוגיות הדור הבא ריצוף, יש לנו גישה רצפי גנום חדש כמעט מדי יום. קצב ההתקדמות אלה מואצת, מבטיח יותר עומק ורוחב. לאור ההתפתחויות הללו יוצא דופן, את הצורך, שיטות מהיר במקביל להגדיר פונקציה הגן הופך להיות יותר ויותר חשוב. אוספים של הגנום כולו מוטציות מחיקה של שמרים וא coli שימשו סוסי עבודה לאפיון פונקציונלי של תפקוד הגנים, אך גישה זו אינה מדרגית הנוכחית גנים המחיקה גישות דורשים כל אחד אלפי גנים אשר מהווים הגנום למחיקה ומאומת. רק לאחר השלמת עבודה זו נוכל לפתח תפוקה גבוהה phenotyping. במהלך העשור האחרון, במעבדה שלנו מעודן פורטפוליו של הגנום כולו תחרותי, מיניאטורי תפוקה גבוהה, מבחני שניתן לבצע במקביל. הקבלה זה אפשרי בשל הכללת &quot;תגים&quot; ה-DNA, או &quot;ברקודים,&quot; לתוך כל מוטציה, עם הברקוד משמש פרוקסי עבור המוטציה, ואפשר למדוד את שפע ברקוד כדי להעריך את כושר מוטנטי. במחקר זה, אנו מבקשים למלא את הפער בין רצף הדנ&quot;א ואוספים מוטציה המינימרקטים. לשם כך אנחנו מציגים transposon בשילוב שיבוש-barcoding גישה שנפתחת מבחני ברקוד במקביל רצף החדש, אך מאופיינת גרוע חיידקים. כדי להמחיש זאת אנו מציגים גישה חדשה קנדידה אלביקנס אוסף שיבוש המבורקדים לתאר איך הן microarray המבוסס על רצף הבא מבוססי פלטפורמות הדור ניתן להשתמש כדי לאסוף 10,000 - 1,000,000 גנים גנים סמים גן אינטראקציות בניסוי יחיד.

Watch this Scientific Journal Video about Competitive Genomic Screens of Barcoded Yeast Libraries at JoVE.com

Competitive Genomic Screens of Barcoded Yeast Libraries

פיתחנו מקיף, משוחדת הגנום כולו מסכי להבין גנים סמים גנים הסביבה אינטראקציות. שיטות סינון אלה אוספים מוטציה מוצגים.

מסכי הגנום תחרותי של ספריות שמרים המבורקדים

By virtue of advances in next generation sequencing technologies, we have access to new genome sequences almost daily.  The tempo of these advances is ...

competitive-genomic-screens-of-barcoded-yeast-libraries

Research

JoVE Journal

Biology

18.1K Views.  University of Toronto. פיתחנו מקיף, משוחדת הגנום כולו מסכי להבין גנים סמים גנים הסביבה אינטראקציות. שיטות סינון אלה אוספים מוטציה מוצגים.

Video: Competitive Genomic Screens of Barcoded Yeast Libraries

Large-Scale Screens of Metagenomic Libraries

Metagenomic libraries archive large fragments of contiguous genomic sequences from microorganisms without requiring prior cultivation. Generating a streamlined procedure for creating and screening metagenomic libraries is therefore useful for efficient high-throughput investigations into the genetic and metabolic properties of uncultured microbial assemblages. Here, key protocols are presented on video, which we propose is the most useful format for accurately describing a long process that alternately depends on robotic instrumentation and (human) manual interventions. First, we employed robotics to spot library clones onto high-density macroarray membranes, each of which can contain duplicate colonies from twenty-four 384-well library plates. Automation is essential for this procedure not only for accuracy and speed, but also due to the miniaturization of scale required to fit the large number of library clones into highly dense spatial arrangements. Once generated, we next demonstrated how the macroarray membranes can be screened for genes of interest using modified versions of standard protocols for probe labeling, membrane hybridization, and signal detection. We complemented the visual demonstration of these procedures with detailed written descriptions of the steps involved and the materials required, all of which are available online alongside the video.

בקנה מידה גדול של מסכי ספריות Metagenomic

Metagenomic libraries archive large fragments of contiguous genomic sequences from microorganisms without requiring prior cultivation.  Generating a ...

Isolation of Genomic DNA from Mouse Tails

בידוד של הדנ&quot;א הגנומי של זנבות עכבר

Technical Demonstration of Whole Genome Array Comparative Genomic Hybridization

Array comparative genomic hybridization (array CGH) is a method for detecting gains and losses of DNA segments or gene dosage in the genome 1. Recent advances in this technology have enabled high resolution comparison of whole genomes for the identification of genetic alterations in cancer and other genetic diseases 2. The Sub-Megabase Resolution Tiling-set array (or SMRT) array is comprised of a set of approximately thirty thousand overlapping bacterial artificial chromosome (BAC) clones that span the human genome in ~100 kilobase pair (kb) segments 2. These BAC targets are individually synthesized and spotted in duplicate on a single glass slide 2-4. Array CGH is based on the principle of competitive hybridization. Sample and reference DNA are differentially labeled with Cyanine-3 and Cyanine-5 fluorescent dyes, and co-hybridized to the array. After an incubation period the unbound samples are washed from the slide and the array is imaged. A freely available custom software package called SeeGH (www.flintbox.ca) is used to process the large volume of data collected - a single experiment generates 53,892 data points. SeeGH visualizes the log2 signal intensity ratio between the 2 samples at each BAC target which is vertically aligned with chromosomal position 5,6. The SMRT array can detect alterations as small as 50 kb in size 7. The SMRT array can detect a variety of DNA rearrangement events including DNA gains, losses, amplifications and homozygous deletions. A unique advantage of the SMRT array is that one can use DNA isolated from formalin fixed paraffin embedded samples. When combined with the low input requirements of unamplified DNA (25-100ng) this allows profiling of precious samples such as those produced by microdissection 7,8. This is attributed to the large size of each BAC hybridization target that allows the binding of sufficient labeled samples to produce signals for detection. Another advantage of this platform is the tolerance of tissue heterogeneity, decreasing the need for tedious tissue microdissection 8. This video protocol is a step-by-step tutorial from labeling the input DNA through to signal acquisition for the whole genome tiling path SMRT array.

This video is a technical demonstration of the hybridization protocol for whole genome tiling path array CGH, which scans the entire human genome using only 25-100 ng of DNA that can be isolated from a variety of sources, including archival formalin fixed material.

הפגנה טכנית של הכלאה שלמות מערך הגנום הגנום השוואתי

Array comparative genomic hybridization (array CGH) is a method for detecting gains and losses of DNA segments or gene dosage in the genome 1.  Recent ...

Large Insert Environmental Genomic Library Production

The vast majority of microbes in nature currently remain inaccessible to traditional cultivation methods. Over the past decade, culture-independent environmental genomic (i.e. metagenomic) approaches have emerged, enabling researchers to bridge this cultivation gap by capturing the genetic content of indigenous microbial communities directly from the environment. To this end, genomic DNA libraries are constructed using standard albeit artful laboratory cloning techniques. Here we describe the construction of a large insert environmental genomic fosmid library with DNA derived from the vertical depth continuum of a seasonally hypoxic fjord. This protocol is directly linked to a series of connected protocols including coastal marine water sampling [1], large volume filtration of microbial biomass [2] and a DNA extraction and purification protocol [3]. At the outset, high quality genomic DNA is end-repaired with the creation of 5 -phosphorylated blunt ends. End-repaired DNA is subjected to pulsed-field gel electrophoresis (PFGE) for size selection and gel extraction is performed to recover DNA fragments between 30 and 60 thousand base pairs (Kb) in length. Size selected DNA is purified away from the PFGE gel matrix and ligated to the phosphatase-treated blunt-end fosmid CopyControl vector pCC1 (EPICENTRE <a href="http://www.epibio.com/item.asp?ID=385">http://www.epibio.com/item.asp?ID=385</a>). Linear concatemers of pCC1 and insert DNA are subsequently headfull packaged into phage particles by lambda terminase, with subsequent infection of phage-resistant E. coli cells. Successfully transduced clones are recovered on LB agar plates under antibiotic selection and archived in 384-well plate format using an automated colony picking robot (Qpix2, GENETIX). The current protocol draws from various sources including the CopyControl Fosmid Library Production Kit from EPICENTRE and the published works of multiple research groups [4-7]. Each step is presented with best practice in mind. Whenever possible we highlight subtleties in execution to improve overall quality and efficiency of library production. The whole process of fosmid library production and automated colony picking takes at least 7-10 days as there are many incubation steps included. However, there are several stopping points possible which are mentioned within the protocol.

Construction of a fosmid library with environmental genomic DNA isolated from the vertical depth continuum of a seasonally hypoxic fjord is described. The resulting clone library is picked into 384-well plates and archived for downstream sequencing and functional screening by the application of an automated colony picking system.

הכנס גדול הסביבה הגנום ספריית הפקה

The vast majority of microbes in nature currently remain inaccessible to traditional cultivation methods. Over the past decade, culture-independent ...

Development of automated imaging and analysis for zebrafish chemical screens.

We demonstrate the application of image-based high-content screening (HCS) methodology to identify small molecules that can modulate the FGF/RAS/MAPK pathway in zebrafish embryos. The zebrafish embryo is an ideal system for in vivo high-content chemical screens. The 1-day old embryo is approximately 1mm in diameter and can be easily arrayed into 96-well plates, a standard format for high throughput screening. During the first day of development, embryos are transparent with most of the major organs present, thus enabling visualization of tissue formation during embryogenesis. The complete automation of zebrafish chemical screens is still a challenge, however, particularly in the development of automated image acquisition and analysis. We previously generated a transgenic reporter line that expresses green fluorescent protein (GFP) under the control of FGF activity and demonstrated their utility in chemical screens 1. To establish methodology for high throughput whole organism screens, we developed a system for automated imaging and analysis of zebrafish embryos at 24-48 hours post fertilization (hpf) in 96-well plates 2. In this video we highlight the procedures for arraying transgenic embryos into multiwell plates at 24hpf and the addition of a small molecule (BCI) that hyperactivates FGF signaling 3. The plates are incubated for 6 hours followed by the addition of tricaine to anesthetize larvae prior to automated imaging on a Molecular Devices ImageXpress Ultra laser scanning confocal HCS reader. Images are processed by Definiens Developer software using a Cognition Network Technology algorithm that we developed to detect and quantify expression of GFP in the heads of transgenic embryos. In this example we highlight the ability of the algorithm to measure dose-dependent effects of BCI on GFP reporter gene expression in treated embryos.

We report the development of a system for automated imaging and analysis of zebrafish transgenic embryos in multiwell plates. This demonstrates the ability to measure dose dependent effects of a small molecule, BCI, on Fibroblast Growth Factor reporter gene expression and provide technology for establishing high-throughput zebrafish chemical screens.

פיתוח הדמיה ניתוח אוטומטיות עבור מסכי דג הזברה כימיים.

We demonstrate the application of image-based high-content screening (HCS) methodology to identify small molecules that can modulate the FGF/RAS/MAPK ...

Genomic MRI - a Public Resource for Studying Sequence Patterns within Genomic DNA

Non-coding genomic regions in complex eukaryotes, including intergenic areas, introns, and untranslated segments of exons, are profoundly non-random in their nucleotide composition and consist of a complex mosaic of sequence patterns. These patterns include so-called Mid-Range Inhomogeneity (MRI) regions -- sequences 30-10000 nucleotides in length that are enriched by a particular base or combination of bases (e.g. (G+T)-rich, purine-rich, etc.). MRI regions are associated with unusual (non-B-form) DNA structures that are often involved in regulation of gene expression, recombination, and other genetic processes (Fedorova &amp; Fedorov 2010). The existence of a strong fixation bias within MRI regions against mutations that tend to reduce their sequence inhomogeneity additionally supports the functionality and importance of these genomic sequences (Prakash et al. 2009).
Here we demonstrate a freely available Internet resource -- the Genomic MRI program package -- designed for computational analysis of genomic sequences in order to find and characterize various MRI patterns within them (Bechtel et al. 2008). This package also allows generation of randomized sequences with various properties and level of correspondence to the natural input DNA sequences. The main goal of this resource is to facilitate examination of vast regions of non-coding DNA that are still scarcely investigated and await thorough exploration and recognition.

We present a public computational web site for the analysis of genomic sequences. It detects DNA sequence patterns with various non-random nucleotide compositions. This resource also generates randomized sequences with diverse levels of complexity.

הגנום MRI - משאב ציבורי עבור לימוד דפוסי בתוך רצף הדנ&quot;א הגנומי

Non-coding genomic regions in complex eukaryotes, including intergenic areas, introns, and untranslated segments of exons, are profoundly non-random in ...

Genomic Transformation of the Picoeukaryote Ostreococcus tauri

Common problems hindering rapid progress in Plant Sciences include cellular, tissue and whole organism complexity, and notably the high level of genomic redundancy affecting simple genetics in higher plants. The novel model organism Ostreococcus tauri is the smallest free-living eukaryote known to date, and possesses a greatly reduced genome size and cellular complexity1,2, manifested by the presence of just one of most organelles (mitochondrion, chloroplast, golgi stack) per cell, and a genome containing only ~8000 genes. Furthermore, the combination of unicellularity and easy culture provides a platform amenable to chemical biology approaches. Recently, Ostreococcus has been successfully employed to study basic mechanisms underlying circadian timekeeping3-6. Results from this model organism have impacted not only plant science, but also mammalian biology7. This example highlights how rapid experimentation in a simple eukaryote from the green lineage can accelerate research in more complex organisms by generating testable hypotheses using methods technically feasible only in this background of reduced complexity. Knowledge of a genome and the possibility to modify genes are essential tools in any model species. Genomic1, Transcriptomic8, and Proteomic9 information for this species is freely available, whereas the previously reported methods6,10 to genetically transform Ostreococcus are known to few laboratories worldwide.
In this article, the experimental methods to genetically transform this novel model organism with an overexpression construct by means of electroporation are outlined in detail, as well as the method of inclusion of transformed cells in low percentage agarose to allow selection of transformed lines originating from a single transformed cell. Following the successful application of Ostreococcus to circadian research, growing interest in Ostreococcus can be expected from diverse research areas within and outside plant sciences, including biotechnological areas. Researchers from a broad range of biological and medical sciences that work on conserved biochemical pathways may consider pursuing research in Ostreococcus, free from the genomic and organismal complexity of larger model species.

Genomic Transformation of the Picoeukaryote Ostreococcus tauri

This article describes genetic transformation of the unicellular marine alga Ostreococcus tauri by electroporation. This eukaryotic organism is an effective model platform for higher plants, possesing greatly reduced genomic and cellular complexity and being readily amenable to both cell culture and chemical biology.

שינוי גנטי של Picoeukaryote<em&gt; Ostreococcus tauri</em

Common problems hindering rapid progress in Plant Sciences include cellular, tissue and whole organism complexity, and notably the high level of genomic ...

Selective Capture of 5-hydroxymethylcytosine from Genomic DNA

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene expression, maintenance of genome integrity, parental imprinting, X-chromosome inactivation, regulation of development, aging, and cancer1. Recently, the presence of an oxidized 5-mC, 5-hydroxymethylcytosine (5-hmC), was discovered in mammalian cells, in particular in embryonic stem (ES) cells and neuronal cells2-4. 5-hmC is generated by oxidation of 5-mC catalyzed by TET family iron (II)/&alpha;-ketoglutarate-dependent dioxygenases2, 3. 5-hmC is proposed to be involved in the maintenance of embryonic stem (mES) cell, normal hematopoiesis and malignancies, and zygote development2, 5-10. To better understand the function of 5-hmC, a reliable and straightforward sequencing system is essential. Traditional bisulfite sequencing cannot distinguish 5-hmC from 5-mC11. To unravel the biology of 5-hmC, we have developed a highly efficient and selective chemical approach to label and capture 5-hmC, taking advantage of a bacteriophage enzyme that adds a glucose moiety to 5-hmC specifically12.
Here we describe a straightforward two-step procedure for selective chemical labeling of 5-hmC. In the first labeling step, 5-hmC in genomic DNA is labeled with a 6-azide-glucose catalyzed by &beta;-GT, a glucosyltransferase from T4 bacteriophage, in a way that transfers the 6-azide-glucose to 5-hmC from the modified cofactor, UDP-6-N3-Glc (6-N3UDPG). In the second step, biotinylation, a disulfide biotin linker is attached to the azide group by click chemistry. Both steps are highly specific and efficient, leading to complete labeling regardless of the abundance of 5-hmC in genomic regions and giving extremely low background. Following biotinylation of 5-hmC, the 5-hmC-containing DNA fragments are then selectively captured using streptavidin beads in a density-independent manner. The resulting 5-hmC-enriched DNA fragments could be used for downstream analyses, including next-generation sequencing.
Our selective labeling and capture protocol confers high sensitivity, applicable to any source of genomic DNA with variable/diverse 5-hmC abundances. Although the main purpose of this protocol is its downstream application (i.e., next-generation sequencing to map out the 5-hmC distribution in genome), it is compatible with single-molecule, real-time SMRT (DNA) sequencing, which is capable of delivering single-base resolution sequencing of 5-hmC.

Described is a two-step labeling process using &beta;-glucosyltransferase (&beta;-GT) to transfer an azide-glucose to 5-hmC, followed by click chemistry to transfer a biotin linker for easy and density-independent enrichment. This efficient and specific labeling method enables enrichment of 5-hmC with extremely low background and high-throughput epigenomic mapping via next-generation sequencing.

לכידה סלקטיבית של 5-hydroxymethylcytosine מהדנ&quot;א הגנומי

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene ...

Assessing Differences in Sperm Competitive Ability in Drosophila

Competition among conspecific males for fertilizing the ova is one of the mechanisms of sexual selection, i.e. selection that operates on maximizing the number of successful mating events rather than on maximizing survival and viability 1. Sperm competition represents the competition between males after copulating with the same female 2, in which their sperm are coincidental in time and space. This phenomenon has been reported in multiple species of plants and animals 3. For example, wild-caught D. melanogaster females usually contain sperm from 2-3 males 4. The sperm are stored in specialized organs with limited storage capacity, which might lead to the direct competition of the sperm from different males 2,5.
Comparing sperm competitive ability of different males of interest (experimental male types) has been performed through controlled double-mating experiments in the laboratory 6,7. Briefly, a single female is exposed to two different males consecutively, one experimental male and one cross-mating reference male. The same mating scheme is then followed using other experimental male types thus facilitating the indirect comparison of the competitive ability of their sperm through a common reference. The fraction of individuals fathered by the experimental and reference males is identified using markers, which allows one to estimate sperm competitive ability using simple mathematical expressions 7,8. In addition, sperm competitive ability can be estimated in two different scenarios depending on whether the experimental male is second or first to mate (offense and defense assay, respectively) 9, which is assumed to be reflective of different competence attributes.
Here, we describe an approach that helps to interrogate the role of different genetic factors that putatively underlie the phenomenon of sperm competitive ability in D. melanogaster.

Assessing Differences in Sperm Competitive Ability in Drosophila

Differential sperm competitive ability among Drosophila males with distinct genotypes can be ascertained through double-mating experiments. Each of these experiments involves one of the males of interest and a reference male. Readily identifiable markers in the progeny allow inference of the fraction of individuals fathered by each male.

הבדלי שומה ביכולת תחרותית בזרע<em&gt; דרוזופילה</em

Competition among conspecific males for fertilizing the ova is one of the mechanisms of sexual selection, i.e. selection that operates on maximizing the ...

Array Comparative Genomic Hybridization (Array CGH) for Detection of Genomic Copy Number Variants

Array CGH for the detection of genomic copy number variants has replaced G-banded karyotype analysis. This paper describes the technology and its application in a clinical diagnostic service laboratory. DNA extracted from a patient&#8217;s sample (blood, saliva or other tissue types) is labeled with a fluorochrome (either cyanine 5 or cyanine 3). A reference DNA sample is labeled with the opposite fluorochrome. There follows a cleanup step to remove unincorporated nucleotides before the labeled DNAs are mixed and resuspended in a hybridization buffer and applied to an array comprising ~60,000 oligonucleotide probes from loci across the genome, with high probe density in clinically important areas. Following hybridization, the arrays are washed, then scanned and the resulting images are analyzed to measure the red and green fluorescence for each probe. Software is used to assess the quality of each probe measurement, calculate the ratio of red to green fluorescence and detect potential copy number variants.

Array Comparative Genomic Hybridization Array CGH for Detection of Genomic Copy Number Variants

Array CGH for the detection of genomic copy number variants has replaced G-banded karyotype analysis. This paper describes the technology and its application in a diagnostic service laboratory.