Ringraziamo Ron Davis, Adam Deutschbauer, e l&#39;intero laboratorio HIP HOP presso l&#39;Università di Toronto per le discussioni e consigli. NC è sostenuto da finanziamenti della National Human Genome Research Institute (Grant Numero HG000205), RO1 HG003317, CIHR MOP-84305, e Canadian Cancer Society (# 020380). JO è stato sostenuto dal Programma di Stanford Formazione Genoma (Grant Numero T32 HG00044 dal National Human Genome Research Institute) e il National Institutes of Health (Grant Numero P01 GH000205). GG è supportato dal RO1 NHGRI HG003317 e la Canadian Cancer Society, Grant # 020380, TD e il Donnelly Sequencing Center è sostenuto in parte da finanziamenti della Fondazione canadese per l&#39;innovazione di Drs. Brenda e Jack Andrews Greenblatt. AMS è supportato da una borsa di studio dell&#39;Università di Toronto Open.

<ol>
	<li>Giaever, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+profiling+of+the+Saccharomyces+cerevisiae+genome.">Functional profiling of the Saccharomyces cerevisiae genome.</a> Nature. 418, 387-391 (2002).</li><li>Baba, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Molecular systems biology. 2, 2006.0008-2006.0008 (2006).</li><li>Claus, H., Frosch, M., Vogel, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+hotspot+for+transformation+of+Neisseria+meningitidis+by+shuttle+mutagenesis+using+signature-tagged+transposons.">Identification of a hotspot for transformation of Neisseria meningitidis by shuttle mutagenesis using signature-tagged transposons.</a> Mol Gen Genet. 259, 363-371 (1998).</li><li>Hava, D. L., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-scale+identification+of+serotype+4+Streptococcus+pneumoniae+virulence+factors.">Large-scale identification of serotype 4 Streptococcus pneumoniae virulence factors.</a> Molecular microbiology. 45, 1389-1406 (2002).</li><li>Costanzo, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Genetic+Landscape+of+a+Cell.">The Genetic Landscape of a Cell.</a> Science. 327, 425-431 (2010).</li><li>Tong, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+genetic+analysis+with+ordered+arrays+of+yeast+deletion+mutants.">Systematic genetic analysis with ordered arrays of yeast deletion mutants.</a> Science. 294, 2364-2368 (2001).</li><li>Pan, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+robust+toolkit+for+functional+profiling+of+the+yeast+genome.">A robust toolkit for functional profiling of the yeast genome.</a> Molecular cell. 16, 487-496 (2004).</li><li>Schuldiner, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploration+of+the+Function+and+Organization+of+the+Yeast+Early+Secretory+Pathway+through+an+Epistatic+Miniarray+Profile.">Exploration of the Function and Organization of the Yeast Early Secretory Pathway through an Epistatic Miniarray Profile.</a> Cell. 123, 507-519 (2005).</li><li>Deutschbauer, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+haploinsufficiency+revealed+by+genome-wide+profiling+in+yeast.">Mechanisms of haploinsufficiency revealed by genome-wide profiling in yeast.</a> Genetics. 169, 1915-1925 (2005).</li><li>Giaever, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemogenomic+profiling:+identifying+the+functional+interactions+of+small+molecules+in+yeast.">Chemogenomic profiling: identifying the functional interactions of small molecules in yeast.</a> Proceedings of the National Academy of Sciences of the United States of America. 101, 793-798 (2004).</li><li>Lum, P. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovering+modes+of+action+for+therapeutic+compounds+using+a+genome-wide+screen+of+yeast+heterozygotes.">Discovering modes of action for therapeutic compounds using a genome-wide screen of yeast heterozygotes.</a> Cell. 116, 121-137 (2004).</li><li>Hillenmeyer, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+chemical+genomic+portrait+of+yeast:+uncovering+a+phenotype+for+all+genes.">The chemical genomic portrait of yeast: uncovering a phenotype for all genes.</a> Science. 320, 362-365 (2008).</li><li>Oh, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+universal+TagModule+collection+for+parallel+genetic+analysis+of+microorganisms.">A universal TagModule collection for parallel genetic analysis of microorganisms.</a> Nucleic acids research. 38, e146-e146 (2010).</li><li>Oh, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+annotation+and+drug+target+discovery+in+Candida+albicans+with+a+tagged+transposon+mutant+collection.">Gene annotation and drug target discovery in Candida albicans with a tagged transposon mutant collection.</a> PLoS pathogens. 6, (2010).</li><li>Nislow, C., Giaever, G., Stark, I., Stansfields, M. J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chapter+387.">Chapter 387.</a> Yeast Gene Analysis. , 387-414 (2007).</li><li>Pierce, S. E., Davis, R. W., Nislow, C., Giaever, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+of+barcoded+Saccharomyces+cerevisiae+gene-deletion+mutants+in+pooled+cultures.">Genome-wide analysis of barcoded Saccharomyces cerevisiae gene-deletion mutants in pooled cultures.</a> Nature protocols. 2, 2958-2974 (2007).</li><li>Sambrook, J., Russell, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning : a laboratory manual. , (2001).</li><li>Smith, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+phenotyping+via+deep+barcode+sequencing.">Quantitative phenotyping via deep barcode sequencing.</a> Genome Res. , (2009).</li><li>Hamady, M., Walker, J. J., Harris, J. K., Gold, N. J., Knight, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Error-correcting+barcoded+primers+for+pyrosequencing+hundreds+of+samples+in+multiplex.">Error-correcting barcoded primers for pyrosequencing hundreds of samples in multiplex.</a> Nature. 5, 235-237 (2008).</li><li>Gresham, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=System-Level+Analysis+of+Genes+and+Functions+Affecting+Survival+During+Nutrient+Starvation+in+Saccharomyces+cerevisiae.">System-Level Analysis of Genes and Functions Affecting Survival During Nutrient Starvation in Saccharomyces cerevisiae.</a> Genetics. 187, 299-317 (2011).</li></ol>

Nessun conflitto di interessi dichiarati.

Qui, abbiamo delineato un protocollo che, con modeste modifiche, può essere facilmente adattato ad una vasta gamma di collezioni esistenti di codici a barre collezioni mutante di microrganismi diversi per creare tag collezioni mutante. Sottolineiamo che, mentre noi abbiamo riportato un protocollo di mutagenesi trasposone tag per i patogeni lievito C. albicans, un protocollo molto simile potrebbe essere adattato ad una grande varietà di funghi unicellulari. Modificato, questo protocollo funziona bene nei batteri 13, e attualmente collezioni per una serie di ulteriori genomi fungini e batterici sono in costruzione. Al momento, questo test fornisce l&#39;unica completa, genome-wide a schermo imparziali per gene-piccole interazioni molecola. Una caratteristica particolarmente interessante del saggio è che nessuna conoscenza preliminare del gene o piccola molecola è richiesto. Nonostante la portata e la potenza di questi test, la loro trasferibilità in altri laboratori è stato ostacolato in qualche modo con l&#39;investimento di capitale iniziale e gli strumenti informatici per l&#39;analisi dei risultati. Con l&#39;adozione di una lettura prossima sequenza di generazione combinata con strumenti affidabili per l&#39;analisi, ci aspettiamo che la loro adozione ad aumentare.

<table border="1"><tbody><tr><td> Antibiotici </td><td> Vendor e catalogo numeri </td></tr><tr><td> Carbenicillina </td><td> Sigma, parte # C1613 </td></tr><tr><td> Kanamicina </td><td> Sigma, parte # K1876 </td></tr><tr><td> spectinomicina </td><td> Sigma, parte # S0692 </td></tr><tr><td> Cloramfenicolo </td><td> Sigma, parte # C0378 </td></tr><tr><td> DNA di pulizia e kit di concentrazione </td><td></td></tr><tr><td> QIAprep Spin Miniprep Kit </td><td> Qiagen, parte # 27106 </td></tr><tr><td> HiSpeed ​​Kit Maxi plasmidi </td><td> Qiagen, parte # 12663 </td></tr><tr><td> QIAquick PCR Purification Kit </td><td> Qiagen, parte # 28106 </td></tr><tr><td> QIAquick Gel Extraction Kit </td><td> Qiagen, parte # 28704 </td></tr><tr><td> PCR e reagenti elettroforesi </td><td></td></tr><tr><td> Taq DNA polimerasi (Mg-free) Buffer </td><td> New England Biolabs, parte # M0320L </td></tr><tr><td> Soluzione Mix desossinucleotide </td><td> New England Biolabs, parte # N0447L </td></tr><tr><td> 25 mM MgCl 2 </td><td> Sigma, parte # 63036 </td></tr><tr><td> Agarosio, carico colorante e acido nucleico macchia adatto per elettroforesi su gel </td><td> Vari </td></tr><tr><td> 10X tampone TAE </td><td> Sigma, parte # T8280 </td></tr><tr><td> 1 Kb Inoltre DNA Ladder </td><td> Invitrogen, parte # 10787026 </td></tr><tr><td> YPD brodo </td><td></td></tr><tr><td> 10 g di estratto di lievito </td><td> Sigma, parte # Y1625 </td></tr><tr><td> 20 g Bacto peptone </td><td> BD Biosciences, parte # 211677 </td></tr><tr><td> 20 g di destrosio </td><td> Sigma, parte # D9434 </td></tr><tr><td> Da laboratorio </td><td></td></tr><tr><td> Pipette multicanale (1000, 200, e 20 mL) </td><td> Vari </td></tr><tr><td> Monouso serbatoi pipettaggio </td><td> Vari </td></tr><tr><td> 15 e 50 provette ml </td><td> Vari </td></tr><tr><td> 96 - e pozzetti 384-pozzo profondo </td><td> Axygen Scientifico, parte # P-2ML-SQ-CS &amp; P-384240SQCS </td></tr><tr><td> 96-bene e 384 pozzetti PCR e film di tenuta </td><td> Vari </td></tr><tr><td> Rullo di lamiera per la sigillatura a più pozzetti </td><td> Sigma, parte # R1275 </td></tr><tr><td> 30 ° C e 37 ° C agitando incubatori per la crescita di batteri e lieviti su piastre e tubi </td><td> Vari </td></tr><tr><td> In vitro trasposone mutagenesi </td><td></td></tr><tr><td> EZ-Tn5 trasposasi </td><td> Biotecnologie Epicentre, parte # TNP92110 </td></tr><tr><td> High-throughput trasformazione </td><td></td></tr><tr><td> Seqprep 96 HT Prep Kit plasmidi </td><td> Bordo Biosystems, parte # 84359 </td></tr><tr><td> polietilene glicole, peso molecolare 3350 </td><td> Vari </td></tr><tr><td> acetato di litio </td><td> Sigma, parte # 517992 </td></tr><tr><td> 6-pozzetti, sterile </td><td> Corning, parte # 3335 </td></tr><tr><td> 50 mg / ml uridina </td><td> Sigma, parte # U3750 </td></tr><tr><td> 100X Tris-EDTA soluzione tampone </td><td> Sigma, parte # T9285 </td></tr><tr><td> 1X TE/0.1M LiOAc </td><td> Vari </td></tr><tr><td> salmone testicolo DNA </td><td> Sigma, parte # 1626 </td></tr><tr><td> La crescita delle collezioni barcode </td><td></td></tr><tr><td> 48-pozzetti, qualora la crescita culture in lastre </td><td> Greiner, parte # M9437 </td></tr><tr><td> Sigillante adesivo </td><td> ABgene, parte # AB-0580 </td></tr><tr><td> 200 mL cultura fiaschi </td><td> Vari </td></tr><tr><td> Spettrofotometro in grado di assorbanza </td><td> Vari </td></tr><tr><td> A temperatura controllata shaker per 250 ml o palloni spettrofotometro agitazione </td><td> Vari </td></tr><tr><td> Safe-Lock provetta, 2 ml </td><td> Eppendorf, parte # 0030 120.094 </td></tr><tr><td> Ibridazione attrezzature </td><td></td></tr><tr><td> Ibridazione Forno 640 </td><td> Affymetrix, parte # 800138 </td></tr><tr><td> GeneChip fluidico Stazione 450 </td><td> Affymetrix, parte # 00-0079 </td></tr><tr><td> GeneArray Scanner 3000 </td><td> Affymetrix, parte # 00-0212 </td></tr><tr><td> Bagno di acqua bollente con cremagliera galleggiante </td><td> Vari </td></tr><tr><td> Ibridazione di consumo </td><td></td></tr><tr><td> Genflex Tag 16K Array v2 </td><td> Affymetrix, parte # 511331 </td></tr><tr><td> Soluzione Denhardt, il concentrato di 50X </td><td> Sigma, parte # D2532 </td></tr><tr><td> Streptavidina, R-ficoeritrina coniugato (SAPE) </td><td> Invitrogen, parte # S866 </td></tr><tr><td> Safe-Lock provetta, 0,5 ml </td><td> Eppendorf, parte # 0030 123.301 </td></tr><tr><td> Teeny Tough-Spots </td><td> Diversificato Biotech, parte # LTTM-1000 </td></tr><tr><td> 0,5 M EDTA </td><td> BioRad, parte # 161-0729 </td></tr><tr><td> 10% Tween </td><td> Sigma, parte # T2700 </td></tr><tr><td> MES monoidrato acido libero </td><td> Sigma, parte # M5287 </td></tr><tr><td> MES sale di sodio </td><td> Sigma, parte # M5057 </td></tr><tr><td> 5 M NaCl </td><td> Sigma, parte # 71386 </td></tr><tr><td> 20X SSPE </td><td> Sigma, parte # S2015 </td></tr><tr><td> Biologia molecolare acqua grado </td><td> Sigma, parte # W4502 </td></tr><tr><td> Ibridazione Primer </td><td> Vari fornitori (dissalazione di serie) </td></tr><tr><td> Uptag </td><td> 5 &#39;GATGTCCACGAGGTCTCT 3&#39; </td></tr><tr><td> Buptagkanmx4 </td><td> 5 &#39;biotina-GTCGACCTGCAGCGTACG 3&#39; </td></tr><tr><td> Dntag </td><td> 5 &#39;CGGTGTCGGTCTCGTAG 3&#39; </td></tr><tr><td> Bdntagkanmx4 </td><td> 5 &#39;biotina-GAAAACGAGCTCGAATTCATCG 3&#39; </td></tr><tr><td> B213 </td><td> 5 &#39;biotina-CTGAACGGTAGCATCTTGAC 3&#39; </td></tr><tr><td> Uptagkanmx </td><td> 5 &#39;GTCGACCTGCAGCGTACG 3&#39; </td></tr><tr><td> Dntagkanmx </td><td> 5&#39;GAAAACGAGCTCGAATTCATCG 3 &#39; </td></tr><tr><td> Uptagcomp </td><td> 5&#39;AGAGACCTCGTGGACATC 3 &#39; </td></tr><tr><td> Dntagcomp </td><td> 5&#39;CTACGAGACCGACACCG 3 &#39; </td></tr><tr><td> Upkancomp </td><td> 5&#39;CGTACGCTGCAGGTCGAC 3 &#39; </td></tr><tr><td> Dnkancomp </td><td> 5&#39;CGATGAATTCGAGCTCGTTTTC 3 &#39; </td></tr><tr><td> Sequencing Primer: Piattaforma Illumina </td><td> Vari fornitori </td></tr><tr><td> UpTag Avanti (100um) </td><td> 5 &#39;CAA GCA GAA GAC GGC ATA CGA GCT CTT CCG ATC T GAT GTC CAC GAG GTC TCT 3&#39; </td></tr><tr><td> UpTag Reverse (100um) </td><td> 5 &#39;AAT GAT ACG GCG ACC ACC GAC ACT CTT CCT CTA CAC GAC GCT CTT CCG ATC T NNNNN GTC GAC CTG CAG CGT ACG 3&#39; </td></tr><tr><td> DownTag Avanti (100um) </td><td> 5 &#39;CAA GCA GAA GAC GGC ATA CGA GCT CTT CCG ATC T GAA AAC GAG CTC GAA TTC ATC G 3&#39; </td></tr><tr><td> DownTag Reverse (100um) </td><td> 5 &#39;AAT GAT ACG GCG ACC ACC GAC ACT CTT CCT CTA CAC GAC GCT CTT CCG ATC T NNNNN CGG TGT CGG TCT CGT AG 3 ` </td></tr><tr><td> Leggi 1 UP-tag seguenti primer (100um) </td><td> 5 &#39;GTC GAC CTG CAG CGT ACG 3&#39; </td></tr><tr><td> Leggi 1 GIU-tag Primer seq (100um) </td><td> 5 &#39;CGG TGT CGG TCT CGT AG 3&#39; </td></tr><tr><td> Leggi 2 Primer Sequencing Index (standard Illumina fondo R1) (100um) </td><td> 5 &#39;AC ATTO CTT CCT CTA CAC GAC GCT CTT CCG ATC T 3&#39; </td></tr><tr><td> Reagenti Sequencing Ulteriori / attrezzature </td><td></td></tr><tr><td> Qiagen MinElute 96 UF Kit di purificazione PCR </td><td> Qiagen, parte # 29051 </td></tr><tr><td> Pompa del vuoto </td><td> Qualsiasi fornitore </td></tr><tr><td> Macherey-Nagel Vacuum Manifold </td><td> Macherey-Nagel, parte # 740 681 </td></tr><tr><td> Invitrogen Quant-iT dsDNA BR Assay Kit </td><td> Invitrogen, parte # Q32853 </td></tr><tr><td> Invitrogen Qubit saggio tubi </td><td> Invitrogen, parte # Q32856 </td></tr><tr><td> Acrilamide 40% più 1% di N, N&#39;-metilene-bis-acrilamide, 37.5:1 </td><td> Bio Rad, part # 161-0148 </td></tr><tr><td> Tris Base </td><td> Sigma, parte # T1503-1KG </td></tr><tr><td> Acido borico </td><td> Sigma, parte # B6768-500G </td></tr><tr><td> 0.5M EDTA, pH 8,0 </td><td> Teknova, parte # E0306 </td></tr><tr><td> Ammonio persolfato </td><td> Sigma, parte # A3678-25G </td></tr><tr><td> TEMED </td><td> Bioshop, parte # TEM001.25 </td></tr><tr><td> Bromuro di etidio Soluzione </td><td> Bioshop, parte # ETB444.10 </td></tr><tr><td> Ammonio acetato 0.5M </td><td> Teknova, parte # A2000 </td></tr><tr><td> 10mM acetato di magnesio tetraidrato </td><td> Sigma, parte # M0631-100G </td></tr><tr><td> 1mM EDTA, pH 8,0 </td><td> Vedi 0.5M EDTA, pH 8,0 </td></tr><tr><td> Etanolo </td><td> Vari </td></tr><tr><td> Di sodio acetato, pH 5,2 </td><td> Teknova, parte # S0297 </td></tr><tr><td> Velocità a vuoto </td><td> Vari </td></tr><tr><td> Leggi singolo cluster Kit Generation </td><td> Illumina, parte # GD-300-1001 </td></tr><tr><td> 36 quater Sequencing Kit v4 </td><td>Illumina, parte # FC-104-4002 </td></tr><tr><td></td><td></td></tr></tbody></table> TBE ricetta 10X <table border="1"><tbody><tr><td> Importi </td><td> Reagenti </td></tr><tr><td> 108 grammi </td><td> Tris Base </td></tr><tr><td> 55 grammi </td><td> Acido borico </td></tr><tr><td> 40ml </td><td> 0.5M EDTA (pH 8,0) </td></tr><tr><td colspan="2"> Aggiungi dH 2 O a 1L marchio </td></tr></tbody></table> 12% di poliacrilammide ricetta gel <table border="1"><tbody><tr><td> Volumi </td><td> Reagenti </td></tr><tr><td> 5,8 ml </td><td> Acrilamide 40% più 1% di N, N&#39;-metilene-bis-acrilamide, 37.5:1 </td></tr><tr><td> 12 ml </td><td> dH 2 O </td></tr><tr><td> 2 ml </td><td> TBE 10X </td></tr><tr><td> 140 microlitri </td><td> Persolfato di ammonio 10% </td></tr><tr><td> Volume totale: 20ml </td><td></td></tr></tbody></table> Uptag mix di fondo: Risospendere Uptag e Buptagkanmx4 ciascuno in DDH 2 O a 100 micron, quindi mescolare in un rapporto di 1:1 per una concentrazione finale di 50 micron ciascuna. Conservare a -20 ° C. Downtag mix di fondo: Risospendere Dntag e Bdntagkanmx4 ciascuno in DDH 2 O a 100 micron, quindi mescolare in un rapporto di 1:1 per una concentrazione finale di 50 micron ciascuna. Conservare a -20 ° C. Oligonucleotidi mista: Risospendere ciascuna delle seguenti otto oligos (standard dissalate) in DDH 2 O a 100 mM: Uptag, Dntag, Uptagkanmx, Dntagkanmx, Uptagcomp, Dntagcomp, Upkancomp, Dnkancomp. Mescolare un volume equivalente di otto oligonucleotidi per una concentrazione finale di 12,5 mM ciascuno. 12X MES magazzino: Per 10 ml, sciogliere 0,7 g monoidrato acido libero MES e 1,93 g di sale di sodio MES in 8 acqua biologia molecolare grado ml. Dopo aver mescolato bene, controllare il pH e regolare, se necessario, a pH 6,5-6,7. Aggiungere acqua per un volume totale di 10 ml. Filtro sterilizzare e conservare a 4 ° C al riparo dalla luce (ad esempio, avvolgere il tubo in alluminio). Sostituire se visibilmente soluzione diventa gialla o dopo 6 mesi. Ibridazione tampone 2X: Per 50 ml, miscelare 8,3 ml di 12X MES magazzino (dal 2.9.14), 17,7 ml di 5 M NaCl, 4,0 ml di 0.5 M EDTA, 0,1 ml di 10% di Tween 20 (vol / vol), e 19,9 ml di filtrato DDH 2 O. Filtro sterilizzare. Lavare A: Mescolare 300 ml 20X SSPE, 1 ml di Tween 10% (vol / vol), 699 ml di DDH 2 O. Filtro sterilizzare. Lavare B: Mescolare 150 ml 20X SSPE, 1 ml di Tween 10% (vol / vol), 849 ml di DDH 2 O. Filtro sterilizzare. Codice a barre sequenza primer In UP-tag sequenze primer 5 &#39;coda (in grassetto) sono Illumina sequenze specifico adattatore incorporato nel fondo F e R. La sequenza variabile (corsivo) rappresenta il 5-mer tag di indicizzazione utilizzato in multiplexing / index read-out. Coda di 3 &#39;(sottolineato) rappresenta l&#39;innesco comune che fiancheggiano il codice a barre uptag ed è necessario per amplificare i codici a barre lievito. In GIU-tag Primer sequenze 5 &#39;coda è identico a 5&#39; coda di UP-tag primer (Illumina sequenza specifica), tuttavia, il 3 &#39;coda (sottolineato), è sostituito con il primer comuni che vengono utilizzati per amplificare il DOWN- tag codici a barre.

competitive genomic screens of barcoded yeast libraries

In virtù dei progressi nelle tecnologie di sequenziamento di nuova generazione, abbiamo accesso alle sequenze del genoma nuovo quasi ogni giorno. Il tempo di questi progressi sta accelerando, promettendo una maggiore profondità e ampiezza. Alla luce di questi progressi straordinari, la necessità di una rapida, metodi paralleli per definire la funzione del gene diventa sempre più importante. Collezioni di genome-wide mutanti di delezione in lieviti ed E. coli sono serviti come cavalli da tiro per la caratterizzazione funzionale della funzione del gene, ma questo approccio non è scalabile, attuale gene-cancellazione approcci richiedono ciascuno delle migliaia di geni che costituiscono il genoma da eliminare e verificato. Solo dopo questo lavoro è completo possiamo perseguire high-throughput fenotipizzazione. Negli ultimi dieci anni, il nostro laboratorio ha perfezionato un portafoglio di competitivo, miniaturizzati, ad alta produttività genome-wide test che possono essere eseguite in parallelo. Questo parallelizzazione è possibile perché l&#39;inclusione dei &#39;tag&#39; del DNA, o &#39;codici a barre,&#39; in ogni mutante, con il codice a barre che funge da proxy per la mutazione e si può misurare l&#39;abbondanza di codici a barre per valutare idoneità mutante. In questo studio, cerchiamo di colmare il divario tra sequenza del DNA e codice a barre collezioni di mutanti. Per fare questo introduciamo un combinato trasposone interruzione-codici a barre approccio che apre saggi di codici a barre parallele di nuova sequenza, ma poco caratterizzato microbi. Per illustrare questo approccio vi presentiamo una nuova collezione di Candida albicans interruzione codice a barre e di descrivere come sia microarray-based e sequenziamento di nuova generazione basati su piattaforme possono essere utilizzate per raccogliere 10.000 - 1.000.000 gene-gene e le interazioni farmaco-gene in un singolo esperimento.

Watch this Scientific Journal Video about Competitive Genomic Screens of Barcoded Yeast Libraries at JoVE.com

Competitive Genomic Screens of Barcoded Yeast Libraries

Abbiamo sviluppato completa, imparziale genoma schermate per capire gene-farmaco e interazioni gene-ambiente. Metodi per lo screening queste collezioni mutanti sono presentati.

Schermi competitivo genomica delle Biblioteche di lievito con codice a barre

By virtue of advances in next generation sequencing technologies, we have access to new genome sequences almost daily.  The tempo of these advances is ...

competitive-genomic-screens-of-barcoded-yeast-libraries

Research

JoVE Journal

Biology

18.1K Views.  University of Toronto. Abbiamo sviluppato completa, imparziale genoma schermate per capire gene-farmaco e interazioni gene-ambiente. Metodi per lo screening queste collezioni mutanti sono presentati.

Video: Competitive Genomic Screens of Barcoded Yeast Libraries

Large-Scale Screens of Metagenomic Libraries

Metagenomic libraries archive large fragments of contiguous genomic sequences from microorganisms without requiring prior cultivation. Generating a streamlined procedure for creating and screening metagenomic libraries is therefore useful for efficient high-throughput investigations into the genetic and metabolic properties of uncultured microbial assemblages. Here, key protocols are presented on video, which we propose is the most useful format for accurately describing a long process that alternately depends on robotic instrumentation and (human) manual interventions. First, we employed robotics to spot library clones onto high-density macroarray membranes, each of which can contain duplicate colonies from twenty-four 384-well library plates. Automation is essential for this procedure not only for accuracy and speed, but also due to the miniaturization of scale required to fit the large number of library clones into highly dense spatial arrangements. Once generated, we next demonstrated how the macroarray membranes can be screened for genes of interest using modified versions of standard protocols for probe labeling, membrane hybridization, and signal detection. We complemented the visual demonstration of these procedures with detailed written descriptions of the steps involved and the materials required, all of which are available online alongside the video.

Su larga scala Schermi di librerie metagenomiche

Metagenomic libraries archive large fragments of contiguous genomic sequences from microorganisms without requiring prior cultivation.  Generating a ...

Ricerca

Biologia

Isolation of Genomic DNA from Mouse Tails

Isolamento del DNA genomico da Tails mouse

Large Insert Environmental Genomic Library Production

The vast majority of microbes in nature currently remain inaccessible to traditional cultivation methods. Over the past decade, culture-independent environmental genomic (i.e. metagenomic) approaches have emerged, enabling researchers to bridge this cultivation gap by capturing the genetic content of indigenous microbial communities directly from the environment. To this end, genomic DNA libraries are constructed using standard albeit artful laboratory cloning techniques. Here we describe the construction of a large insert environmental genomic fosmid library with DNA derived from the vertical depth continuum of a seasonally hypoxic fjord. This protocol is directly linked to a series of connected protocols including coastal marine water sampling [1], large volume filtration of microbial biomass [2] and a DNA extraction and purification protocol [3]. At the outset, high quality genomic DNA is end-repaired with the creation of 5 -phosphorylated blunt ends. End-repaired DNA is subjected to pulsed-field gel electrophoresis (PFGE) for size selection and gel extraction is performed to recover DNA fragments between 30 and 60 thousand base pairs (Kb) in length. Size selected DNA is purified away from the PFGE gel matrix and ligated to the phosphatase-treated blunt-end fosmid CopyControl vector pCC1 (EPICENTRE <a href="http://www.epibio.com/item.asp?ID=385">http://www.epibio.com/item.asp?ID=385</a>). Linear concatemers of pCC1 and insert DNA are subsequently headfull packaged into phage particles by lambda terminase, with subsequent infection of phage-resistant E. coli cells. Successfully transduced clones are recovered on LB agar plates under antibiotic selection and archived in 384-well plate format using an automated colony picking robot (Qpix2, GENETIX). The current protocol draws from various sources including the CopyControl Fosmid Library Production Kit from EPICENTRE and the published works of multiple research groups [4-7]. Each step is presented with best practice in mind. Whenever possible we highlight subtleties in execution to improve overall quality and efficiency of library production. The whole process of fosmid library production and automated colony picking takes at least 7-10 days as there are many incubation steps included. However, there are several stopping points possible which are mentioned within the protocol.

Construction of a fosmid library with environmental genomic DNA isolated from the vertical depth continuum of a seasonally hypoxic fjord is described. The resulting clone library is picked into 384-well plates and archived for downstream sequencing and functional screening by the application of an automated colony picking system.

Inserire grande Ambientale Genomic Produzione Biblioteca

The vast majority of microbes in nature currently remain inaccessible to traditional cultivation methods. Over the past decade, culture-independent ...

Purification of Mitochondria from Yeast Cells

Mitochondria are the main site of ATP production during aerobic metabolism in eukaryotic non-photosynthetic cells1. These complex organelles also play essential roles in apoptotic cell death2, cell survival3, mammalian development4, neuronal development and function4, intracellular signalling5, and longevity regulation6. Our understanding of these complex biological processes controlled by mitochondria relies on robust methods for assessing their morphology, their protein and lipid composition, the integrity of their DNA, and their numerous vital functions. The budding yeast Saccharomyces cerevisiae, a genetically and biochemically manipulable unicellular eukaryote with annotated genome and well-defined proteome, is a valuable model for studying the molecular and cellular mechanisms underlying essential biological functions of mitochondria. For these types of studies, it is crucial to have highly pure mitochondria. Here we present a detailed description of a rapid and effective method for purification of yeast mitochondria. This method enables the isolation of highly pure mitochondria that are essentially free of contamination by other organelles and retain their structural and functional integrity after their purification. Mitochondria purified by this method are suitable for cell-free reconstitution of essential mitochondrial processes and can be used for the analysis of mitochondrial structure and functions, mitochondrial proteome and lipidome, and mitochondrial DNA.

We describe a rapid and effective method for purification of mitochondria from the yeast Saccharomyces cerevisiae. This method enables the high-yield isolation of pure mitochondria that are essentially free of contamination by other organelles and retain their structural and functional integrity after their purification.

Purificazione dei mitocondri da cellule di lievito

Mitochondria are the main site of ATP production during aerobic metabolism in eukaryotic non-photosynthetic cells1. These complex organelles also play ...

Development of automated imaging and analysis for zebrafish chemical screens.

We demonstrate the application of image-based high-content screening (HCS) methodology to identify small molecules that can modulate the FGF/RAS/MAPK pathway in zebrafish embryos. The zebrafish embryo is an ideal system for in vivo high-content chemical screens. The 1-day old embryo is approximately 1mm in diameter and can be easily arrayed into 96-well plates, a standard format for high throughput screening. During the first day of development, embryos are transparent with most of the major organs present, thus enabling visualization of tissue formation during embryogenesis. The complete automation of zebrafish chemical screens is still a challenge, however, particularly in the development of automated image acquisition and analysis. We previously generated a transgenic reporter line that expresses green fluorescent protein (GFP) under the control of FGF activity and demonstrated their utility in chemical screens 1. To establish methodology for high throughput whole organism screens, we developed a system for automated imaging and analysis of zebrafish embryos at 24-48 hours post fertilization (hpf) in 96-well plates 2. In this video we highlight the procedures for arraying transgenic embryos into multiwell plates at 24hpf and the addition of a small molecule (BCI) that hyperactivates FGF signaling 3. The plates are incubated for 6 hours followed by the addition of tricaine to anesthetize larvae prior to automated imaging on a Molecular Devices ImageXpress Ultra laser scanning confocal HCS reader. Images are processed by Definiens Developer software using a Cognition Network Technology algorithm that we developed to detect and quantify expression of GFP in the heads of transgenic embryos. In this example we highlight the ability of the algorithm to measure dose-dependent effects of BCI on GFP reporter gene expression in treated embryos.

We report the development of a system for automated imaging and analysis of zebrafish transgenic embryos in multiwell plates. This demonstrates the ability to measure dose dependent effects of a small molecule, BCI, on Fibroblast Growth Factor reporter gene expression and provide technology for establishing high-throughput zebrafish chemical screens.

Sviluppo di imaging automatizzati e analisi chimiche per gli schermi zebrafish.

We demonstrate the application of image-based high-content screening (HCS) methodology to identify small molecules that can modulate the FGF/RAS/MAPK ...

Yeast Colony Embedding Method

Patterning of different cell types in embryos is a key mechanism in metazoan development. Communities of microorganisms, such as colonies and biofilms also display patterns of cell types. For example, in the yeast S. cerevisiae, sporulated cells and pseudohyphal cells are not uniformly distributed in colonies. The functional importance of patterning and the molecular mechanisms that underlie these patterns are still poorly understood.
One challenge with respect to investigating patterns of cell types in fungal colonies is that unlike metazoan tissue, cells in colonies are relatively weakly attached to one another. In particular, fungal colonies do not contain the same extensive level of extracellular matrix found in most tissues . Here we report on a method for embedding and sectioning yeast colonies that reveals the interior patterns of cell types in these colonies. The method can be used to prepare thick sections (0.5 &mu;) useful for light microscopy and thin sections (0.1 &mu;) suitable for transmission electron microscopy. Asci and pseudohyphal cells can easily be distinguished from ovoid yeast cells by light microscopy , while the interior structure of these cells can be visualized by EM.
The method is based on surrounding colonies with agar, infiltrating them with Spurr's medium, and then sectioning. Colonies with a diameter in the range of 1-2 mm are suitable for this protocol. In addition to visualizing the interior of colonies, the method allows visualization of the region of the colony that invades the underlying agar.

A method for embedding yeast colonies allowing sectioning for light and electron microscopy. This protocol allows determination of the distribution of sporulated cells and pseudohyphal cells within colonies providing a new tool toward understanding the organization of cell types within a fungal community.

Lievito Colony metodo di inserimento

Patterning of  different cell types in embryos is a key mechanism in metazoan development. Communities of microorganisms, such as colonies and biofilms ...

Genomic MRI - a Public Resource for Studying Sequence Patterns within Genomic DNA

Non-coding genomic regions in complex eukaryotes, including intergenic areas, introns, and untranslated segments of exons, are profoundly non-random in their nucleotide composition and consist of a complex mosaic of sequence patterns. These patterns include so-called Mid-Range Inhomogeneity (MRI) regions -- sequences 30-10000 nucleotides in length that are enriched by a particular base or combination of bases (e.g. (G+T)-rich, purine-rich, etc.). MRI regions are associated with unusual (non-B-form) DNA structures that are often involved in regulation of gene expression, recombination, and other genetic processes (Fedorova &amp; Fedorov 2010). The existence of a strong fixation bias within MRI regions against mutations that tend to reduce their sequence inhomogeneity additionally supports the functionality and importance of these genomic sequences (Prakash et al. 2009).
Here we demonstrate a freely available Internet resource -- the Genomic MRI program package -- designed for computational analysis of genomic sequences in order to find and characterize various MRI patterns within them (Bechtel et al. 2008). This package also allows generation of randomized sequences with various properties and level of correspondence to the natural input DNA sequences. The main goal of this resource is to facilitate examination of vast regions of non-coding DNA that are still scarcely investigated and await thorough exploration and recognition.

We present a public computational web site for the analysis of genomic sequences. It detects DNA sequence patterns with various non-random nucleotide compositions. This resource also generates randomized sequences with diverse levels of complexity.

Genomica risonanza magnetica - una risorsa pubblica per lo Studio Patterns sequenza all&#39;interno del DNA genomico

Non-coding genomic regions in complex eukaryotes, including intergenic areas, introns, and untranslated segments of exons, are profoundly non-random in ...

Genomic Transformation of the Picoeukaryote Ostreococcus tauri

Common problems hindering rapid progress in Plant Sciences include cellular, tissue and whole organism complexity, and notably the high level of genomic redundancy affecting simple genetics in higher plants. The novel model organism Ostreococcus tauri is the smallest free-living eukaryote known to date, and possesses a greatly reduced genome size and cellular complexity1,2, manifested by the presence of just one of most organelles (mitochondrion, chloroplast, golgi stack) per cell, and a genome containing only ~8000 genes. Furthermore, the combination of unicellularity and easy culture provides a platform amenable to chemical biology approaches. Recently, Ostreococcus has been successfully employed to study basic mechanisms underlying circadian timekeeping3-6. Results from this model organism have impacted not only plant science, but also mammalian biology7. This example highlights how rapid experimentation in a simple eukaryote from the green lineage can accelerate research in more complex organisms by generating testable hypotheses using methods technically feasible only in this background of reduced complexity. Knowledge of a genome and the possibility to modify genes are essential tools in any model species. Genomic1, Transcriptomic8, and Proteomic9 information for this species is freely available, whereas the previously reported methods6,10 to genetically transform Ostreococcus are known to few laboratories worldwide.
In this article, the experimental methods to genetically transform this novel model organism with an overexpression construct by means of electroporation are outlined in detail, as well as the method of inclusion of transformed cells in low percentage agarose to allow selection of transformed lines originating from a single transformed cell. Following the successful application of Ostreococcus to circadian research, growing interest in Ostreococcus can be expected from diverse research areas within and outside plant sciences, including biotechnological areas. Researchers from a broad range of biological and medical sciences that work on conserved biochemical pathways may consider pursuing research in Ostreococcus, free from the genomic and organismal complexity of larger model species.

Genomic Transformation of the Picoeukaryote Ostreococcus tauri

This article describes genetic transformation of the unicellular marine alga Ostreococcus tauri by electroporation. This eukaryotic organism is an effective model platform for higher plants, possesing greatly reduced genomic and cellular complexity and being readily amenable to both cell culture and chemical biology.

Trasformazione genomica del Picoeukaryote<em&gt; Ostreococcus Tauri</em

Common problems hindering rapid progress in Plant Sciences include cellular, tissue and whole organism complexity, and notably the high level of genomic ...

Selective Capture of 5-hydroxymethylcytosine from Genomic DNA

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene expression, maintenance of genome integrity, parental imprinting, X-chromosome inactivation, regulation of development, aging, and cancer1. Recently, the presence of an oxidized 5-mC, 5-hydroxymethylcytosine (5-hmC), was discovered in mammalian cells, in particular in embryonic stem (ES) cells and neuronal cells2-4. 5-hmC is generated by oxidation of 5-mC catalyzed by TET family iron (II)/&alpha;-ketoglutarate-dependent dioxygenases2, 3. 5-hmC is proposed to be involved in the maintenance of embryonic stem (mES) cell, normal hematopoiesis and malignancies, and zygote development2, 5-10. To better understand the function of 5-hmC, a reliable and straightforward sequencing system is essential. Traditional bisulfite sequencing cannot distinguish 5-hmC from 5-mC11. To unravel the biology of 5-hmC, we have developed a highly efficient and selective chemical approach to label and capture 5-hmC, taking advantage of a bacteriophage enzyme that adds a glucose moiety to 5-hmC specifically12.
Here we describe a straightforward two-step procedure for selective chemical labeling of 5-hmC. In the first labeling step, 5-hmC in genomic DNA is labeled with a 6-azide-glucose catalyzed by &beta;-GT, a glucosyltransferase from T4 bacteriophage, in a way that transfers the 6-azide-glucose to 5-hmC from the modified cofactor, UDP-6-N3-Glc (6-N3UDPG). In the second step, biotinylation, a disulfide biotin linker is attached to the azide group by click chemistry. Both steps are highly specific and efficient, leading to complete labeling regardless of the abundance of 5-hmC in genomic regions and giving extremely low background. Following biotinylation of 5-hmC, the 5-hmC-containing DNA fragments are then selectively captured using streptavidin beads in a density-independent manner. The resulting 5-hmC-enriched DNA fragments could be used for downstream analyses, including next-generation sequencing.
Our selective labeling and capture protocol confers high sensitivity, applicable to any source of genomic DNA with variable/diverse 5-hmC abundances. Although the main purpose of this protocol is its downstream application (i.e., next-generation sequencing to map out the 5-hmC distribution in genome), it is compatible with single-molecule, real-time SMRT (DNA) sequencing, which is capable of delivering single-base resolution sequencing of 5-hmC.

Described is a two-step labeling process using &beta;-glucosyltransferase (&beta;-GT) to transfer an azide-glucose to 5-hmC, followed by click chemistry to transfer a biotin linker for easy and density-independent enrichment. This efficient and specific labeling method enables enrichment of 5-hmC with extremely low background and high-throughput epigenomic mapping via next-generation sequencing.

Cattura selettiva di 5 hydroxymethylcytosine dal DNA genomico

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene ...

Assessing Differences in Sperm Competitive Ability in Drosophila

Competition among conspecific males for fertilizing the ova is one of the mechanisms of sexual selection, i.e. selection that operates on maximizing the number of successful mating events rather than on maximizing survival and viability 1. Sperm competition represents the competition between males after copulating with the same female 2, in which their sperm are coincidental in time and space. This phenomenon has been reported in multiple species of plants and animals 3. For example, wild-caught D. melanogaster females usually contain sperm from 2-3 males 4. The sperm are stored in specialized organs with limited storage capacity, which might lead to the direct competition of the sperm from different males 2,5.
Comparing sperm competitive ability of different males of interest (experimental male types) has been performed through controlled double-mating experiments in the laboratory 6,7. Briefly, a single female is exposed to two different males consecutively, one experimental male and one cross-mating reference male. The same mating scheme is then followed using other experimental male types thus facilitating the indirect comparison of the competitive ability of their sperm through a common reference. The fraction of individuals fathered by the experimental and reference males is identified using markers, which allows one to estimate sperm competitive ability using simple mathematical expressions 7,8. In addition, sperm competitive ability can be estimated in two different scenarios depending on whether the experimental male is second or first to mate (offense and defense assay, respectively) 9, which is assumed to be reflective of different competence attributes.
Here, we describe an approach that helps to interrogate the role of different genetic factors that putatively underlie the phenomenon of sperm competitive ability in D. melanogaster.

Assessing Differences in Sperm Competitive Ability in Drosophila

Differential sperm competitive ability among Drosophila males with distinct genotypes can be ascertained through double-mating experiments. Each of these experiments involves one of the males of interest and a reference male. Readily identifiable markers in the progeny allow inference of the fraction of individuals fathered by each male.

Differenze valutando in capacità competitiva sperma in<em&gt; Drosophila</em

Competition among conspecific males for fertilizing the ova is one of the mechanisms of sexual selection, i.e. selection that operates on maximizing the ...