Agradecemos a Ron Davis, Adam Deutschbauer, eo laboratório HOP toda HIP da Universidade de Toronto para discussões e aconselhamento. CN é suportado por concessões do National Human Genome Research Institute (Grant Número HG000205), RO1 HG003317, CIHR MOP-84305, e Canadian Cancer Society (# 020380). JO foi apoiado pelo Programa de Formação de Stanford Genome (Grant Número T32 HG00044 do National Human Genome Research Institute) e os Institutos Nacionais de Saúde (Grant Número GH000205 P01). GG é suportado pelo RO1 NHGRI HG003317 e da Sociedade Canadense do Câncer, Grant # 020380, TD e do Centro de Seqüenciamento Donnelly é suportado, em parte por doações da Fundação Canadense para Inovação, para as Dras. Brenda e Jack Andrews Greenblatt. AMS é apoiado por uma Universidade de Toronto Fellowship Open.

<ol>
	<li>Giaever, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+profiling+of+the+Saccharomyces+cerevisiae+genome.">Functional profiling of the Saccharomyces cerevisiae genome.</a> Nature. 418, 387-391 (2002).</li><li>Baba, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Molecular systems biology. 2, 2006.0008-2006.0008 (2006).</li><li>Claus, H., Frosch, M., Vogel, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+hotspot+for+transformation+of+Neisseria+meningitidis+by+shuttle+mutagenesis+using+signature-tagged+transposons.">Identification of a hotspot for transformation of Neisseria meningitidis by shuttle mutagenesis using signature-tagged transposons.</a> Mol Gen Genet. 259, 363-371 (1998).</li><li>Hava, D. L., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-scale+identification+of+serotype+4+Streptococcus+pneumoniae+virulence+factors.">Large-scale identification of serotype 4 Streptococcus pneumoniae virulence factors.</a> Molecular microbiology. 45, 1389-1406 (2002).</li><li>Costanzo, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Genetic+Landscape+of+a+Cell.">The Genetic Landscape of a Cell.</a> Science. 327, 425-431 (2010).</li><li>Tong, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+genetic+analysis+with+ordered+arrays+of+yeast+deletion+mutants.">Systematic genetic analysis with ordered arrays of yeast deletion mutants.</a> Science. 294, 2364-2368 (2001).</li><li>Pan, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+robust+toolkit+for+functional+profiling+of+the+yeast+genome.">A robust toolkit for functional profiling of the yeast genome.</a> Molecular cell. 16, 487-496 (2004).</li><li>Schuldiner, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploration+of+the+Function+and+Organization+of+the+Yeast+Early+Secretory+Pathway+through+an+Epistatic+Miniarray+Profile.">Exploration of the Function and Organization of the Yeast Early Secretory Pathway through an Epistatic Miniarray Profile.</a> Cell. 123, 507-519 (2005).</li><li>Deutschbauer, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+haploinsufficiency+revealed+by+genome-wide+profiling+in+yeast.">Mechanisms of haploinsufficiency revealed by genome-wide profiling in yeast.</a> Genetics. 169, 1915-1925 (2005).</li><li>Giaever, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemogenomic+profiling:+identifying+the+functional+interactions+of+small+molecules+in+yeast.">Chemogenomic profiling: identifying the functional interactions of small molecules in yeast.</a> Proceedings of the National Academy of Sciences of the United States of America. 101, 793-798 (2004).</li><li>Lum, P. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovering+modes+of+action+for+therapeutic+compounds+using+a+genome-wide+screen+of+yeast+heterozygotes.">Discovering modes of action for therapeutic compounds using a genome-wide screen of yeast heterozygotes.</a> Cell. 116, 121-137 (2004).</li><li>Hillenmeyer, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+chemical+genomic+portrait+of+yeast:+uncovering+a+phenotype+for+all+genes.">The chemical genomic portrait of yeast: uncovering a phenotype for all genes.</a> Science. 320, 362-365 (2008).</li><li>Oh, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+universal+TagModule+collection+for+parallel+genetic+analysis+of+microorganisms.">A universal TagModule collection for parallel genetic analysis of microorganisms.</a> Nucleic acids research. 38, e146-e146 (2010).</li><li>Oh, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+annotation+and+drug+target+discovery+in+Candida+albicans+with+a+tagged+transposon+mutant+collection.">Gene annotation and drug target discovery in Candida albicans with a tagged transposon mutant collection.</a> PLoS pathogens. 6, (2010).</li><li>Nislow, C., Giaever, G., Stark, I., Stansfields, M. J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chapter+387.">Chapter 387.</a> Yeast Gene Analysis. , 387-414 (2007).</li><li>Pierce, S. E., Davis, R. W., Nislow, C., Giaever, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+of+barcoded+Saccharomyces+cerevisiae+gene-deletion+mutants+in+pooled+cultures.">Genome-wide analysis of barcoded Saccharomyces cerevisiae gene-deletion mutants in pooled cultures.</a> Nature protocols. 2, 2958-2974 (2007).</li><li>Sambrook, J., Russell, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning : a laboratory manual. , (2001).</li><li>Smith, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+phenotyping+via+deep+barcode+sequencing.">Quantitative phenotyping via deep barcode sequencing.</a> Genome Res. , (2009).</li><li>Hamady, M., Walker, J. J., Harris, J. K., Gold, N. J., Knight, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Error-correcting+barcoded+primers+for+pyrosequencing+hundreds+of+samples+in+multiplex.">Error-correcting barcoded primers for pyrosequencing hundreds of samples in multiplex.</a> Nature. 5, 235-237 (2008).</li><li>Gresham, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=System-Level+Analysis+of+Genes+and+Functions+Affecting+Survival+During+Nutrient+Starvation+in+Saccharomyces+cerevisiae.">System-Level Analysis of Genes and Functions Affecting Survival During Nutrient Starvation in Saccharomyces cerevisiae.</a> Genetics. 187, 299-317 (2011).</li></ol>

Não há conflitos de interesse declarados.

Aqui, esboçamos um protocolo que, com a alteração modesta, pode ser facilmente adaptado a uma ampla gama de colecções existentes de código de barras coleções mutantes de microorganismos diferentes para criar coleções tag mutantes. Ressaltamos que, embora tenhamos relatado um protocolo sobre a mutagênese transposon marcadas para a levedura patogênica C. albicans, um protocolo muito semelhante poderia ser adaptado a uma grande variedade de fungos unicelulares. Modificada, este protocolo funciona bem em bactérias 13 e, atualmente, coleções para um número adicional de genomas de fungos e bactérias estão em construção. Atualmente, este ensaio fornece a única abrangente, a tela do genoma imparcial para interações gene-pequena molécula. Um aspecto particularmente atraente do ensaio é que nenhum conhecimento prévio do gene ou molécula pequena é necessária. Apesar do alcance e do poder destes ensaios, a sua transferência para outros laboratórios tem sido dificultada pelo pouco investimento de capital inicial e as ferramentas de informática para a análise dos resultados. Com a adoção de uma leitura próxima geração seqüência combinada com ferramentas robustas para análise, esperamos a sua aprovação a aumentar.

<table border="1"><tbody><tr><td> Antibióticos </td><td> Número de fornecedores e catálogo </td></tr><tr><td> Carbenicilina </td><td> Sigma, parte # C1613 </td></tr><tr><td> Canamicina </td><td> Sigma, parte # K1876 </td></tr><tr><td> espectinomicina </td><td> Sigma, parte # S0692 </td></tr><tr><td> Cloranfenicol </td><td> Sigma, parte # C0378 </td></tr><tr><td> DNA Clean-up e kits de concentração </td><td></td></tr><tr><td> QIAprep rotação Miniprep Kit </td><td> Qiagen, parte # 27106 </td></tr><tr><td> Kit Maxi HiSpeed ​​Plasmid </td><td> Qiagen, parte # 12663 </td></tr><tr><td> QIAquick Kit de Purificação PCR </td><td> Qiagen, parte # 28106 </td></tr><tr><td> QIAquick Gel Extraction Kit </td><td> Qiagen, parte # 28704 </td></tr><tr><td> PCR e reagentes eletroforese </td><td></td></tr><tr><td> Taq DNA polimerase (Mg-free) do buffer </td><td> New England Biolabs, parte # M0320L </td></tr><tr><td> Mix Solução desoxinucleotídeo </td><td> New England Biolabs, parte # N0447L </td></tr><tr><td> 25 mM MgCl 2 </td><td> Sigma, parte # 63036 </td></tr><tr><td> Agarose, corante e ácido nucléico mancha adequado para eletroforese em gel </td><td> Vários </td></tr><tr><td> Tampão TAE 10X </td><td> Sigma, parte # T8280 </td></tr><tr><td> 1 Kb DNA Ladder Mais </td><td> Invitrogen, parte # 10787026 </td></tr><tr><td> YPD caldo </td><td></td></tr><tr><td> 10 g de extrato de levedura </td><td> Sigma, parte # Y1625 </td></tr><tr><td> 20 g de peptona Bacto </td><td> BD Biosciences, parte # 211677 </td></tr><tr><td> 20 g de dextrose </td><td> Sigma, parte # D9434 </td></tr><tr><td> Material de laboratório </td><td></td></tr><tr><td> Pipetas multicanal (1000, 200 e 20 mL) </td><td> Vários </td></tr><tr><td> Descartáveis ​​reservatórios pipetagem </td><td> Vários </td></tr><tr><td> 15 e 50 mL tubos de centrífuga </td><td> Vários </td></tr><tr><td> 96 - e 384-poço profundo Placas Bem </td><td> Axygen Scientific, parte # P-2ML-SQ-CS &amp; P-384240SQCS </td></tr><tr><td> De 96 poços e 384 placas de bem-PCR e filme de vedação </td><td> Vários </td></tr><tr><td> Rolo de chapa para a selagem de poços múltiplos placas </td><td> Sigma, parte # R1275 </td></tr><tr><td> 30 ° C e 37 ° C agitando incubadoras para o crescimento de bactérias e leveduras em placas e em tubos </td><td> Vários </td></tr><tr><td> In vitro transposon mutagênese </td><td></td></tr><tr><td> EZ-Tn5 transposase </td><td> Biotecnologias Epicentro, parte # TNP92110 </td></tr><tr><td> Alto rendimento de transformação </td><td></td></tr><tr><td> Seqprep 96 HT Kit Prep Plasmid </td><td> Borda Biosystems, parte # 84359 </td></tr><tr><td> polietileno glicol, peso molecular 3350 </td><td> Vários </td></tr><tr><td> acetato de lítio </td><td> Sigma, parte # 517992 </td></tr><tr><td> 6-bem pratos, estéril </td><td> Corning, parte # 3335 </td></tr><tr><td> 50 mg / mL uridina </td><td> Sigma, parte # U3750 </td></tr><tr><td> 100X solução tampão Tris-EDTA </td><td> Sigma, parte # T9285 </td></tr><tr><td> 1X TE/0.1M LiOAc </td><td> Vários </td></tr><tr><td> salmão testículo DNA </td><td> Sigma, parte # 1626 </td></tr><tr><td> Crescimento das coleções de código de barras </td><td></td></tr><tr><td> 48 placas bem, se crescer culturas em placas </td><td> Greiner, parte # M9437 </td></tr><tr><td> Colantes placa </td><td> ABgene, parte # AB-0580 </td></tr><tr><td> 200 frascos de cultura mL </td><td> Vários </td></tr><tr><td> Espectrofotômetro capaz de absorbância </td><td> Vários </td></tr><tr><td> Temperatura controlada shaker para balões de 250 ml ou espectrofotômetro agitação </td><td> Vários </td></tr><tr><td> Seguro-Lock tubo de microcentrífuga, 2 mL </td><td> Eppendorf, parte # 0030 120.094 </td></tr><tr><td> Equipamentos de hibridização </td><td></td></tr><tr><td> Forno de hibridização 640 </td><td> Affymetrix, parte # 800138 </td></tr><tr><td> GeneChip Fluidic Station 450 </td><td> Affymetrix, parte # 00-0079 </td></tr><tr><td> GeneArray Scanner 3000 </td><td> Affymetrix, parte # 00-0212 </td></tr><tr><td> Banho de água fervente com suporte flutuante </td><td> Vários </td></tr><tr><td> Consumíveis de hibridização </td><td></td></tr><tr><td> Genflex Tag Matriz 16K v2 </td><td> AffymEtrix, parte # 511331 </td></tr><tr><td> Solução Denhardt, a concentrar-50X </td><td> Sigma, parte # D2532 </td></tr><tr><td> Estreptavidina, R-ficoeritrina conjugada (SAPE) </td><td> Invitrogen, parte # S866 </td></tr><tr><td> Seguro-Lock tubo de microcentrífuga de 0,5 mL </td><td> Eppendorf, parte # 0030 123.301 </td></tr><tr><td> Teeny Tough-Spots </td><td> Diversified Biotech, parte # LTTM-1000 </td></tr><tr><td> 0,5 M EDTA </td><td> BioRad, parte # 161-0729 </td></tr><tr><td> 10% Tween </td><td> Sigma, parte # T2700 </td></tr><tr><td> MES monohidrato do ácido livre </td><td> Sigma, parte # M5287 </td></tr><tr><td> MES sal de sódio </td><td> Sigma, parte # M5057 </td></tr><tr><td> 5 M NaCl </td><td> Sigma, parte # 71386 </td></tr><tr><td> 20X SSPE </td><td> Sigma, parte # S2015 </td></tr><tr><td> Água de grau de biologia molecular </td><td> Sigma, parte # W4502 </td></tr><tr><td> Primers hibridação </td><td> Diversos fornecedores (dessalinização standard) </td></tr><tr><td> Uptag </td><td> &quot;GATGTCCACGAGGTCTCT 3 &#39;5 </td></tr><tr><td> Buptagkanmx4 </td><td> 5 &#39;biotina-GTCGACCTGCAGCGTACG 3&#39; </td></tr><tr><td> Dntag </td><td> 5 &#39;CGGTGTCGGTCTCGTAG 3&#39; </td></tr><tr><td> Bdntagkanmx4 </td><td> 5 &#39;biotina-GAAAACGAGCTCGAATTCATCG 3&#39; </td></tr><tr><td> B213 </td><td> 5 &#39;biotina-CTGAACGGTAGCATCTTGAC 3&#39; </td></tr><tr><td> Uptagkanmx </td><td> 5 &#39;GTCGACCTGCAGCGTACG 3&#39; </td></tr><tr><td> Dntagkanmx </td><td> 5&#39;GAAAACGAGCTCGAATTCATCG 3 &#39; </td></tr><tr><td> Uptagcomp </td><td> 5&#39;AGAGACCTCGTGGACATC 3 &#39; </td></tr><tr><td> Dntagcomp </td><td> 5&#39;CTACGAGACCGACACCG 3 &#39; </td></tr><tr><td> Upkancomp </td><td> 5&#39;CGTACGCTGCAGGTCGAC 3 &#39; </td></tr><tr><td> Dnkancomp </td><td> 5&#39;CGATGAATTCGAGCTCGTTTTC 3 &#39; </td></tr><tr><td> Seqüenciamento Primers: Plataforma Illumina </td><td> Diversos fornecedores </td></tr><tr><td> UpTag Forward (100um) </td><td> 5 &#39;CAA GGC GAC GAA GCA ATA CGA GCT CTT ATC CCG T GAT GTC GTC GAG CAC TCT 3&#39; </td></tr><tr><td> UpTag Reverse (100um) </td><td> 5 &#39;GAT AAT ACG GCG ACC ACC GAC ACT CTT TCC CTA CAC GAC GCT CTT ATC CCG T NNNNN GTC GAC CTG CAG CGT ACG 3&#39; </td></tr><tr><td> DownTag Forward (100um) </td><td> 5 &#39;CAA GGC GAC GAA GCA ATA CGA GCT CTT ATC CCG T GAA GAG AAC CTC TTC GAA ATC G 3&#39; </td></tr><tr><td> DownTag Reverse (100um) </td><td> 5 &#39;GAT AAT ACG GCG ACC ACC GAC ACT CTT TCC CTA CAC GAC GCT CTT ATC CCG T NNNNN CGG TGT CGG TCT CGT AG 3 ` </td></tr><tr><td> Leia um UP-tag cartilha seq (100um) </td><td> 5 &#39;GAC GTC CTG CAG CGT ACG 3&#39; </td></tr><tr><td> Leia um BAIXO tag-primário seq (100um) </td><td> 5 &#39;CGG TGT CGG TCT CGT AG 3&#39; </td></tr><tr><td> Ler 2 cartilha Seqüenciamento Index (padrão primário Illumina R1) (100um) </td><td> 5 &#39;ACT AC CTT TCC CTA CAC GAC GCT CTT ATC CCG T 3&#39; </td></tr><tr><td> Reagentes adicionais Seqüenciamento / Equipamentos </td><td></td></tr><tr><td> Qiagen MinElute 96 UF Kit de purificação de PCR </td><td> Qiagen, parte # 29051 </td></tr><tr><td> Bomba de vácuo </td><td> Qualquer fornecedor </td></tr><tr><td> Macherey-Nagel Manifold Vacuum </td><td> Macherey-Nagel, parte # 740 681 </td></tr><tr><td> Invitrogen Quant-iT dsDNA BR Assay Kit </td><td> Invitrogen, parte # Q32853 </td></tr><tr><td> Ensaio Invitrogen tubos Qubit </td><td> Invitrogen, parte # Q32856 </td></tr><tr><td> 40 acrilamida% mais 1% N, N&#39;-metileno-bis-acrilamida, 37.5:1 </td><td> Bio Rad, parte # 161-0148 </td></tr><tr><td> Tris Base de Dados </td><td> Sigma, parte # T1503-1KG </td></tr><tr><td> Ácido bórico </td><td> Sigma, parte # B6768-500G </td></tr><tr><td> EDTA 0,5 M, pH 8,0 </td><td> Teknova, parte # E0306 </td></tr><tr><td> Persulfato de amônio </td><td> Sigma, parte # A3678-25G </td></tr><tr><td> Temed </td><td> Bioshop, parte # TEM001.25 </td></tr><tr><td> Solução de brometo de etídio </td><td> Bioshop, parte # ETB444.10 </td></tr><tr><td> Acetato de amônio 0,5 M </td><td> Teknova, parte # A2000 </td></tr><tr><td> Tetra acetato de magnésio 10mM </td><td> Sigma, parte # M0631-100G </td></tr><tr><td> 1mM EDTA, pH 8,0 </td><td> Ver EDTA 0.5M, pH 8.0 </td></tr><tr><td> Etanol </td><td> Vários </td></tr><tr><td> Acetato de sódio, pH 5,2 </td><td> Teknova, parte # S0297 </td></tr><tr><td> Vácuo velocidade </td><td> Vários </td></tr><tr><td> Leia Kit Single-Generation Cluster </td><td> Illumina, parte # GD-300-1001 </td></tr><tr><td> 36c Seqüenciamento Kit v4 </td><td>Illumina, parte # FC-104-4002 </td></tr><tr><td></td><td></td></tr></tbody></table> Receita TBE 10X <table border="1"><tbody><tr><td> Quantidades </td><td> Reagentes </td></tr><tr><td> 108 gramas </td><td> Tris Base de Dados </td></tr><tr><td> 55 gramas </td><td> Ácido bórico </td></tr><tr><td> 40mL </td><td> EDTA 0,5 M (pH 8,0) </td></tr><tr><td colspan="2"> Adicionar dH 2 O para 1L marca </td></tr></tbody></table> 12% da receita em gel de poliacrilamida <table border="1"><tbody><tr><td> Volumes </td><td> Reagentes </td></tr><tr><td> 5,8 ml </td><td> 40 acrilamida% mais 1% N, N&#39;-metileno-bis-acrilamida, 37.5:1 </td></tr><tr><td> 12 ml </td><td> dH 2 O </td></tr><tr><td> 2 ml </td><td> TBE 10X </td></tr><tr><td> 140 mL </td><td> Persulfato de amônio 10% </td></tr><tr><td> Volume total: 20ml </td><td></td></tr></tbody></table> Uptag mistura de iniciadores: Ressuspender Uptag e Buptagkanmx4 cada um em DDH 2 O a 100 mM, em seguida, misture em uma proporção de 1:1 para uma concentração final de 50 mM cada um. Armazenar a -20 ° C. Downtag mistura de iniciadores: Ressuspender Dntag e Bdntagkanmx4 cada um em DDH 2 O a 100 mM, em seguida, misture em uma proporção de 1:1 para uma concentração final de 50 mM cada um. Armazenar a -20 ° C. Oligonucleotides misto: Ressuspender cada um dos seguintes oito oligos (standard já dessalgado) em DDH 2 O a 100 mM: Uptag, Dntag, Uptagkanmx, Dntagkanmx, Uptagcomp, Dntagcomp, Upkancomp, Dnkancomp. Misturar um volume igual de oito oligonucleotídeos para uma concentração final de 12,5 mM cada um. 12X de ações MES: Para 10 ml, dissolver 0,7 g MES monohidrato do ácido livre e 1,93 g de sal de sódio MES em 8 ml de água de grau de biologia molecular. Depois de misturar bem, verificar o pH e se necessário ajustar a um pH 6,5-6,7. Adicionar água a um volume total de 10 ml. Filtro de esterilizar e armazenar a 4 ° C protegido da luz (por exemplo, envolva o tubo em papel alumínio). Substituir se a solução torna-se visivelmente amarelo ou após 6 meses. 2X tampão de hibridação: Para 50 ml, misturar 8,3 ml de 12X MES estoque (de 2.9.14), 17,7 ml de 5 M NaCl, 4,0 ml de 0,5 M EDTA, 0,1 ml de 10% Tween 20 (vol / vol), e 19,9 ml filtrados DDH 2 O. Filtro de esterilizar. Lavar A: Misturar 300 ml 20X SSPE, 1 mL de Tween 10% (vol / vol), 699 ml DDH 2 O. Filtro de esterilizar. Lavar B: Misture 150 ml 20X SSPE, 1 mL de Tween 10% (vol / vol), 849 ml DDH 2 O. Filtro de esterilizar. Seqüenciamento primers de código de barras Em seqüências UP tag-primário a 5 &#39;da cauda (negrito) são seqüências de Illumina adaptador específico incorporado o primer F e R. A seqüência variável (itálico) representa a marca de indexação 5-mer usado em multiplexação / index de leitura. A cauda do 3 &#39;(sublinhado) representa o primer comum de acompanhamento do código de barras uptag e é necessário para ampliar os códigos de barras de levedura. Em Down tag-primário seqüências 5 &#39;cauda é idêntica à 5&#39; cauda de UP-tag primers (seqüência específica Illumina), no entanto, a 3 &#39;cauda (sublinhado) é substituído pelo primers comuns que são usados ​​para amplificar o DOWN- tag barcodes.

competitive genomic screens of barcoded yeast libraries

Em virtude dos avanços em tecnologias de próxima geração de sequenciamento, temos acesso a novas seqüências do genoma quase que diariamente. O ritmo destes avanços está se acelerando, prometendo uma maior profundidade e amplitude. À luz desses avanços extraordinários, a necessidade de rápido, métodos paralelos para definir a função do gene torna-se cada vez mais importante. Coleções de mutantes do genoma exclusão em leveduras e E. coli têm servido como burros de carga para a caracterização funcional da função dos genes, mas esta abordagem não é escalável, atual gene-apagamento abordagens exigem cada um dos milhares de genes que compõem o genoma a ser excluído e verificada. Somente após esse trabalho é completo pode buscamos high-throughput fenotipagem. Durante a última década, nosso laboratório tem refinado uma carteira de competitivo, miniaturizado, do genoma de alto rendimento ensaios que podem ser executadas em paralelo. Esta paralelização é possível por causa da inclusão de &#39;tags&#39; DNA, ou &quot;código de barras,&quot; em cada mutante, com o código de barras que serve como um proxy para a mutação e pode-se medir a abundância de código de barras para avaliar aptidão mutante. Neste estudo, procuramos preencher a lacuna entre seqüência de DNA e código de barras coleções mutante. Para conseguir isso, apresentamos uma abordagem combinada transposon interrupção código de barras, que abre os ensaios de código de barras paralelas para recém seqüenciados, mas mal caracterizada micróbios. Para ilustrar esta abordagem, apresentamos uma nova Candida albicans coleção rompimento com código de barras e descrever a forma como o microarray-based e próxima geração de plataformas baseadas em seqüenciamento pode ser usado para coletar 10.000 - 1.000.000 gene-gene e gene-drogas interações em um único experimento.

Watch this Scientific Journal Video about Competitive Genomic Screens of Barcoded Yeast Libraries at JoVE.com

Competitive Genomic Screens of Barcoded Yeast Libraries

Nós desenvolvemos abrangente, imparcial genome-wide telas para entender gene de drogas e interações gene-ambiente. Métodos para a triagem dessas coleções mutantes são apresentados.

Competitiva Screens Genomic de Bibliotecas Yeast Barcoded

By virtue of advances in next generation sequencing technologies, we have access to new genome sequences almost daily.  The tempo of these advances is ...

competitive-genomic-screens-of-barcoded-yeast-libraries

Research

JoVE Journal

Biology

18.1K visualizações.  University of Toronto. Nós desenvolvemos abrangente, imparcial genome-wide telas para entender gene de drogas e interações gene-ambiente. Métodos para a triagem dessas coleções mutantes são apresentados.

Vídeo: Competitive Genomic Screens of Barcoded Yeast Libraries

Large-Scale Screens of Metagenomic Libraries

Metagenomic libraries archive large fragments of contiguous genomic sequences from microorganisms without requiring prior cultivation. Generating a streamlined procedure for creating and screening metagenomic libraries is therefore useful for efficient high-throughput investigations into the genetic and metabolic properties of uncultured microbial assemblages. Here, key protocols are presented on video, which we propose is the most useful format for accurately describing a long process that alternately depends on robotic instrumentation and (human) manual interventions. First, we employed robotics to spot library clones onto high-density macroarray membranes, each of which can contain duplicate colonies from twenty-four 384-well library plates. Automation is essential for this procedure not only for accuracy and speed, but also due to the miniaturization of scale required to fit the large number of library clones into highly dense spatial arrangements. Once generated, we next demonstrated how the macroarray membranes can be screened for genes of interest using modified versions of standard protocols for probe labeling, membrane hybridization, and signal detection. We complemented the visual demonstration of these procedures with detailed written descriptions of the steps involved and the materials required, all of which are available online alongside the video.

Grande Escala Telas de Bibliotecas metagenomic

Metagenomic libraries archive large fragments of contiguous genomic sequences from microorganisms without requiring prior cultivation.  Generating a ...

Biologia

Isolation of Genomic DNA from Mouse Tails

Isolamento de DNA genômico de Tails rato

Large Insert Environmental Genomic Library Production

The vast majority of microbes in nature currently remain inaccessible to traditional cultivation methods. Over the past decade, culture-independent environmental genomic (i.e. metagenomic) approaches have emerged, enabling researchers to bridge this cultivation gap by capturing the genetic content of indigenous microbial communities directly from the environment. To this end, genomic DNA libraries are constructed using standard albeit artful laboratory cloning techniques. Here we describe the construction of a large insert environmental genomic fosmid library with DNA derived from the vertical depth continuum of a seasonally hypoxic fjord. This protocol is directly linked to a series of connected protocols including coastal marine water sampling [1], large volume filtration of microbial biomass [2] and a DNA extraction and purification protocol [3]. At the outset, high quality genomic DNA is end-repaired with the creation of 5 -phosphorylated blunt ends. End-repaired DNA is subjected to pulsed-field gel electrophoresis (PFGE) for size selection and gel extraction is performed to recover DNA fragments between 30 and 60 thousand base pairs (Kb) in length. Size selected DNA is purified away from the PFGE gel matrix and ligated to the phosphatase-treated blunt-end fosmid CopyControl vector pCC1 (EPICENTRE <a href="http://www.epibio.com/item.asp?ID=385">http://www.epibio.com/item.asp?ID=385</a>). Linear concatemers of pCC1 and insert DNA are subsequently headfull packaged into phage particles by lambda terminase, with subsequent infection of phage-resistant E. coli cells. Successfully transduced clones are recovered on LB agar plates under antibiotic selection and archived in 384-well plate format using an automated colony picking robot (Qpix2, GENETIX). The current protocol draws from various sources including the CopyControl Fosmid Library Production Kit from EPICENTRE and the published works of multiple research groups [4-7]. Each step is presented with best practice in mind. Whenever possible we highlight subtleties in execution to improve overall quality and efficiency of library production. The whole process of fosmid library production and automated colony picking takes at least 7-10 days as there are many incubation steps included. However, there are several stopping points possible which are mentioned within the protocol.

Construction of a fosmid library with environmental genomic DNA isolated from the vertical depth continuum of a seasonally hypoxic fjord is described. The resulting clone library is picked into 384-well plates and archived for downstream sequencing and functional screening by the application of an automated colony picking system.

Grandes Inserir Produção Ambiental Biblioteca Genômica

The vast majority of microbes in nature currently remain inaccessible to traditional cultivation methods. Over the past decade, culture-independent ...

Purification of Mitochondria from Yeast Cells

Mitochondria are the main site of ATP production during aerobic metabolism in eukaryotic non-photosynthetic cells1. These complex organelles also play essential roles in apoptotic cell death2, cell survival3, mammalian development4, neuronal development and function4, intracellular signalling5, and longevity regulation6. Our understanding of these complex biological processes controlled by mitochondria relies on robust methods for assessing their morphology, their protein and lipid composition, the integrity of their DNA, and their numerous vital functions. The budding yeast Saccharomyces cerevisiae, a genetically and biochemically manipulable unicellular eukaryote with annotated genome and well-defined proteome, is a valuable model for studying the molecular and cellular mechanisms underlying essential biological functions of mitochondria. For these types of studies, it is crucial to have highly pure mitochondria. Here we present a detailed description of a rapid and effective method for purification of yeast mitochondria. This method enables the isolation of highly pure mitochondria that are essentially free of contamination by other organelles and retain their structural and functional integrity after their purification. Mitochondria purified by this method are suitable for cell-free reconstitution of essential mitochondrial processes and can be used for the analysis of mitochondrial structure and functions, mitochondrial proteome and lipidome, and mitochondrial DNA.

We describe a rapid and effective method for purification of mitochondria from the yeast Saccharomyces cerevisiae. This method enables the high-yield isolation of pure mitochondria that are essentially free of contamination by other organelles and retain their structural and functional integrity after their purification.

Purificação de mitocôndrias de células de levedura

Mitochondria are the main site of ATP production during aerobic metabolism in eukaryotic non-photosynthetic cells1. These complex organelles also play ...

Development of automated imaging and analysis for zebrafish chemical screens.

We demonstrate the application of image-based high-content screening (HCS) methodology to identify small molecules that can modulate the FGF/RAS/MAPK pathway in zebrafish embryos. The zebrafish embryo is an ideal system for in vivo high-content chemical screens. The 1-day old embryo is approximately 1mm in diameter and can be easily arrayed into 96-well plates, a standard format for high throughput screening. During the first day of development, embryos are transparent with most of the major organs present, thus enabling visualization of tissue formation during embryogenesis. The complete automation of zebrafish chemical screens is still a challenge, however, particularly in the development of automated image acquisition and analysis. We previously generated a transgenic reporter line that expresses green fluorescent protein (GFP) under the control of FGF activity and demonstrated their utility in chemical screens 1. To establish methodology for high throughput whole organism screens, we developed a system for automated imaging and analysis of zebrafish embryos at 24-48 hours post fertilization (hpf) in 96-well plates 2. In this video we highlight the procedures for arraying transgenic embryos into multiwell plates at 24hpf and the addition of a small molecule (BCI) that hyperactivates FGF signaling 3. The plates are incubated for 6 hours followed by the addition of tricaine to anesthetize larvae prior to automated imaging on a Molecular Devices ImageXpress Ultra laser scanning confocal HCS reader. Images are processed by Definiens Developer software using a Cognition Network Technology algorithm that we developed to detect and quantify expression of GFP in the heads of transgenic embryos. In this example we highlight the ability of the algorithm to measure dose-dependent effects of BCI on GFP reporter gene expression in treated embryos.

We report the development of a system for automated imaging and analysis of zebrafish transgenic embryos in multiwell plates. This demonstrates the ability to measure dose dependent effects of a small molecule, BCI, on Fibroblast Growth Factor reporter gene expression and provide technology for establishing high-throughput zebrafish chemical screens.

Desenvolvimento de imagem automatizada e análise química para as telas de zebrafish.

We demonstrate the application of image-based high-content screening (HCS) methodology to identify small molecules that can modulate the FGF/RAS/MAPK ...

Yeast Colony Embedding Method

Patterning of different cell types in embryos is a key mechanism in metazoan development. Communities of microorganisms, such as colonies and biofilms also display patterns of cell types. For example, in the yeast S. cerevisiae, sporulated cells and pseudohyphal cells are not uniformly distributed in colonies. The functional importance of patterning and the molecular mechanisms that underlie these patterns are still poorly understood.
One challenge with respect to investigating patterns of cell types in fungal colonies is that unlike metazoan tissue, cells in colonies are relatively weakly attached to one another. In particular, fungal colonies do not contain the same extensive level of extracellular matrix found in most tissues . Here we report on a method for embedding and sectioning yeast colonies that reveals the interior patterns of cell types in these colonies. The method can be used to prepare thick sections (0.5 &mu;) useful for light microscopy and thin sections (0.1 &mu;) suitable for transmission electron microscopy. Asci and pseudohyphal cells can easily be distinguished from ovoid yeast cells by light microscopy , while the interior structure of these cells can be visualized by EM.
The method is based on surrounding colonies with agar, infiltrating them with Spurr's medium, and then sectioning. Colonies with a diameter in the range of 1-2 mm are suitable for this protocol. In addition to visualizing the interior of colonies, the method allows visualization of the region of the colony that invades the underlying agar.

A method for embedding yeast colonies allowing sectioning for light and electron microscopy. This protocol allows determination of the distribution of sporulated cells and pseudohyphal cells within colonies providing a new tool toward understanding the organization of cell types within a fungal community.

Levedura Método Embedding Colony

Patterning of  different cell types in embryos is a key mechanism in metazoan development. Communities of microorganisms, such as colonies and biofilms ...

Genomic MRI - a Public Resource for Studying Sequence Patterns within Genomic DNA

Non-coding genomic regions in complex eukaryotes, including intergenic areas, introns, and untranslated segments of exons, are profoundly non-random in their nucleotide composition and consist of a complex mosaic of sequence patterns. These patterns include so-called Mid-Range Inhomogeneity (MRI) regions -- sequences 30-10000 nucleotides in length that are enriched by a particular base or combination of bases (e.g. (G+T)-rich, purine-rich, etc.). MRI regions are associated with unusual (non-B-form) DNA structures that are often involved in regulation of gene expression, recombination, and other genetic processes (Fedorova &amp; Fedorov 2010). The existence of a strong fixation bias within MRI regions against mutations that tend to reduce their sequence inhomogeneity additionally supports the functionality and importance of these genomic sequences (Prakash et al. 2009).
Here we demonstrate a freely available Internet resource -- the Genomic MRI program package -- designed for computational analysis of genomic sequences in order to find and characterize various MRI patterns within them (Bechtel et al. 2008). This package also allows generation of randomized sequences with various properties and level of correspondence to the natural input DNA sequences. The main goal of this resource is to facilitate examination of vast regions of non-coding DNA that are still scarcely investigated and await thorough exploration and recognition.

We present a public computational web site for the analysis of genomic sequences. It detects DNA sequence patterns with various non-random nucleotide compositions. This resource also generates randomized sequences with diverse levels of complexity.

Genômica MRI - um recurso público para estudar os padrões de seqüência dentro de DNA genômico

Non-coding genomic regions in complex eukaryotes, including intergenic areas, introns, and untranslated segments of exons, are profoundly non-random in ...

Genomic Transformation of the Picoeukaryote Ostreococcus tauri

Common problems hindering rapid progress in Plant Sciences include cellular, tissue and whole organism complexity, and notably the high level of genomic redundancy affecting simple genetics in higher plants. The novel model organism Ostreococcus tauri is the smallest free-living eukaryote known to date, and possesses a greatly reduced genome size and cellular complexity1,2, manifested by the presence of just one of most organelles (mitochondrion, chloroplast, golgi stack) per cell, and a genome containing only ~8000 genes. Furthermore, the combination of unicellularity and easy culture provides a platform amenable to chemical biology approaches. Recently, Ostreococcus has been successfully employed to study basic mechanisms underlying circadian timekeeping3-6. Results from this model organism have impacted not only plant science, but also mammalian biology7. This example highlights how rapid experimentation in a simple eukaryote from the green lineage can accelerate research in more complex organisms by generating testable hypotheses using methods technically feasible only in this background of reduced complexity. Knowledge of a genome and the possibility to modify genes are essential tools in any model species. Genomic1, Transcriptomic8, and Proteomic9 information for this species is freely available, whereas the previously reported methods6,10 to genetically transform Ostreococcus are known to few laboratories worldwide.
In this article, the experimental methods to genetically transform this novel model organism with an overexpression construct by means of electroporation are outlined in detail, as well as the method of inclusion of transformed cells in low percentage agarose to allow selection of transformed lines originating from a single transformed cell. Following the successful application of Ostreococcus to circadian research, growing interest in Ostreococcus can be expected from diverse research areas within and outside plant sciences, including biotechnological areas. Researchers from a broad range of biological and medical sciences that work on conserved biochemical pathways may consider pursuing research in Ostreococcus, free from the genomic and organismal complexity of larger model species.

Genomic Transformation of the Picoeukaryote Ostreococcus tauri

This article describes genetic transformation of the unicellular marine alga Ostreococcus tauri by electroporation. This eukaryotic organism is an effective model platform for higher plants, possesing greatly reduced genomic and cellular complexity and being readily amenable to both cell culture and chemical biology.

Transformação genômica do Picoeukaryote<em&gt; Ostreococcus tauri</em

Common problems hindering rapid progress in Plant Sciences include cellular, tissue and whole organism complexity, and notably the high level of genomic ...

Selective Capture of 5-hydroxymethylcytosine from Genomic DNA

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene expression, maintenance of genome integrity, parental imprinting, X-chromosome inactivation, regulation of development, aging, and cancer1. Recently, the presence of an oxidized 5-mC, 5-hydroxymethylcytosine (5-hmC), was discovered in mammalian cells, in particular in embryonic stem (ES) cells and neuronal cells2-4. 5-hmC is generated by oxidation of 5-mC catalyzed by TET family iron (II)/&alpha;-ketoglutarate-dependent dioxygenases2, 3. 5-hmC is proposed to be involved in the maintenance of embryonic stem (mES) cell, normal hematopoiesis and malignancies, and zygote development2, 5-10. To better understand the function of 5-hmC, a reliable and straightforward sequencing system is essential. Traditional bisulfite sequencing cannot distinguish 5-hmC from 5-mC11. To unravel the biology of 5-hmC, we have developed a highly efficient and selective chemical approach to label and capture 5-hmC, taking advantage of a bacteriophage enzyme that adds a glucose moiety to 5-hmC specifically12.
Here we describe a straightforward two-step procedure for selective chemical labeling of 5-hmC. In the first labeling step, 5-hmC in genomic DNA is labeled with a 6-azide-glucose catalyzed by &beta;-GT, a glucosyltransferase from T4 bacteriophage, in a way that transfers the 6-azide-glucose to 5-hmC from the modified cofactor, UDP-6-N3-Glc (6-N3UDPG). In the second step, biotinylation, a disulfide biotin linker is attached to the azide group by click chemistry. Both steps are highly specific and efficient, leading to complete labeling regardless of the abundance of 5-hmC in genomic regions and giving extremely low background. Following biotinylation of 5-hmC, the 5-hmC-containing DNA fragments are then selectively captured using streptavidin beads in a density-independent manner. The resulting 5-hmC-enriched DNA fragments could be used for downstream analyses, including next-generation sequencing.
Our selective labeling and capture protocol confers high sensitivity, applicable to any source of genomic DNA with variable/diverse 5-hmC abundances. Although the main purpose of this protocol is its downstream application (i.e., next-generation sequencing to map out the 5-hmC distribution in genome), it is compatible with single-molecule, real-time SMRT (DNA) sequencing, which is capable of delivering single-base resolution sequencing of 5-hmC.

Described is a two-step labeling process using &beta;-glucosyltransferase (&beta;-GT) to transfer an azide-glucose to 5-hmC, followed by click chemistry to transfer a biotin linker for easy and density-independent enrichment. This efficient and specific labeling method enables enrichment of 5-hmC with extremely low background and high-throughput epigenomic mapping via next-generation sequencing.

Captura selectivo de 5-hydroxymethylcytosine a partir de DNA genómico

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene ...

Assessing Differences in Sperm Competitive Ability in Drosophila

Competition among conspecific males for fertilizing the ova is one of the mechanisms of sexual selection, i.e. selection that operates on maximizing the number of successful mating events rather than on maximizing survival and viability 1. Sperm competition represents the competition between males after copulating with the same female 2, in which their sperm are coincidental in time and space. This phenomenon has been reported in multiple species of plants and animals 3. For example, wild-caught D. melanogaster females usually contain sperm from 2-3 males 4. The sperm are stored in specialized organs with limited storage capacity, which might lead to the direct competition of the sperm from different males 2,5.
Comparing sperm competitive ability of different males of interest (experimental male types) has been performed through controlled double-mating experiments in the laboratory 6,7. Briefly, a single female is exposed to two different males consecutively, one experimental male and one cross-mating reference male. The same mating scheme is then followed using other experimental male types thus facilitating the indirect comparison of the competitive ability of their sperm through a common reference. The fraction of individuals fathered by the experimental and reference males is identified using markers, which allows one to estimate sperm competitive ability using simple mathematical expressions 7,8. In addition, sperm competitive ability can be estimated in two different scenarios depending on whether the experimental male is second or first to mate (offense and defense assay, respectively) 9, which is assumed to be reflective of different competence attributes.
Here, we describe an approach that helps to interrogate the role of different genetic factors that putatively underlie the phenomenon of sperm competitive ability in D. melanogaster.

Assessing Differences in Sperm Competitive Ability in Drosophila

Differential sperm competitive ability among Drosophila males with distinct genotypes can be ascertained through double-mating experiments. Each of these experiments involves one of the males of interest and a reference male. Readily identifiable markers in the progeny allow inference of the fraction of individuals fathered by each male.

Avaliar as diferenças na capacidade competitiva do esperma em<em&gt; Drosophila</em

Competition among conspecific males for fertilizing the ova is one of the mechanisms of sexual selection, i.e. selection that operates on maximizing the ...