Nous tenons à remercier Ron Davis, Adam Deutschbauer, et le laboratoire HIP HOP entière à l&#39;Université de Toronto pour des discussions et des conseils. Le CN est soutenu par des subventions de la National Human Genome Research Institute (Numéro de la subvention HG000205), RO1 HG003317, les IRSC RdP-84 305, et Société canadienne du cancer (# 020380). Jo a été soutenu par le Programme de formation de Stanford Genome (Numéro de la subvention T32 HG00044 du National Human Genome Research Institute) et le National Institutes of Health (numéro Grant P01 GH000205). GG est soutenu par le NHGRI HG003317 RO1 et la Société canadienne du cancer, Grant # 020380, TD et le Centre de séquençage Donnelly est soutenu en partie par des subventions de la Fondation canadienne pour l&#39;innovation pour les docteurs. Brenda Andrews et Jack Greenblatt. AMS est soutenu par l&#39;Université de Toronto Bourse ouverte.

<ol>
	<li>Giaever, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+profiling+of+the+Saccharomyces+cerevisiae+genome.">Functional profiling of the Saccharomyces cerevisiae genome.</a> Nature. 418, 387-391 (2002).</li><li>Baba, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Molecular systems biology. 2, 2006.0008-2006.0008 (2006).</li><li>Claus, H., Frosch, M., Vogel, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+hotspot+for+transformation+of+Neisseria+meningitidis+by+shuttle+mutagenesis+using+signature-tagged+transposons.">Identification of a hotspot for transformation of Neisseria meningitidis by shuttle mutagenesis using signature-tagged transposons.</a> Mol Gen Genet. 259, 363-371 (1998).</li><li>Hava, D. L., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-scale+identification+of+serotype+4+Streptococcus+pneumoniae+virulence+factors.">Large-scale identification of serotype 4 Streptococcus pneumoniae virulence factors.</a> Molecular microbiology. 45, 1389-1406 (2002).</li><li>Costanzo, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Genetic+Landscape+of+a+Cell.">The Genetic Landscape of a Cell.</a> Science. 327, 425-431 (2010).</li><li>Tong, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+genetic+analysis+with+ordered+arrays+of+yeast+deletion+mutants.">Systematic genetic analysis with ordered arrays of yeast deletion mutants.</a> Science. 294, 2364-2368 (2001).</li><li>Pan, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+robust+toolkit+for+functional+profiling+of+the+yeast+genome.">A robust toolkit for functional profiling of the yeast genome.</a> Molecular cell. 16, 487-496 (2004).</li><li>Schuldiner, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploration+of+the+Function+and+Organization+of+the+Yeast+Early+Secretory+Pathway+through+an+Epistatic+Miniarray+Profile.">Exploration of the Function and Organization of the Yeast Early Secretory Pathway through an Epistatic Miniarray Profile.</a> Cell. 123, 507-519 (2005).</li><li>Deutschbauer, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+haploinsufficiency+revealed+by+genome-wide+profiling+in+yeast.">Mechanisms of haploinsufficiency revealed by genome-wide profiling in yeast.</a> Genetics. 169, 1915-1925 (2005).</li><li>Giaever, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemogenomic+profiling:+identifying+the+functional+interactions+of+small+molecules+in+yeast.">Chemogenomic profiling: identifying the functional interactions of small molecules in yeast.</a> Proceedings of the National Academy of Sciences of the United States of America. 101, 793-798 (2004).</li><li>Lum, P. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovering+modes+of+action+for+therapeutic+compounds+using+a+genome-wide+screen+of+yeast+heterozygotes.">Discovering modes of action for therapeutic compounds using a genome-wide screen of yeast heterozygotes.</a> Cell. 116, 121-137 (2004).</li><li>Hillenmeyer, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+chemical+genomic+portrait+of+yeast:+uncovering+a+phenotype+for+all+genes.">The chemical genomic portrait of yeast: uncovering a phenotype for all genes.</a> Science. 320, 362-365 (2008).</li><li>Oh, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+universal+TagModule+collection+for+parallel+genetic+analysis+of+microorganisms.">A universal TagModule collection for parallel genetic analysis of microorganisms.</a> Nucleic acids research. 38, e146-e146 (2010).</li><li>Oh, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+annotation+and+drug+target+discovery+in+Candida+albicans+with+a+tagged+transposon+mutant+collection.">Gene annotation and drug target discovery in Candida albicans with a tagged transposon mutant collection.</a> PLoS pathogens. 6, (2010).</li><li>Nislow, C., Giaever, G., Stark, I., Stansfields, M. J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chapter+387.">Chapter 387.</a> Yeast Gene Analysis. , 387-414 (2007).</li><li>Pierce, S. E., Davis, R. W., Nislow, C., Giaever, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+of+barcoded+Saccharomyces+cerevisiae+gene-deletion+mutants+in+pooled+cultures.">Genome-wide analysis of barcoded Saccharomyces cerevisiae gene-deletion mutants in pooled cultures.</a> Nature protocols. 2, 2958-2974 (2007).</li><li>Sambrook, J., Russell, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning : a laboratory manual. , (2001).</li><li>Smith, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+phenotyping+via+deep+barcode+sequencing.">Quantitative phenotyping via deep barcode sequencing.</a> Genome Res. , (2009).</li><li>Hamady, M., Walker, J. J., Harris, J. K., Gold, N. J., Knight, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Error-correcting+barcoded+primers+for+pyrosequencing+hundreds+of+samples+in+multiplex.">Error-correcting barcoded primers for pyrosequencing hundreds of samples in multiplex.</a> Nature. 5, 235-237 (2008).</li><li>Gresham, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=System-Level+Analysis+of+Genes+and+Functions+Affecting+Survival+During+Nutrient+Starvation+in+Saccharomyces+cerevisiae.">System-Level Analysis of Genes and Functions Affecting Survival During Nutrient Starvation in Saccharomyces cerevisiae.</a> Genetics. 187, 299-317 (2011).</li></ol>

Aucun conflit d&#39;intérêt déclaré.

Ici, nous avons présenté un protocole qui, avec une modification modeste, peut facilement être adapté à un large éventail de collections existantes des codes-barres collections de mutants de microorganismes différents pour créer des collections de mutants étiquetés. Nous soulignons que, bien que nous avons rapporté un protocole sur la mutagenèse transposon marqués pour la levure pathogène C. albicans, un protocole très similaire pourrait être adapté à une grande variété de champignons unicellulaires. Mise à jour, ce protocole fonctionne bien chez les bactéries 13, et actuellement les collections d&#39;un certain nombre d&#39;autres génomes fongiques et bactériennes sont en construction. A l&#39;heure actuelle, ce test fournit la seule complète, l&#39;ensemble du génome d&#39;écran impartiale pour les interactions gène-petite molécule. Une caractéristique particulièrement convaincante de l&#39;essai est qu&#39;aucune connaissance préalable du gène ou de petites molécules est nécessaire. En dépit de la portée et la puissance de ces tests, leur transférabilité à d&#39;autres laboratoires a été entravée par le peu d&#39;investissement initial et outils informatiques pour l&#39;analyse des résultats. Avec l&#39;adoption d&#39;une lecture séquence prochaine génération combinée avec des outils robustes pour l&#39;analyse, nous nous attendons à leur adoption à augmenter.

<table border="1"><tbody><tr><td> Antibiotiques </td><td> Numéros de fournisseur et le catalogue </td></tr><tr><td> Carbénicilline </td><td> Sigma, pièce # C1613 </td></tr><tr><td> Kanamycine </td><td> Sigma, pièce # K1876 </td></tr><tr><td> spectinomycine </td><td> Sigma, pièce # S0692 </td></tr><tr><td> Le chloramphénicol </td><td> Sigma, pièce # C0378 </td></tr><tr><td> DNA Clean-up et des kits de concentration </td><td></td></tr><tr><td> QIAprep Spin Miniprep Kit </td><td> Qiagen, pièce # 27106 </td></tr><tr><td> HiSpeed ​​Maxi Kit Plasmid </td><td> Qiagen, pièce # 12663 </td></tr><tr><td> QIAquick PCR Purification </td><td> Qiagen, pièce # 28106 </td></tr><tr><td> QIAquick Gel Extraction Kit </td><td> Qiagen, pièce # 28704 </td></tr><tr><td> PCR et des réactifs d&#39;électrophorèse </td><td></td></tr><tr><td> Taq DNA polymerase (Mg-libres) Tampon </td><td> New England Biolabs, pièce # M0320L </td></tr><tr><td> Mélanger une solution désoxynucléotides </td><td> New England Biolabs, pièce # N0447L </td></tr><tr><td> 25 mM MgCl 2 </td><td> Sigma, pièce # 63036 </td></tr><tr><td> Agarose, le colorant de charge et d&#39;acides nucléiques tache adapté à l&#39;électrophorèse sur gel </td><td> Divers </td></tr><tr><td> 10X tampon TAE </td><td> Sigma, pièce # T8280 </td></tr><tr><td> 1 Kb DNA Ladder plus </td><td> Invitrogen, pièce # 10787026 </td></tr><tr><td> YPD bouillon </td><td></td></tr><tr><td> 10 g d&#39;extrait de levure </td><td> Sigma, pièce # Y1625 </td></tr><tr><td> 20 g de peptone Bacto </td><td> BD Biosciences, pièce # 211677 </td></tr><tr><td> 20 g de dextrose </td><td> Sigma, pièce # D9434 </td></tr><tr><td> Labware </td><td></td></tr><tr><td> Pipettes multicanaux (1000, 200, et 20 pi) </td><td> Divers </td></tr><tr><td> Jetables réservoirs de pipetage </td><td> Divers </td></tr><tr><td> 15 et 50 ml tubes à centrifuger </td><td> Divers </td></tr><tr><td> 96 - et 384 puits profonds plaques à puits </td><td> Axygen scientifique, pièce # P-2ML-SQ-CS &amp; P-384240SQCS </td></tr><tr><td> 96 puits et 384 puits de PCR et le film d&#39;étanchéité </td><td> Divers </td></tr><tr><td> Plaque pour rouleaux d&#39;étanchéité plaques multi-puits </td><td> Sigma, pièce # R1275 </td></tr><tr><td> 30 ° C et 37 ° C en secouant incubateurs pour la culture des bactéries et de levures sur les assiettes et dans les tubes </td><td> Divers </td></tr><tr><td> In vitro transposon mutagenèse </td><td></td></tr><tr><td> EZ-Tn5 transposase </td><td> Biotechnologies Epicentre, pièce # TNP92110 </td></tr><tr><td> À haut débit de transformation </td><td></td></tr><tr><td> Seqprep 96 Kit HT Prep Plasmid </td><td> Edge Biosystems, pièce # 84359 </td></tr><tr><td> polyéthylène glycol, poids moléculaire 3350 </td><td> Divers </td></tr><tr><td> l&#39;acétate de lithium </td><td> Sigma, pièce # 517992 </td></tr><tr><td> Plaques de 6 puits, stériles </td><td> Corning, pièce # 3335 </td></tr><tr><td> 50 mg / ml d&#39;uridine </td><td> Sigma, pièce # U3750 </td></tr><tr><td> Solution de 100X tampon Tris-EDTA </td><td> Sigma, pièce # T9285 </td></tr><tr><td> 1X TE/0.1M LiOAc </td><td> Divers </td></tr><tr><td> Saumon testicule ADN </td><td> Sigma, pièce # 1626 </td></tr><tr><td> La croissance des collections code-barres </td><td></td></tr><tr><td> Plaques de 48 puits, et si de plus en plus les cultures en plaques </td><td> Greiner, pièce # M9437 </td></tr><tr><td> Sceaux plaque adhésive </td><td> ABgene, pièce # AB-0580 </td></tr><tr><td> 200 flacons de culture ml </td><td> Divers </td></tr><tr><td> Spectrophotomètre permettant d&#39;absorbance </td><td> Divers </td></tr><tr><td> À température contrôlée shaker pour flacons de 250 ml ou spectrophotomètre secouant </td><td> Divers </td></tr><tr><td> Microtube Safe-Lock, 2 ml </td><td> Eppendorf, pièce # 0030 120.094 </td></tr><tr><td> Hybridation équipements </td><td></td></tr><tr><td> 640 Four à hybridation </td><td> Affymetrix, pièce # 800138 </td></tr><tr><td> GeneChip fluidique station 450 </td><td> Affymetrix, pièce # 00-0079 </td></tr><tr><td> GeneArray Scanner 3000 </td><td> Affymetrix, pièce # 00-0212 </td></tr><tr><td> Bain d&#39;eau bouillante avec rack flottante </td><td> Divers </td></tr><tr><td> Hybridation des consommables </td><td></td></tr><tr><td> GenFlex Tag tableau 16K v2 </td><td> AffymEtrix, pièce # 511331 </td></tr><tr><td> Solution de Denhardt, concentré 50X </td><td> Sigma, pièce # D2532 </td></tr><tr><td> Streptavidine, la R-phycoérythrine conjugué (SAPE) </td><td> Invitrogen, pièce # S866 </td></tr><tr><td> Microtube Safe-Lock, 0,5 mL </td><td> Eppendorf, pièce # 0030 123.301 </td></tr><tr><td> Teeny Tough-Spots </td><td> Diversified Biotech, pièce # LTTM-1000 </td></tr><tr><td> EDTA 0,5 M </td><td> BioRad, pièce # 161-0729 </td></tr><tr><td> 10% de Tween </td><td> Sigma, pièce # T2700 </td></tr><tr><td> Monohydraté MES sans acide </td><td> Sigma, pièce # M5287 </td></tr><tr><td> Sel de sodium MES </td><td> Sigma, pièce # M5057 </td></tr><tr><td> 5 M de NaCl </td><td> Sigma, pièce # 71386 </td></tr><tr><td> 20X SSPE </td><td> Sigma, pièce # S2015 </td></tr><tr><td> Moléculaire de l&#39;eau de qualité de biologie </td><td> Sigma, pièce # W4502 </td></tr><tr><td> Primaires hybridation </td><td> Divers fournisseurs (dessalage standard) </td></tr><tr><td> Uptag </td><td> 5 &#39;GATGTCCACGAGGTCTCT 3&#39; </td></tr><tr><td> Buptagkanmx4 </td><td> 5 &#39;biotine-GTCGACCTGCAGCGTACG 3&#39; </td></tr><tr><td> Dntag </td><td> 5 &#39;CGGTGTCGGTCTCGTAG 3&#39; </td></tr><tr><td> Bdntagkanmx4 </td><td> 5 &#39;biotine-GAAAACGAGCTCGAATTCATCG 3&#39; </td></tr><tr><td> B213 </td><td> 5 &#39;biotine-CTGAACGGTAGCATCTTGAC 3&#39; </td></tr><tr><td> Uptagkanmx </td><td> 5 &#39;GTCGACCTGCAGCGTACG 3&#39; </td></tr><tr><td> Dntagkanmx </td><td> 5&#39;GAAAACGAGCTCGAATTCATCG 3 &#39; </td></tr><tr><td> Uptagcomp </td><td> 5&#39;AGAGACCTCGTGGACATC 3 &#39; </td></tr><tr><td> Dntagcomp </td><td> 5&#39;CTACGAGACCGACACCG 3 &#39; </td></tr><tr><td> Upkancomp </td><td> 5&#39;CGTACGCTGCAGGTCGAC 3 &#39; </td></tr><tr><td> Dnkancomp </td><td> 5&#39;CGATGAATTCGAGCTCGTTTTC 3 &#39; </td></tr><tr><td> Amorces de séquençage: Plate-forme Illumina </td><td> Divers fournisseurs </td></tr><tr><td> UpTag Forward (100uM) </td><td> 5 &#39;CAA GCA GAA GAC GGC CGA ATA GCT ATC CTT GCC T GAT GTC CAC GAG GTC TCT 3&#39; </td></tr><tr><td> UpTag inverse (100uM) </td><td> 5 &#39;AAT GCG GAT ACG CAC CAC GAC LOI CTT TCC CTA CAC GAC TGC CTT GCC ATC T NNNNN GTC GAC CTG ACG CGT ACG 3&#39; </td></tr><tr><td> DownTag Forward (100uM) </td><td> 5 &#39;CAA GCA GAA GAC GGC CGA ATA GCT ATC CTT GCC T GAA GAA CTC GAG AAC TTC ATC G 3&#39; </td></tr><tr><td> DownTag inverse (100uM) </td><td> 5 &#39;AAT GCG GAT ACG CAC CAC GAC LOI CTT TCC CTA CAC GAC TGC CTT GCC ATC T NNNNN CGG TGT CGG TCT CGT AG 3 ` </td></tr><tr><td> Lire 1 UP-tag suivants amorce (100uM) </td><td> 5 &#39;GTC GAC CTG ACG CGT ACG 3&#39; </td></tr><tr><td> Lire une BAS-tag amorce SEQ (100uM) </td><td> 5 &#39;TGT CGG CGG TCT CGT AG 3&#39; </td></tr><tr><td> Lire 2 amorce de séquençage Index (standard Illumina R1 amorce) (100uM) </td><td> 5 &#39;AC LOI CTT TCC CTA CAC GAC TGC CTT GCC ATC T 3&#39; </td></tr><tr><td> Réactifs de séquençage supplémentaires / Equipement </td><td></td></tr><tr><td> Qiagen MinElute 96 Kit UF purification de PCR </td><td> Qiagen, pièce # 29051 </td></tr><tr><td> Pompe à vide </td><td> Tout vendeur </td></tr><tr><td> Collecteur à vide Macherey-Nagel </td><td> Macherey-Nagel, pièce # 740 681 </td></tr><tr><td> Invitrogen Quant-iT ADNdb BR Assay Kit </td><td> Invitrogen, pièce # Q32853 </td></tr><tr><td> Invitrogen tubes de dosage Qubit </td><td> Invitrogen, pièce # Q32856 </td></tr><tr><td> 40% d&#39;acrylamide, plus de 1% N, N&#39;-méthylène-bis-acrylamide, 37.5:1 </td><td> Bio Rad, pièce # 161-0148 </td></tr><tr><td> Tris Base </td><td> Sigma, pièce # T1503-1KG </td></tr><tr><td> Acide borique </td><td> Sigma, pièce # B6768-500G </td></tr><tr><td> EDTA 0,5 M, pH 8,0 </td><td> Teknova, pièce # E0306 </td></tr><tr><td> Persulfate d&#39;ammonium </td><td> Sigma, pièce # A3678-25G </td></tr><tr><td> TEMED </td><td> Bioshop, pièce # TEM001.25 </td></tr><tr><td> Solution de bromure d&#39;éthidium </td><td> Bioshop, pièce # ETB444.10 </td></tr><tr><td> L&#39;acétate d&#39;ammonium 0,5 M </td><td> Teknova, pièce # A2000 </td></tr><tr><td> 10 mM acétate de magnésium tétrahydraté </td><td> Sigma, pièce # M0631-100G </td></tr><tr><td> 1mM EDTA, pH 8,0 </td><td> Voir EDTA 0,5 M, pH 8,0 </td></tr><tr><td> Éthanol </td><td> Divers </td></tr><tr><td> L&#39;acétate de sodium, pH 5,2 </td><td> Teknova, pièce # S0297 </td></tr><tr><td> Vitesse à vide </td><td> Divers </td></tr><tr><td> Single-Kit Lire Génération Cluster </td><td> Illumina, pièce # GD-300-1001 </td></tr><tr><td> 36c Séquencement v4 kit </td><td>Illumina, pièce # FC-104-4002 </td></tr><tr><td></td><td></td></tr></tbody></table> Recette de TBE 10X <table border="1"><tbody><tr><td> Montants </td><td> Réactifs </td></tr><tr><td> 108 grammes </td><td> Tris Base </td></tr><tr><td> 55 grammes </td><td> Acide borique </td></tr><tr><td> 40mL </td><td> EDTA 0,5 M (pH 8,0) </td></tr><tr><td colspan="2"> Ajouter dH 2 O pour marquer 1L </td></tr></tbody></table> 12% de gel de polyacrylamide recette <table border="1"><tbody><tr><td> Volumes </td><td> Réactifs </td></tr><tr><td> 5,8 ml </td><td> 40% d&#39;acrylamide, plus de 1% N, N&#39;-méthylène-bis-acrylamide, 37.5:1 </td></tr><tr><td> 12 ml </td><td> dH 2 O </td></tr><tr><td> 2 ml </td><td> TBE 10X </td></tr><tr><td> 140 ul </td><td> Persulfate d&#39;ammonium à 10% </td></tr><tr><td> Le volume total: 20ml </td><td></td></tr></tbody></table> Uptag mélange d&#39;amorces: Resuspendre Uptag et Buptagkanmx4 chacun dans ddH 2 O à 100 uM, puis mélanger dans un rapport 1:1 pour une concentration finale de 50 uM de chacun. Conserver à -20 ° C. Downtag mélange d&#39;amorces: Resuspendre Dntag et Bdntagkanmx4 chacun dans ddH 2 O à 100 uM, puis mélanger dans un rapport 1:1 pour une concentration finale de 50 uM de chacun. Conserver à -20 ° C. Oligonucléotides mixtes: Resuspendre chacun des huit suivantes oligos (standard dessalé) dans le trou DDH 2 O à 100 M: Uptag, Dntag, Uptagkanmx, Dntagkanmx, Uptagcomp, Dntagcomp, Upkancomp, Dnkancomp. Mélanger un volume égal de huit oligonucléotides pour une concentration finale de 12,5 uM de chacun. 12X MES stock: Pour 10 ml, dissoudre 0,7 g MES monohydrate d&#39;acide libre et 1,93 g de sel de sodium dans 8 ml MES de biologie moléculaire, l&#39;eau de qualité. Après en mélangeant bien, vérifier le pH et l&#39;ajuster si nécessaire à un pH 6.5 au 6.7. Ajouter l&#39;eau pour un volume total de 10 ml. Filtre stériliser et conserver à 4 ° C à l&#39;abri de la lumière (par exemple, envelopper le tube dans du papier). Remplacer si la solution devient visiblement jaune ou après 6 mois. Tampon d&#39;hybridation 2X: Pour 50 ml, mélanger 8,3 ml de 12X MES stock (à partir de 2.9.14), 17,7 ml de NaCl 5 M, 4,0 ml d&#39;EDTA 0,5 M, 0,1 ml de 10% de Tween 20 (vol / vol), et 19,9 ml filtrée ddH 2 O. Stériliser par filtration. Lavez A: Mélanger 300 ml 20X SSPE, 1 ml de Tween 10% (vol / vol), 699 ml ddH 2 O. Stériliser par filtration. Lavez B: Mélanger 150 ml 20X SSPE, 1 ml de Tween 10% (vol / vol), 849 ml ddH 2 O. Stériliser par filtration. Amorces de séquençage Barcode Dans les séquences des amorces UP-tag 5 &#39;de la queue (en gras) sont des séquences d&#39;Illumina adaptateur spécifique incorporé dans l&#39;apprêt F et R. La séquence variable (en italique) représente la balise indexation 5-mer utilisée dans le multiplexage / index de lecture. La queue du 3 &#39;(souligné) représente l&#39;amorce commune flanquant le code à barres uptag et est nécessaire pour amplifier le code-barres de la levure. Dans BAS-tag apprêt séquences 5 &#39;queue est identique à 5&#39; queue de l&#39;UP-tag amorces (Illumina séquence spécifique), cependant, la 3 &#39;de la queue (souligné) est remplacé par les amorces communs qui sont utilisés pour amplifier le BAS- tag codes à barres.

competitive genomic screens of barcoded yeast libraries

En vertu de progrès dans les technologies de prochaine génération de séquençage, nous avons accès à de nouvelles séquences du génome presque quotidiennement. Le tempo de ces avances est l&#39;accélération, en promettant une plus grande profondeur et la largeur. À la lumière de ces avancées extraordinaires, le besoin de méthodes rapides, parallèlement à définir la fonction des gènes devient de plus en plus important. Les collections de mutants de délétion du génome entier dans les levures et E. coli ont servi comme bêtes de somme pour la caractérisation fonctionnelle de la fonction des gènes, mais cette approche n&#39;est pas extensible, le courant de gènes de suppression des approches nécessitent chacune des milliers de gènes qui composent un génome à être supprimé et vérifiées. C&#39;est seulement après ce travail est terminé nous pouvons poursuivre le phénotypage à haut débit. Au cours des dix dernières années, notre laboratoire a affiné un portefeuille de la concurrence, miniaturisé et à haut débit l&#39;ensemble du génome des dosages qui peuvent être effectuées en parallèle. Cette parallélisation est possible en raison de l&#39;inclusion des «balises» de l&#39;ADN, ou «code-barres,&quot; dans chaque mutant, avec le code à barres servant de proxy pour la mutation et l&#39;on peut mesurer l&#39;abondance de codes à barres pour évaluer l&#39;aptitude de mutants. Dans cette étude, nous cherchons à combler le fossé entre la séquence d&#39;ADN et de code-barres collections de mutants. Pour ce faire, nous introduisons un transposon combinés des perturbations-barcoding approche qui ouvre de tests de codes à barres parallèles à nouveau séquencé, mais mal caractérisé les microbes. Pour illustrer cette approche, nous présentons une nouvelle collection de Candida albicans perturbations code-barres et décrire comment les deux basé sur un microréseau et la prochaine génération de plates-formes basées séquençage peut être utilisé pour collecter 10.000 - 1.000.000 gène-gène et gène-médicament interactions en une seule expérience.

Watch this Scientific Journal Video about Competitive Genomic Screens of Barcoded Yeast Libraries at JoVE.com

Competitive Genomic Screens of Barcoded Yeast Libraries

Nous avons développé complètes, impartiales échelle du génome écrans à comprendre gène-médicament et les interactions gènes-environnement. Méthodes de dépistage de ces collections de mutants sont présentées.

Écrans concurrentiel des bibliothèques génomiques de levure Barcoded

By virtue of advances in next generation sequencing technologies, we have access to new genome sequences almost daily.  The tempo of these advances is ...

competitive-genomic-screens-of-barcoded-yeast-libraries

Research

JoVE Journal

Biology

18.1K vues.  University of Toronto. Nous avons développé complètes, impartiales échelle du génome écrans à comprendre gène-médicament et les interactions gènes-environnement. Méthodes de dépistage de ces collections de mutants sont présentées.

Vidéo: Competitive Genomic Screens of Barcoded Yeast Libraries

Large-Scale Screens of Metagenomic Libraries

Metagenomic libraries archive large fragments of contiguous genomic sequences from microorganisms without requiring prior cultivation. Generating a streamlined procedure for creating and screening metagenomic libraries is therefore useful for efficient high-throughput investigations into the genetic and metabolic properties of uncultured microbial assemblages. Here, key protocols are presented on video, which we propose is the most useful format for accurately describing a long process that alternately depends on robotic instrumentation and (human) manual interventions. First, we employed robotics to spot library clones onto high-density macroarray membranes, each of which can contain duplicate colonies from twenty-four 384-well library plates. Automation is essential for this procedure not only for accuracy and speed, but also due to the miniaturization of scale required to fit the large number of library clones into highly dense spatial arrangements. Once generated, we next demonstrated how the macroarray membranes can be screened for genes of interest using modified versions of standard protocols for probe labeling, membrane hybridization, and signal detection. We complemented the visual demonstration of these procedures with detailed written descriptions of the steps involved and the materials required, all of which are available online alongside the video.

Grands écrans des banques métagénomiques

Metagenomic libraries archive large fragments of contiguous genomic sequences from microorganisms without requiring prior cultivation.  Generating a ...

Recherche

Biologie

Isolation of Genomic DNA from Mouse Tails

Isolement de l&#39;ADN génomique de souris Tails

Large Insert Environmental Genomic Library Production

The vast majority of microbes in nature currently remain inaccessible to traditional cultivation methods. Over the past decade, culture-independent environmental genomic (i.e. metagenomic) approaches have emerged, enabling researchers to bridge this cultivation gap by capturing the genetic content of indigenous microbial communities directly from the environment. To this end, genomic DNA libraries are constructed using standard albeit artful laboratory cloning techniques. Here we describe the construction of a large insert environmental genomic fosmid library with DNA derived from the vertical depth continuum of a seasonally hypoxic fjord. This protocol is directly linked to a series of connected protocols including coastal marine water sampling [1], large volume filtration of microbial biomass [2] and a DNA extraction and purification protocol [3]. At the outset, high quality genomic DNA is end-repaired with the creation of 5 -phosphorylated blunt ends. End-repaired DNA is subjected to pulsed-field gel electrophoresis (PFGE) for size selection and gel extraction is performed to recover DNA fragments between 30 and 60 thousand base pairs (Kb) in length. Size selected DNA is purified away from the PFGE gel matrix and ligated to the phosphatase-treated blunt-end fosmid CopyControl vector pCC1 (EPICENTRE <a href="http://www.epibio.com/item.asp?ID=385">http://www.epibio.com/item.asp?ID=385</a>). Linear concatemers of pCC1 and insert DNA are subsequently headfull packaged into phage particles by lambda terminase, with subsequent infection of phage-resistant E. coli cells. Successfully transduced clones are recovered on LB agar plates under antibiotic selection and archived in 384-well plate format using an automated colony picking robot (Qpix2, GENETIX). The current protocol draws from various sources including the CopyControl Fosmid Library Production Kit from EPICENTRE and the published works of multiple research groups [4-7]. Each step is presented with best practice in mind. Whenever possible we highlight subtleties in execution to improve overall quality and efficiency of library production. The whole process of fosmid library production and automated colony picking takes at least 7-10 days as there are many incubation steps included. However, there are several stopping points possible which are mentioned within the protocol.

Construction of a fosmid library with environmental genomic DNA isolated from the vertical depth continuum of a seasonally hypoxic fjord is described. The resulting clone library is picked into 384-well plates and archived for downstream sequencing and functional screening by the application of an automated colony picking system.

Grand Insérer production bibliothèque génomique de l&#39;environnement

The vast majority of microbes in nature currently remain inaccessible to traditional cultivation methods. Over the past decade, culture-independent ...

Purification of Mitochondria from Yeast Cells

Mitochondria are the main site of ATP production during aerobic metabolism in eukaryotic non-photosynthetic cells1. These complex organelles also play essential roles in apoptotic cell death2, cell survival3, mammalian development4, neuronal development and function4, intracellular signalling5, and longevity regulation6. Our understanding of these complex biological processes controlled by mitochondria relies on robust methods for assessing their morphology, their protein and lipid composition, the integrity of their DNA, and their numerous vital functions. The budding yeast Saccharomyces cerevisiae, a genetically and biochemically manipulable unicellular eukaryote with annotated genome and well-defined proteome, is a valuable model for studying the molecular and cellular mechanisms underlying essential biological functions of mitochondria. For these types of studies, it is crucial to have highly pure mitochondria. Here we present a detailed description of a rapid and effective method for purification of yeast mitochondria. This method enables the isolation of highly pure mitochondria that are essentially free of contamination by other organelles and retain their structural and functional integrity after their purification. Mitochondria purified by this method are suitable for cell-free reconstitution of essential mitochondrial processes and can be used for the analysis of mitochondrial structure and functions, mitochondrial proteome and lipidome, and mitochondrial DNA.

We describe a rapid and effective method for purification of mitochondria from the yeast Saccharomyces cerevisiae. This method enables the high-yield isolation of pure mitochondria that are essentially free of contamination by other organelles and retain their structural and functional integrity after their purification.

Purification des mitochondries de cellules de levure

Mitochondria are the main site of ATP production during aerobic metabolism in eukaryotic non-photosynthetic cells1. These complex organelles also play ...

Development of automated imaging and analysis for zebrafish chemical screens.

We demonstrate the application of image-based high-content screening (HCS) methodology to identify small molecules that can modulate the FGF/RAS/MAPK pathway in zebrafish embryos. The zebrafish embryo is an ideal system for in vivo high-content chemical screens. The 1-day old embryo is approximately 1mm in diameter and can be easily arrayed into 96-well plates, a standard format for high throughput screening. During the first day of development, embryos are transparent with most of the major organs present, thus enabling visualization of tissue formation during embryogenesis. The complete automation of zebrafish chemical screens is still a challenge, however, particularly in the development of automated image acquisition and analysis. We previously generated a transgenic reporter line that expresses green fluorescent protein (GFP) under the control of FGF activity and demonstrated their utility in chemical screens 1. To establish methodology for high throughput whole organism screens, we developed a system for automated imaging and analysis of zebrafish embryos at 24-48 hours post fertilization (hpf) in 96-well plates 2. In this video we highlight the procedures for arraying transgenic embryos into multiwell plates at 24hpf and the addition of a small molecule (BCI) that hyperactivates FGF signaling 3. The plates are incubated for 6 hours followed by the addition of tricaine to anesthetize larvae prior to automated imaging on a Molecular Devices ImageXpress Ultra laser scanning confocal HCS reader. Images are processed by Definiens Developer software using a Cognition Network Technology algorithm that we developed to detect and quantify expression of GFP in the heads of transgenic embryos. In this example we highlight the ability of the algorithm to measure dose-dependent effects of BCI on GFP reporter gene expression in treated embryos.

We report the development of a system for automated imaging and analysis of zebrafish transgenic embryos in multiwell plates. This demonstrates the ability to measure dose dependent effects of a small molecule, BCI, on Fibroblast Growth Factor reporter gene expression and provide technology for establishing high-throughput zebrafish chemical screens.

Développement de l&#39;imagerie automatisée et d&#39;analyse pour les écrans chimiques du poisson zèbre.

We demonstrate the application of image-based high-content screening (HCS) methodology to identify small molecules that can modulate the FGF/RAS/MAPK ...

Yeast Colony Embedding Method

Patterning of different cell types in embryos is a key mechanism in metazoan development. Communities of microorganisms, such as colonies and biofilms also display patterns of cell types. For example, in the yeast S. cerevisiae, sporulated cells and pseudohyphal cells are not uniformly distributed in colonies. The functional importance of patterning and the molecular mechanisms that underlie these patterns are still poorly understood.
One challenge with respect to investigating patterns of cell types in fungal colonies is that unlike metazoan tissue, cells in colonies are relatively weakly attached to one another. In particular, fungal colonies do not contain the same extensive level of extracellular matrix found in most tissues . Here we report on a method for embedding and sectioning yeast colonies that reveals the interior patterns of cell types in these colonies. The method can be used to prepare thick sections (0.5 &mu;) useful for light microscopy and thin sections (0.1 &mu;) suitable for transmission electron microscopy. Asci and pseudohyphal cells can easily be distinguished from ovoid yeast cells by light microscopy , while the interior structure of these cells can be visualized by EM.
The method is based on surrounding colonies with agar, infiltrating them with Spurr's medium, and then sectioning. Colonies with a diameter in the range of 1-2 mm are suitable for this protocol. In addition to visualizing the interior of colonies, the method allows visualization of the region of the colony that invades the underlying agar.

A method for embedding yeast colonies allowing sectioning for light and electron microscopy. This protocol allows determination of the distribution of sporulated cells and pseudohyphal cells within colonies providing a new tool toward understanding the organization of cell types within a fungal community.

Méthode d&#39;insertion de levure Colony

Patterning of  different cell types in embryos is a key mechanism in metazoan development. Communities of microorganisms, such as colonies and biofilms ...

Genomic MRI - a Public Resource for Studying Sequence Patterns within Genomic DNA

Non-coding genomic regions in complex eukaryotes, including intergenic areas, introns, and untranslated segments of exons, are profoundly non-random in their nucleotide composition and consist of a complex mosaic of sequence patterns. These patterns include so-called Mid-Range Inhomogeneity (MRI) regions -- sequences 30-10000 nucleotides in length that are enriched by a particular base or combination of bases (e.g. (G+T)-rich, purine-rich, etc.). MRI regions are associated with unusual (non-B-form) DNA structures that are often involved in regulation of gene expression, recombination, and other genetic processes (Fedorova &amp; Fedorov 2010). The existence of a strong fixation bias within MRI regions against mutations that tend to reduce their sequence inhomogeneity additionally supports the functionality and importance of these genomic sequences (Prakash et al. 2009).
Here we demonstrate a freely available Internet resource -- the Genomic MRI program package -- designed for computational analysis of genomic sequences in order to find and characterize various MRI patterns within them (Bechtel et al. 2008). This package also allows generation of randomized sequences with various properties and level of correspondence to the natural input DNA sequences. The main goal of this resource is to facilitate examination of vast regions of non-coding DNA that are still scarcely investigated and await thorough exploration and recognition.

We present a public computational web site for the analysis of genomic sequences. It detects DNA sequence patterns with various non-random nucleotide compositions. This resource also generates randomized sequences with diverse levels of complexity.

Genomic IRM - une ressource publique pour l&#39;étude des schémas de séquence dans l&#39;ADN génomique

Non-coding genomic regions in complex eukaryotes, including intergenic areas, introns, and untranslated segments of exons, are profoundly non-random in ...

Genomic Transformation of the Picoeukaryote Ostreococcus tauri

Common problems hindering rapid progress in Plant Sciences include cellular, tissue and whole organism complexity, and notably the high level of genomic redundancy affecting simple genetics in higher plants. The novel model organism Ostreococcus tauri is the smallest free-living eukaryote known to date, and possesses a greatly reduced genome size and cellular complexity1,2, manifested by the presence of just one of most organelles (mitochondrion, chloroplast, golgi stack) per cell, and a genome containing only ~8000 genes. Furthermore, the combination of unicellularity and easy culture provides a platform amenable to chemical biology approaches. Recently, Ostreococcus has been successfully employed to study basic mechanisms underlying circadian timekeeping3-6. Results from this model organism have impacted not only plant science, but also mammalian biology7. This example highlights how rapid experimentation in a simple eukaryote from the green lineage can accelerate research in more complex organisms by generating testable hypotheses using methods technically feasible only in this background of reduced complexity. Knowledge of a genome and the possibility to modify genes are essential tools in any model species. Genomic1, Transcriptomic8, and Proteomic9 information for this species is freely available, whereas the previously reported methods6,10 to genetically transform Ostreococcus are known to few laboratories worldwide.
In this article, the experimental methods to genetically transform this novel model organism with an overexpression construct by means of electroporation are outlined in detail, as well as the method of inclusion of transformed cells in low percentage agarose to allow selection of transformed lines originating from a single transformed cell. Following the successful application of Ostreococcus to circadian research, growing interest in Ostreococcus can be expected from diverse research areas within and outside plant sciences, including biotechnological areas. Researchers from a broad range of biological and medical sciences that work on conserved biochemical pathways may consider pursuing research in Ostreococcus, free from the genomic and organismal complexity of larger model species.

Genomic Transformation of the Picoeukaryote Ostreococcus tauri

This article describes genetic transformation of the unicellular marine alga Ostreococcus tauri by electroporation. This eukaryotic organism is an effective model platform for higher plants, possesing greatly reduced genomic and cellular complexity and being readily amenable to both cell culture and chemical biology.

Transformation génomique de la Picoeukaryote<em&gt; Ostreococcus tauri</em

Common problems hindering rapid progress in Plant Sciences include cellular, tissue and whole organism complexity, and notably the high level of genomic ...

Selective Capture of 5-hydroxymethylcytosine from Genomic DNA

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene expression, maintenance of genome integrity, parental imprinting, X-chromosome inactivation, regulation of development, aging, and cancer1. Recently, the presence of an oxidized 5-mC, 5-hydroxymethylcytosine (5-hmC), was discovered in mammalian cells, in particular in embryonic stem (ES) cells and neuronal cells2-4. 5-hmC is generated by oxidation of 5-mC catalyzed by TET family iron (II)/&alpha;-ketoglutarate-dependent dioxygenases2, 3. 5-hmC is proposed to be involved in the maintenance of embryonic stem (mES) cell, normal hematopoiesis and malignancies, and zygote development2, 5-10. To better understand the function of 5-hmC, a reliable and straightforward sequencing system is essential. Traditional bisulfite sequencing cannot distinguish 5-hmC from 5-mC11. To unravel the biology of 5-hmC, we have developed a highly efficient and selective chemical approach to label and capture 5-hmC, taking advantage of a bacteriophage enzyme that adds a glucose moiety to 5-hmC specifically12.
Here we describe a straightforward two-step procedure for selective chemical labeling of 5-hmC. In the first labeling step, 5-hmC in genomic DNA is labeled with a 6-azide-glucose catalyzed by &beta;-GT, a glucosyltransferase from T4 bacteriophage, in a way that transfers the 6-azide-glucose to 5-hmC from the modified cofactor, UDP-6-N3-Glc (6-N3UDPG). In the second step, biotinylation, a disulfide biotin linker is attached to the azide group by click chemistry. Both steps are highly specific and efficient, leading to complete labeling regardless of the abundance of 5-hmC in genomic regions and giving extremely low background. Following biotinylation of 5-hmC, the 5-hmC-containing DNA fragments are then selectively captured using streptavidin beads in a density-independent manner. The resulting 5-hmC-enriched DNA fragments could be used for downstream analyses, including next-generation sequencing.
Our selective labeling and capture protocol confers high sensitivity, applicable to any source of genomic DNA with variable/diverse 5-hmC abundances. Although the main purpose of this protocol is its downstream application (i.e., next-generation sequencing to map out the 5-hmC distribution in genome), it is compatible with single-molecule, real-time SMRT (DNA) sequencing, which is capable of delivering single-base resolution sequencing of 5-hmC.

Described is a two-step labeling process using &beta;-glucosyltransferase (&beta;-GT) to transfer an azide-glucose to 5-hmC, followed by click chemistry to transfer a biotin linker for easy and density-independent enrichment. This efficient and specific labeling method enables enrichment of 5-hmC with extremely low background and high-throughput epigenomic mapping via next-generation sequencing.

Capture d&#39;sélectif de 5-hydroxyméthylcytosine partir de l&#39;ADN génomique

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene ...

Assessing Differences in Sperm Competitive Ability in Drosophila

Competition among conspecific males for fertilizing the ova is one of the mechanisms of sexual selection, i.e. selection that operates on maximizing the number of successful mating events rather than on maximizing survival and viability 1. Sperm competition represents the competition between males after copulating with the same female 2, in which their sperm are coincidental in time and space. This phenomenon has been reported in multiple species of plants and animals 3. For example, wild-caught D. melanogaster females usually contain sperm from 2-3 males 4. The sperm are stored in specialized organs with limited storage capacity, which might lead to the direct competition of the sperm from different males 2,5.
Comparing sperm competitive ability of different males of interest (experimental male types) has been performed through controlled double-mating experiments in the laboratory 6,7. Briefly, a single female is exposed to two different males consecutively, one experimental male and one cross-mating reference male. The same mating scheme is then followed using other experimental male types thus facilitating the indirect comparison of the competitive ability of their sperm through a common reference. The fraction of individuals fathered by the experimental and reference males is identified using markers, which allows one to estimate sperm competitive ability using simple mathematical expressions 7,8. In addition, sperm competitive ability can be estimated in two different scenarios depending on whether the experimental male is second or first to mate (offense and defense assay, respectively) 9, which is assumed to be reflective of different competence attributes.
Here, we describe an approach that helps to interrogate the role of different genetic factors that putatively underlie the phenomenon of sperm competitive ability in D. melanogaster.

Assessing Differences in Sperm Competitive Ability in Drosophila

Differential sperm competitive ability among Drosophila males with distinct genotypes can be ascertained through double-mating experiments. Each of these experiments involves one of the males of interest and a reference male. Readily identifiable markers in the progeny allow inference of the fraction of individuals fathered by each male.

Différences Évaluation de la capacité concurrentielle de sperme dans<em&gt; Drosophila</em

Competition among conspecific males for fertilizing the ova is one of the mechanisms of sexual selection, i.e. selection that operates on maximizing the ...