ברצוננו להודות לד"ר ווסלי וונג על הנחת היסודות לפרוטוקול הזה ולחונכותו החשובה. עבודה זו נתמכה בחלקה על ידי המכונים הלאומיים לבריאות (מענקים R01GM127575 ו R01GM121584) וקרן וולש (גרנט A-1715).

1. בניית פלסמיד
<ol><li>התחילו בהחלטה איזה חלבון היסטון יהיה אצטילאט ובאיזה אתר ליסטין. מוטציה האתר כדי לעצור ענבר קודון (TAG) באמצעות mutagenesis מכוון האתר. הערה: ישנם ארבעה פלסמידים שתוכננו בעבר מנוצלים לביטוי של חלבוני היסטון. כל ארבעת חלבוני ההיסטון שוכפלו לווקטור pETDuet-1 עם תג היסטידין N-terminal. Histone H4 כולל גם תג SUMO, המקור של colE1 שכפול עם מספר עותק של כ 40, אמיטצילין עמיד, ו מקדם T7.<ol>
<li>עצבו פריימרים קדמיים ומתהווכים המכילים מוטציית TAG באתר הרצוי (החלפת קודון ליצין קיים בקודון עצירת הענבר) באחד מארבעת פלסמידי החלבון של היסטון.</li>
		<li>השתמש ב- PCR שלם כדי להגביר את התג המכיל פלסמיד. קבעו טמפרטורת חישול מתאימה לפריימרים. באופן כללי, טמפרטורת ההיתוך (Tm)של פרייומרים מינוס 5 מעלות צלזיוס יהיה מספיק. אם יש קושי בהשגת מוצר PCR, ניתן להשתמש במעבר טמפרטורה סביב Tm - 5 °C (60 °F) כדי למטב את טמפרטורת חישול להגברה. הערה: בניסוי זה פולימראז PFU מבוטא בתוך הבית שימש במשך 30 מחזורים עם התנאים הבאים: 94 °C (94 °C (30 s (denaturation), חישול טמפרטורה עבור 30 s, ו 72 °C (6 דקות (או 1 דקה לקילו-בייס-זוגות). לפרטים נוספים על סוג זה של שיטת PCR ראו ליו ונייסמית'7.</li>
		<li>נקה את מוצר ה- PCR באמצעות ערכת ניקוי PCR על-ידי ביצוע פרוטוקול היצרן. לנתח את מוצר PCR על ידי אלקטרופורזה ג'ל agarose וכתמים אתידיום ברומיד הבאים.</li>
		<li>Ligate פלסמיד על ידי דגירה עם T4 ligase לילה ב 16 °C (66 °F).</li>
	</ol>
</li>
	<li>ראשית להפוך את תג המכיל פלסמיד (AmpR)לתוך כימית מוסמך Escherichia coli. בחר מינימום של 4 מושבות מהשינוי ולטהר את הפלסמיד. הפוך את מלאי התאים של כל אחד עם גליצרול בשיטות סטנדרטיות ולאחסן ב -80 מעלות צלזיוס. שלח רצף כדי לאשר את המוטציה הרצויה TAG.</li>
	<li>לאחר שהרצף מאושר, הפוך במשותף את הפלסמיד המכיל תג (AmpR)עם pEVOL-AckRS (ChlR)לקובB בעל יכולת כימית (הליסין deacetylase ההיסטון היחיד הידוע בתאי BL21 E. coli). pEVOL הוא פלסמיד עם מספר עותק בינוני למקור p15A בעל העתקה נמוכה. הערה: סדרת pEVOL של פלסמידים נבנו בהתבסס על מחקרים קודמים שהראו ביטוי מוגבר של זוג aaRS / tRNATyr אורתוגונלי היה יעיל בהפחתת חיתוך חלבון ובהגדלת התפוקה הכוללת של חלבונים מוטנטים8. אם תאי מחיקה של CobB אינם נגישים, המשך עם תאי BL21 בעלי יכולת כימית. CobB הוא ליצרין ליצרין דמוי סירטואין וניקוטינמיד ניתן להוסיף בריכוז סופי של 5 מ"מ במהלך ביטוי חלבון היסטון כדי לעכב את CobB כגישה חלופית9.</li>
	<li>הפוך מלאי תא ולאחסן ב -80 °C (69 °F).</li>
</ol>2. ביטוי חלבון histone אצטילאט
<ol><li>הכן 1 L של מדיה 2YT autoclaved (או נפח של בחירה) בבקבוק תרבות.</li>
	<li>לחסן 20 מ"ל של 2YT מדיה המכילה את האנטיביוטיקה המתאימה עם מלאי תאים טרנספורמציה משותפת כי יש פלסמיד המכיל תג (AmpR)ו pEVOL-AckRS (ChlR)ולגדול ב 37 °C (70 °F) כדי OD = 0.6 (4-6 שעות).</li>
	<li>הוסיפו את האנטיביוטיקה המתאימה ל-1 ליטר של מדיה 2YT אוטומטית וחסן עם תרבות המתנע של 20 מ"ל. לגדול ב 37 °C (70 °F) כדי OD = 0.6-0.8 (2-3 שעות).</li>
	<li>הוסף סוכני גרימת אצטיליסין (AcK) לריכוזים הסופיים של IPTG 1 מ"מ, 0.2% arabinose, ו AcK 5 mM.</li>
	<li>לגדל את התרבות ב 37 °C (67 °F) עבור 6-8 שעות.</li>
	<li>כדורי תאים ב 2,700 x g במשך 15 דקות.</li>
	<li>לאחסן את גלולת התא ב -80 מעלות צלזיוס לילה.</li>
	<li>מצעד זה ואילך לשמור את המדגם על הקרח כל הזמן. להמיס את גלולת התא ב 50 מ"ל של מאגר תמוגה היסטון לכל 1 L של תרבות.</li>
	<li>Sonicate על פי המחזור הבא: 1 s על, 1 הנחה, סה"כ בזמן: 3 דקות ב 60% משרעת.</li>
	<li>גופי הכללה גלולה ב 41,600 x g במשך 45 דקות.</li>
	<li>השלך את גופי ההכללה העל-טבעיים וההתחדשות ב- 30 מ"ל של מאגר תמוגה של היסטון. גלולה הכללה bodes ב 41,600 x g במשך 30 דקות.</li>
	<li>השלך את גופי הכללה supernatant ו resuspend ב 30 מ"ל של חיץ לשטוף גלולה. גופי הכללה גלולה ב 41,600 x g במשך 30 דקות.</li>
	<li>להשליך את גופי הכללה supernatant ולהמיס ב 25 מ"ל של 6 M Guanidine הידרוכלוריד (GuHCl) חיץ. דגירה עם עצבנות ב 37 °C (69 °F) עבור 1 שעות. הערה: במידת הצורך, גופי הכללה ניתן לדגור עם עצבנות לילה ב 4 מעלות צלזיוס.</li>
	<li>גלולה הכללה bodes ב 41,600 x g במשך 45 דקות. דגירה supernatant עם 1 מ"ל של שף Ni-NTA שווה עם 6 M GuHCl חיץ עבור 2 שעות.</li>
	<li>המשך עם טיהור Ni-NTA בתנאים מפורקים. שטפו את העמודה עם נפח של 3 עמודות של מאגר שטיפת עמודות. חלבון histone Elute עם 10 מ"ל של חיץ אלוטיון. הערה: ניסיון לרכז את החלבון כאן הוא אופציה אבל היסטוני אצטילציה הם מאוד בלתי צפויים והוא יכול בקלות לזרז. לא מומלץ להתרכז מעבר ל-2 מ"ל בנפח הכולל.</li>
	<li>דיאליז נרחב חלבון histone אצטילאט נגד 5% חומצה אצטית חוצץ כדי להסיר מלחים. Dialyze עבור 3 שעות בכל פעם ב 4 מעלות צלזיוס, החלפת חיץ טרי מינימום של 6 פעמים. הערה: לשיפור טוהר החלבון, קיימת אפשרות לחייג נגד מים טהורים. עם זאת, זה גורם משקעים משמעותיים וירידה בתפוקה אשר עשוי להיות לא רצוי עבור חלבונים histone אצטילציה בתשואה נמוכה.</li>
	<li>Aliquot ו lyophilize חלבון, ולאחסן ללא הגבלת זמן ב -80 מעלות צלזיוס. חלבוני היסטון מסוג פראי מניבים בדרך כלל 10-50 מ"ג/ל' ואילו חלבוני היסטון עם אצטילאט מניבים פחות מ-10 מ"ג/ליטר בהתאם לאתר הליצין הספציפי. לדוגמה, H3K79Ac ממוצעים 5 מ"ג / ליטר.</li>
</ol>3. ביטוי חלבון היסטון מסוג פראי
<ol><li>להרכבת נוקלאוזומים מלאים, יש לבטא את כל 4 חלבוני ההיסטון. כאשר מבטאים ומטהרים היסטונים מסוג פראי הפרוטוקול זהה להיסטוני האצטילאט למעט הדברים הבאים:<ol>
<li>אל תבצע המרה משותפת. אין להשתמש ב- pEVOL-AcKRS עבור ביטוי histone מסוג בר. התאימו אנטיביוטיקה בהתאם.</li>
		<li>אין להשתמש בקו תא מחיקה של CobB או להוסיף Nicotinamide, AcK או arabinose במהלך אינדוקציה של ביטוי תאי.</li>
	</ol>
</li>
</ol>4. הכנת 601 DNA
הערה: רצף דנ"א ממוטב שתוכנן בעבר למיקום נוקלאוזום ישיר מורכב עם תמנוני היסטון כדי לייצר מונונוקלאוזום ביעילות גבוהה. רצף זה נקרא 601 DNA או רצף Widom. רצף זה הפך לרצף הדנ"א הסטנדרטי למחקרי חוץ גופיות של נוקלאוזומים ממסיעות שיפוץ כרומטין למדידות מולקולה אחת10.
<ol><li>כדי להכין כמויות משמעותיות של 601 DNA להרכבה גרעינית, להפוך pGEM-3z/601 לתוך למעלה 10 תאים ולגדול 10 מ"ל של תרבות עבור הגברה פלסמיד ומיצוי. השתמש בערכת חילוץ פלסמיד ופעל בהתאם להמלצת היצרן.</li>
	<li>השתמש בפולימראז PFU מבוטא בתוך הארגון (יעיל יותר) עבור פרוטוקול הגברה זה. הגדר תגובת PCR: לתגובת 250 μL, להשתמש 207.5 μL autoclaved MQ H2O, 25 μL 10x PFU Buffer, 5 μL קדימה פריימר: ctggagaatccctggccg, 5 μL הפוך פריימר: acaggatgtatatatctctgacacg, 5 μL dNTP לערבב, 2.5 מיקרול PFU אנזים. אנחנו בדרך כלל רצים 60 תגובות בבת אחת כדי לקבל מספיק DNA להרכיב.</li>
	<li>השתמש בטמפרטורת חישול של 52 °C (70 °F) עבור 30 s וזמן הארכה של 30 s אם באמצעות פולימראז PFU. אחרת, פעל בהתאם לתנאים המומלצים על-ידי היצרנים.</li>
	<li>לאחר ש- PCR נעשה, השתמש בערכת ניקוי PCR לבחירתך כדי לטהר את מוצר PCR.</li>
</ol>5. הרכבה של אוקטמר היסטון
<ol><li>להמיס aliquots של כדורי חלבון histone H2A, H2B, H3, ו H4 כך שיש מלאי נפרד של כל חלבון histone במאגר GuHCl עם נפח כולל של 100 μL.</li>
	<li>לחשב את הריכוז של כל חלבון histone על ידי מדידת ספיגת A280.</li>
	<li>אם הספיגה גדולה מ-1 עבור חלבון כלשהו, יש לדלל עם מאגר GuHCl כדי לקבל ריכוז מדויק יותר.</li>
	<li>ערבבו חלבוני H2A ו-H2B ביחס טוחנת של 1:1 ודללו לריכוז חלבון כולל של 4 מיקרוגרם/μL. חזרו על הפעולה עבור H3 ו-H4.</li>
	<li>חייג ברצף ב- 4 °C (70 °F) מול מאגר TE של 2 M למשך לילה, מאגר TE M אחד עבור 2 שעות ומאגר TE של 0.5 M למשך 5 שעות. הערה: השלב השני והשלישי של הדיאליזה גורם קונפורמציות לא יציבות של חלבון לזרז החוצה. הוא צפוי לראות משקעים כבדים בשלבים אלה.</li>
	<li>הסר משקעים על ידי צנטריפוגה ב 16,800 x g ב 4 מעלות צלזיוס.</li>
	<li>שוב, לחשב את הריכוז של דימרים histone (תערובת H2A / H2B) ו tetramers (תערובת H3/H4) מדידת ספיגת A280.</li>
	<li>מערבבים דימרים וטטרמה ביחס טוחנת של 1:1 ומתאימים את NaCl ל-2 מ' על ידי תוספת של NaCl מוצק.</li>
	<li>תמנון Histone ניתן לאחסן ב 4 מעלות צלזיוס והוא יציב יותר מאשר dimers ו tetramers. לעולם אל תקפיא את תמנון היסטון מכיוון שזה יכול לגרום לפירוק.</li>
	<li>אם הרכבה עם היסטוני אצטילאט, פשוט להחליף את החלבון סוג הבר עם חלבון אצטילאט בהליך.</li>
</ol>6. הרכבה נוקלאוזום
<ol><li>השתמש במאגר TE 100x וב- NaCl מלא כדי להתאים 601 דנ"א למאגר TE של 2M. הוסף את ה- DNA של 601 במאגר TE של 2M לתמנון histone ביחס טוחנת של 0.85:1 ל- 0.90:1. ניתן להוסיף יחס נמוך יותר של דנ"א אם קיים דנ"א חופשי בניתוח משמרת הג'ל.</li>
	<li>מעבירים את תערובת הדנ"א-histone לשקית דיאליזה ומניחים כ-200 מ"ל של מאגר TE 2M (או יותר אם מרכיבים דגימות מרובות) ומערבבים בעדינות רבה ב-4 מעלות צלזיוס.</li>
	<li>הגדר משאבה פריסטלית לטיהור כדי לטפטף באיטיות ללא מאגר TE מלח. כאשר עוצמת הקול הוכפלה בערך, שפוך חצי מעוצמת הקול. עשה זאת לפחות 4 פעמים בסך הכל. עם משאבה זה יכול לקחת 4-8 שעות בהתאם לנפח ההתחלה. גרעינים נוצרים כאשר ריכוז המלח מצטמצם ל-150 מ"ר (נמדד על ידי מד מליחות).</li>
	<li>לאחר ריכוז המלח מצטמצם ל 150 מ"מ, dialyze נגד מאגר TE 20 מ"מ לילה.</li>
	<li>הסר משקעים על ידי צנטריפוגה ולמדוד את הריכוז של הגרעינים על ידי קריאהA 260 באמצעות קורא צלחת.</li>
	<li>הוסף פרוטאז His-TEV (TEV: נוקלאוזום 1:30, w:w) ודגר לילה ב 4 מעלות צלזיוס כדי להסיר את כל תגי היסטידין. הסר את זיהומים תג היסטידין מתמיסת הגרעין על ידי שף Ni-NTA למשוך למטה.</li>
	<li>כדי למקם את הגרעין הומוגנית המדגם, דגירה ב 60 °C (60 °F) במשך 1 שעות. הערה: עבור אתרים עם אצטילאט שאינם יציבים במיוחד, ייתכן שצעד זה לא מומלץ.</li>
	<li>יש לאחסן גרעינים לטווח קצר (כמה שבועות) ב-4 מעלות צלזיוס.</li>
	<li>לאחסון לטווח ארוך, נוקלאוזומים dialyze נגד מאגר אחסון ולאחסן ב -80 °C (60 °F).</li>
</ol>

<ol>
	<li>Srinivasan, G., James, C. M., Krzycki, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysine+encoded+by+UAG+in+Archaea:+Charging+of+a+UAG-Decoding+specialized+tRNA.">Pyrrolysine encoded by UAG in Archaea: Charging of a UAG-Decoding specialized tRNA.</a> Science. 296 (5572), 1459-1462 (2002).</li><li>Wan, W., Tharp, J. M., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysyl-tRNA+synthetase:+an+ordinary+enzyme+but+an+outstanding+genetic+code+expansion+tool.">Pyrrolysyl-tRNA synthetase: an ordinary enzyme but an outstanding genetic code expansion tool.</a> Biochimica Et Biophysica Acta. 1844 (6), 1059-1070 (2014).</li><li>Umehara, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-Acetyl+lysyl-tRNA+synthetases+evolved+by+a+CcdB-based+selection+possess+N-acetyl+lysine+specificity+in+vitro+and+in+vivo.">N-Acetyl lysyl-tRNA synthetases evolved by a CcdB-based selection possess N-acetyl lysine specificity in vitro and in vivo.</a> FEBS Letters. 586 (6), 729-733 (2012).</li><li>Hsu, W. W., Wu, B., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sirtuins+1+and+2+are+universal+histone+deacetylases.">Sirtuins 1 and 2 are universal histone deacetylases.</a> ACS Chemical Biology. 11 (3), 792-799 (2016).</li><li>Wang, W. W., Zeng, Y., Wu, B., Deiters, A., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+chemical+biology+approach+to+reveal+Sirt6-targeted+histone+H3+sites+in+nucleosomes.">A chemical biology approach to reveal Sirt6-targeted histone H3 sites in nucleosomes.</a> ACS Chemical Biology. 11 (7), 1973-1981 (2016).</li><li>Wang, W. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+click+chemistry+approach+reveals+the+chromatin-dependent+histone+H3K36+deacylase+nature+of+SIRT7.">A click chemistry approach reveals the chromatin-dependent histone H3K36 deacylase nature of SIRT7.</a> Journal of the American Chemical Society. 141 (6), 2462-2473 (2019).</li><li>Liu, H., Naismith, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+one-step+site-directed+deletion,+insertion,+single+and+multiple-site+plasmid+mutagenesis+protocol.">An efficient one-step site-directed deletion, insertion, single and multiple-site plasmid mutagenesis protocol.</a> BMC Biotechnology. 8 (1), 91 (2008).</li><li>Young, T. S., Ahmad, I., Yin, J. A., Schultz, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+enhanced+system+for+unnatural+amino+acid+mutagenesis+in+E.+coli.">An enhanced system for unnatural amino acid mutagenesis in E. coli.</a> Journal of Molecular Biology. 395 (2), 361-374 (2010).</li><li>Gallego-Jara, J., &#201;cija Conesa, A., de Diego Puente, T., Lozano Terol, G., C&#225;novas D&#237;az, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+CobB+kinetics+and+inhibition+by+nicotinamide.">Characterization of CobB kinetics and inhibition by nicotinamide.</a> PLoS One. 12 (12), 0189689 (2017).</li><li>Lowary, P. T., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+DNA+sequence+rules+for+high+affinity+binding+to+histone+octamer+and+sequence-directed+nucleosome+positioning.">New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning.</a> Journal of Molecular Biology. 276 (1), 19-42 (1998).</li><li>Zhao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+basis+of+tight+nuclear+tethering+and+inactivation+of+cGAS.">The molecular basis of tight nuclear tethering and inactivation of cGAS.</a> Nature. 587 (7835), 673-677 (2020).</li><li>Burdette, D. L., Vance, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+and+the+innate+immune+response+to+nucleic+acids+in+the+cytosol.">STING and the innate immune response to nucleic acids in the cytosol.</a> Nature Immunology. 14 (1), 19-26 (2013).</li><li>Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+immune+DNA+sensing+pathways:+STING,+AIMII+and+the+regulation+of+interferon+production+and+inflammatory+responses.">Innate immune DNA sensing pathways: STING, AIMII and the regulation of interferon production and inflammatory responses.</a> Current Opinion in Immunology. 23 (1), 10-20 (2011).</li><li>Ablasser, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=cGAS+produces+a+2'-5'-linked+cyclic+dinucleotide+second+messenger+that+activates+STING.">cGAS produces a 2'-5'-linked cyclic dinucleotide second messenger that activates STING.</a> Nature. 498 (7454), 380-384 (2013).</li><li>Gao, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+[G(2',5')pA(3',5')p]+is+the+metazoan+second+messenger+produced+by+DNA-activated+cyclic+GMP-AMP+synthase.">Cyclic [G(2',5')pA(3',5')p] is the metazoan second messenger produced by DNA-activated cyclic GMP-AMP synthase.</a> Cell. 153 (5), 1094-1107 (2013).</li><li>Zhao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conserved+PLPLRT/SD+motif+of+STING+mediates+the+recruitment+and+activation+of+TBK1.">A conserved PLPLRT/SD motif of STING mediates the recruitment and activation of TBK1.</a> Nature. 569 (7758), 718-722 (2019).</li></ol>

אין אינטרסים כלכליים מתחרים להצהיר על ידי אף אחד מהכותבים.

זה חיוני כדי לעקוב אחר פרוטוקול זה בכל פרט במהלך ניסוי. Nucleosomes אינם יציבים מאוד הרבה ניסוי וטעייה נכנסה לתוך קביעת פרוטוקול זה. זה המפתח להסרת משקעים בכל שלב (או בכל פעם שנצפה) כי חלקיקים יכולים בקלות להפריע לתהליכי ההרכבה. תמיד לשמור דגימות היסטון על קרח. אם נוקלאוזומים מאוחסנים ב 4 מעלות צל...

השתמשנו ב-PylRS וב-tRNAPyl כדי לסנתז ולהרכיב מונונוקלאוזומים משוחזרים עם היסטוני אצטילציה ספציפיים לאתר. PylRS הוכיחה את עצמה ככלי להרחבת קוד גנטי לייצור חלבונים עם שינויים לאחר תרגום (PTMs) והתפתחה גנטית כדי לשלב כ -200 ncAAs שונים. PylRS משלבת בקודון עצירת ענבר, הסרת תחרות מחומצות אמינו אחרות במהלך התרגום. PylRS התגלה לראשונה בארכיאולוגיה מתנוגנית, ומאז נוצל בביולוגיה כימית כדי לשלב קבוצות כימיות תגובתיות חדשניות לחלבונים1,2.
MmAcKRS1 התפתח מ מתנוזרצ'ינה mazei PylRS ומשמש לעתים קרובות במעבדה שלנו לסינתזה של חלבונים acetylated3,4,5,6. MmAcKRS1 מספק AcK באתר מוטציה ענבר mRNA של בחירה במהלך התרגום ב Escherichia קולי. טכניקה זו שימשה בעבר לשלב AcK ב K4, K9, K14, K18, K23, K27, K36, K56, K64, ו K79 היסטון H3 לידין אתרים ללמוד את הפעילות של Sirtuin 1, 2, 6, ו 7 על מונונוקלאוזומים acetylated4,5,6. כאן אנו מפרטים שיטה זו כדי להביע היסטונים אצטילאטים ו לבנות מחדש נוקלאוזומים acetylated.

<table><tbody><tr><td>0.5 M TE Buffer</td><td>NA</td><td>NA</td><td>0.5 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td></tr><tr><td>1 M TE Buffer</td><td>NA</td><td>NA</td><td>1 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td></tr><tr><td>100x TE Buffer</td><td>NA</td><td>NA</td><td></td></tr><tr><td>2 M TE Buffer</td><td>NA</td><td>NA</td><td>2 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td></tr><tr><td>20 mM TE Buffer</td><td>NA</td><td>NA</td><td>20 mM NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td></tr><tr><td>6 M GuHCl</td><td></td><td></td><td>6M guanidinium chloride, 20 mM Tris, 500 mM NaCl, pH 8.0</td></tr><tr><td>Acetyllysine</td><td></td><td></td><td></td></tr><tr><td>Column Wash Buffer</td><td>NA</td><td>NA</td><td>6 M urea, 500 mM NaCl, 20 mM Tris, 20 mM imidazole pH 7.8</td></tr><tr><td>Elution Buffer</td><td>NA</td><td>NA</td><td></td></tr><tr><td>Fisherbrand&amp;nbsp;Variable-Flow Chemical Transfer Pump</td><td>Fischer Scientific</td><td>15-077-67</td><td></td></tr><tr><td>His-TEV protease</td><td></td><td></td><td></td></tr><tr><td>Histone Lysis Buffer</td><td>NA</td><td>NA</td><td>60 mM Tris, 100 mM NaCl, 0.5% Triton-X100 (v/v), 1 mM PMSF pH 8.0</td></tr><tr><td>Ni-NTA Resin</td><td></td><td></td><td>6 M urea, 500 mM NaCl, 20 mM Tris, 250 mM imidazole, pH 7.8</td></tr><tr><td>PCR Clean-Up Kit</td><td>Epoch Life Sicences</td><td>2360050</td><td></td></tr><tr><td>Pellet Wash Buffer</td><td>NA</td><td>NA</td><td>60 mM Tris, 100 mM NaCl, pH 8.0</td></tr><tr><td>petDUET-His-SUMO-TEV-H4</td><td></td><td></td><td></td></tr><tr><td>petDUET-His-TEV-H2A</td><td></td><td></td><td></td></tr><tr><td>petDUET-His-TEV-H2B</td><td></td><td></td><td></td></tr><tr><td>petDUET-His-TEV-H3</td><td></td><td></td><td></td></tr><tr><td>pEVOL-AckRS</td><td>Addgene</td><td>137976</td><td></td></tr><tr><td>pGEM-3z/601</td><td>Addgene</td><td>26656</td><td></td></tr><tr><td>Storage Buffer</td><td>NA</td><td>NA</td><td>20 mM NaCl, 20 mM Tris, 20 mM NaCl, 1 mM EDTA, 20% glycerol, pH 7.8</td></tr><tr><td>Thermocycler</td><td></td><td></td><td></td></tr></tbody></table>

site specific lysine acetylation of histones for nucleosome reconstitution using genetic code expansion in escherichia coli

חלבוני histone אצטילאט יכול לבוא לידי ביטוי בקלות ב Escherichia coli קידוד מוטציה, Nε-אצטיל-ליצין (AcK) ספציפי מתנוסרצ'ינה מזי פירוסין tRNA-סינתטאז (MmAcKRS1) ו tRNA קוגנטיבי שלה (tRNAPyl)להרכיב מונונוקלאוזומים משוחזרים עם היסטון אצטילאט ספציפי לאתר. MmAcKRS1 ו- tRNAPyl מספקים AcK באתר מוטציה ענבר ב mRNA של בחירה במהלך התרגום ב Escherichia coli. טכניקה זו שימשה בהרחבה כדי לשלב AcK באתרי ליזין H3. סינתזת Pyrrolysyl-tRNA (PylRS) ניתן גם להתפתח בקלות לשלב חומצות אמינו לא קאנוניות אחרות (ncAAs) עבור שינוי חלבון ספציפי לאתר או פונקציונליזציה. כאן אנו מפרטים שיטה לשלב AcK באמצעות מערכת MmAcKRS1 לתוך H3 histone ולשלב חלבוני H3 אצטילאט לתוך mononucleosomes מחדש. מונונוקלאוזומים משוחזרים אצטילאטים יכולים לשמש מבחנים ביוכימיים ומחייבים, קביעת מבנה ועוד. השגת מונונוקלאוזומים מותאמים היא חיונית לתכנון ניסויים הקשורים לגילוי אינטראקציות חדשות והבנת אפיגנטיקה.

ניתן להעריך דימרים, טטרמרים ושמיניות על ידי הפעלת ג'ל SDS PAGE של 12%(איור 1 ואיור 2). כאן ניתן לראות שלחלק מהטטרמרים בעלי האצטילאט יש תשואה נמוכה יותר מאחרים (איור 1). למעשה, ככל שאזור הליבה קרוב יותר לאזור הליבה, כך התשואה נצפתה נמ?...

Watch this Scientific Journal Video about Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli at JoVE.com

Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

כאן אנו מציגים שיטה לבטא חלבוני histone אצטילאט באמצעות הרחבת קוד גנטי להרכיב נוקלאוזומים מחדש במבחנה.

אתר ספציפי ליסין אצטילציה של היסטונים עבור שחזור Nucleosome באמצעות הרחבת קוד גנטי ב Escherichia קולי

Acetylated histone proteins can be easily expressed in Escherichia coli encoding a mutant, N&#949;-acetyl-lysine (AcK)-specific Methanosarcina mazi ...

site-specific-lysine-acetylation-histones-for-nucleosome

Research

Education

JoVE Journal

JoVE Core

Cell Biology

Biochemistry

Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Unit 1

Structure and Organization of DNA

SCIENTISTS IN ACTION

3.9K Views.  Texas A&M University. כאן אנו מציגים שיטה לבטא חלבוני histone אצטילאט באמצעות הרחבת קוד גנטי להרכיב נוקלאוזומים מחדש במבחנה.

Video: Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Reconstitution of Nucleosomes with Differentially Isotope-labeled Sister Histones

Asymmetrically modified nucleosomes contain the two copies of a histone (sister histones) decorated with distinct sets of Post-translational Modifications (PTMs). They are newly identified species with unknown means of establishment and functional implications. Current analytical methods are inadequate to detect the copy-specific occurrence of PTMs on the nucleosomal sister histones. This protocol presents a biochemical method for the in vitro reconstitution of nucleosomes containing differentially isotope-labeled sister histones. The generated complex can be also asymmetrically modified, after including a premodified histone pool during refolding of histone subcomplexes. These asymmetric nucleosome preparations can be readily reacted with histone-modifying enzymes to study modification cross-talk mechanisms imposed by the asymmetrically pre-incorporated PTM using nuclear magnetic resonance (NMR) spectroscopy. Particularly, the modification reactions in real-time can be mapped independently on the two sister histones by performing different types of NMR correlation experiments, tailored for the respective isotope type. This methodology provides the means to study crosstalk mechanisms that contribute to the formation and propagation of asymmetric PTM patterns on nucleosomal complexes.

This protocol describes the reconstitution of nucleosomes containing differentially isotope-labeled sister histones. At the same time, asymmetrically post-translationally modified nucleosomes can be generated after using a premodified histone copy. These preparations can be readily used to study modification crosstalk mechanisms, simultaneously on both sister histones, by using high-resolution NMR spectroscopy.

כינון של נוקלאוזום עם דיפרנציאלי איזוטופ שכותרתו היסטונים אחות

Asymmetrically modified nucleosomes contain the two copies of a histone (sister histones) decorated with distinct sets of Post-translational Modifications ...

Analysis of Histone Antibody Specificity with Peptide Microarrays

Post-translational modifications (PTMs) on histone proteins are widely studied for their roles in regulating chromatin structure and gene expression. The mass production and distribution of antibodies specific to histone PTMs has greatly facilitated research on these marks. As histone PTM antibodies are key reagents for many chromatin biochemistry applications, rigorous analysis of antibody specificity is necessary for accurate data interpretation and continued progress in the field. This protocol describes an integrated pipeline for the design, fabrication and use of peptide microarrays for profiling the specificity of histone antibodies. The design and analysis aspects of this procedure are facilitated by ArrayNinja, an open-source and interactive software package we recently developed to streamline the customization of microarray print formats. This pipeline has been used to screen a large number of commercially available and widely used histone PTM antibodies, and data generated from these experiments are freely available through an online and expanding Histone Antibody Specificity Database. Beyond histones, the general methodology described herein can be applied broadly to the analysis of PTM-specific antibodies.

This manuscript describes methods for applying peptide microarray technology to specificity profiling of antibodies that recognize histones and their post-translational modifications.

ניתוח של היסטון נוגדנים היסטון עם Microprays פפטיד

Post-translational modifications (PTMs) on histone proteins are widely studied for their roles in regulating chromatin structure and gene expression. The ...

Optimizing the Genetic Incorporation of Chemical Probes into GPCRs for Photo-crosslinking Mapping and Bioorthogonal Chemistry in Live Mammalian Cells

The genetic incorporation of non-canonical amino acids (ncAAs) via amber stop codon suppression is a powerful technique to install artificial probes and reactive moieties onto proteins directly in the live cell. Each ncAA is incorporated by a dedicated orthogonal suppressor-tRNA/amino-acyl-tRNA-synthetase (AARS) pair that is imported into the host organism. The incorporation efficiency of different ncAAs can greatly differ, and be unsatisfactory in some cases. Orthogonal pairs can be improved by manipulating either the AARS or the tRNA. However, directed evolution of tRNA or AARS using large libraries and dead/alive selection methods are not feasible in mammalian cells. Here, a facile and robust fluorescence-based assay to evaluate the efficiency of orthogonal pairs in mammalian cells is presented. The assay allows screening tens to hundreds of AARS/tRNA variants with a moderate effort and within a reasonable time. Use of this assay to generate new tRNAs that significantly improve the efficiency of the pyrrolysine orthogonal system is described, along with the application of ncAAs to the study of G-protein coupled receptors (GPCRs), which are challenging objects for ncAA mutagenesis. First, by systematically incorporating a photo-crosslinking ncAA throughout the extracellular surface of a receptor, binding sites of different ligands on the intact receptor are mapped directly in the live cell. Second, by incorporating last-generation ncAAs into a GPCR, ultrafast catalyst-free receptor labeling with a fluorescent dye is demonstrated, which exploits bioorthogonal strain-promoted inverse Diels Alder cycloaddition (SPIEDAC) on the live cell. As ncAAs can be generally applied to any protein independently on its size, the method is of general interest for a number of applications. In addition, ncAA incorporation does not require any special equipment and is easily performed in standard biochemistry labs.

A facile fluorescence assay is presented to evaluate the efficiency of amino-acyl-tRNA-synthetase/tRNA pairs incorporating non-canonical amino-acids (ncAAs) into proteins expressed in mammalian cells. The application of ncAAs to study G-protein coupled receptors (GPCRs) is described, including photo-crosslinking mapping of binding sites and bioorthogonal GPCR labeling on live cells.

אופטימיזציה של שיתוף גנטי של חומר כימי רגשים לתוך GPCRs עבור צילום-crosslinking מיפוי וכימיה Bioorthogonal בתאים בתרבית של חיה

The genetic incorporation of non-canonical amino acids (ncAAs) via amber stop codon suppression is a powerful technique to install artificial probes and ...

Chemistry

Detection of Post-translational Modifications on Native Intact Nucleosomes by ELISA

The genome of eukaryotes exists as chromatin which contains both DNA and proteins. The fundamental unit of chromatin is the nucleosome, which contains 146 base pairs of DNA associated with two each of histones H2A, H2B, H3, and H41. The N-terminal tails of histones are rich in lysine and arginine and are modified post-transcriptionally by acetylation, methylation, and other post-translational modifications (PTMs). The PTM configuration of nucleosomes can affect the transcriptional activity of associated DNA, thus providing a mode of gene regulation that is epigenetic in nature 2,3. We developed a method called nucleosome ELISA (NU-ELISA) to quantitatively determine global PTM signatures of nucleosomes extracted from cells. NU-ELISA is more sensitive and quantitative than western blotting, and is useful to interrogate the epiproteomic state of specific cell types. This video journal article shows detailed procedures to perform NU-ELISA analysis.

Nucleosome ELISA (NU-ELISA) is a sensitive and quantitative method to detect global patterns of post-translational modifications in preparations of native, intact nucleosomes. These modifications include methylations, acetylations, and phosphorylations at specific histone amino acid residues, and hence NU-ELISA provides a global proteomic assay of the overall chromatin modification states of specific cell types.

איתור של פוסט translational שינויים על nucleosomes אינטקט Native ידי ELISA

The genome of eukaryotes exists as chromatin which contains both DNA and proteins. The fundamental unit of chromatin is the nucleosome, which contains 146 ...

Biology

Repressing Gene Transcription by Redirecting Cellular Machinery with Chemical Epigenetic Modifiers

Regulation of chromatin compaction is an important process that governs gene expression in higher eukaryotes. Although chromatin compaction and gene expression regulation are commonly disrupted in many diseases, a locus-specific, endogenous, and reversible method to study and control these mechanisms of action has been lacking. To address this issue, we have developed and characterized novel gene-regulating bifunctional molecules. One component of the bifunctional molecule binds to a DNA-protein anchor so that it will be recruited to an allele-specific locus. The other component engages endogenous cellular chromatin-modifying machinery, recruiting these proteins to a gene of interest. These small molecules, called chemical epigenetic modifiers (CEMs), are capable of controlling gene expression and the chromatin environment in a dose-dependent and reversible manner. Here, we detail a CEM approach and its application to decrease gene expression and histone tail acetylation at a Green Fluorescent Protein (GFP) reporter located at the Oct4 locus in mouse embryonic stem cells (mESCs). We characterize the lead CEM (CEM23) using fluorescent microscopy, flow cytometry, and chromatin immunoprecipitation (ChIP), followed by a quantitative polymerase chain reaction (qPCR). While the power of this system is demonstrated at the Oct4 locus, conceptually, the CEM technology is modular and can be applied in other cell types and at other genomic loci.

Regulation of the chromatin environment is an essential process required for proper gene expression. Here, we describe a method for controlling gene expression through the recruitment of chromatin-modifying machinery in a gene-specific and reversible manner.

הדחקת שעתוק גנים על ידי ניתוב מחדש מכונות הסלולר עם המגבילים Epigenetic כימי

Regulation of chromatin compaction is an important process that governs gene expression in higher eukaryotes. Although chromatin compaction and gene ...

Bioengineering

<meta charset="utf8"></head><body>In Situ Nucleosome Reconstitution for Single-Molecule Studies

In Situ Nucleosome Assembly for Single-Molecule Correlative Force and Fluorescence Microscopy

Nucleosomes constitute the primary unit of eukaryotic chromatin and have been the focus of numerous informative single-molecule investigations regarding their biophysical properties and interactions with chromatin-binding proteins. Nucleosome reconstitution on DNA for these studies typically involves a salt dialysis procedure that provides precise control over the placement and number of nucleosomes formed along a DNA tether. However, this protocol is time-consuming and requires a substantial amount of DNA and histone octamers as inputs. To offer an alternative strategy, an in situ nucleosome reconstitution method for single-molecule force and fluorescence microscopy that utilizes the histone chaperone Nap1 is described. This method enables users to assemble nucleosomes on any DNA template without the need for strong nucleosome positioning sequences, adjust nucleosome density on demand, and use fewer reagents. In situ nucleosome formation occurs within seconds, offering a simpler experimental workflow and a convenient transition into single-molecule measurements. Examples of two downstream assays for probing nucleosome mechanics and visualizing the behavior of individual proteins on chromatin are further described.

<meta charset="utf8"></head><body>מחבר זרקור: הרכבה מחדש יעילה של נוקלאוזומים עבור טכניקות של מולקולה בודדת

This article presents a detailed experimental procedure for reconstituting nucleosome-containing DNA tethers for single-molecule correlative force and fluorescence microscopy. It further describes several downstream experiments that can be conducted to visualize the binding behavior of chromatin-interacting proteins and analyze changes in the physical properties of nucleosomes.

מכלול נוקלאוזומים באתרו עבור כוח מתאם של מולקולה בודדת ומיקרוסקופ פלואורסצנטי

Nucleosomes constitute the primary unit of eukaryotic chromatin and have been the focus of numerous informative single-molecule investigations regarding ...

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

Post-translational modifications that occur at specific positions of proteins have been shown to play important roles in a variety of cellular processes. Among them, reversible lysine acetylation is one of the most widely distributed in all domains of life. Although numerous mass spectrometry-based acetylome studies have been performed, further characterization of these putative acetylation targets has been limited. One possible reason is that it is difficult to generate purely acetylated proteins at desired positions by most classic biochemical approaches. To overcome this challenge, the genetic code expansion technique has been applied to use the pair of an engineered pyrrolysyl-tRNA synthetase variant, and its cognate tRNA from Methanosarcinaceae species, to direct the cotranslational incorporation of acetyllysine at the specific site in the protein of interest. After first application in the study of histone acetylation, this approach has facilitated acetylation studies on a variety of proteins. In this work, we demonstrated a facile protocol to produce site-specifically acetylated proteins by using the model bacterium Escherichia coli as the host. Malate dehydrogenase was used as a demonstration example in this work.

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

Genetic code expansion serves as a powerful tool to study a wide range of biological processes, including protein acetylation. Here we demonstrate a facile protocol to exploit this technique for generating homogeneously acetylated proteins at specific sites in Escherichia coli cells.

פרוטוקול נתיישב לייצר חלבונים Site-Specifically Acetylated Escherichia Coli

Post-translational modifications that occur at specific positions of proteins have been shown to play important roles in a variety of cellular processes. ...

Immunology and Infection

Application of MassSQUIRM for Quantitative Measurements of Lysine Demethylase Activity

Recently, epigenetic regulators have been discovered as key players in many different diseases 1-3. As a result, these enzymes are prime targets for small molecule studies and drug development 4. Many epigenetic regulators have only recently been discovered and are still in the process of being classified. Among these enzymes are lysine demethylases which remove methyl groups from lysines on histones and other proteins. Due to the novel nature of this class of enzymes, few assays have been developed to study their activity. This has been a road block to both the classification and high throughput study of histone demethylases. Currently, very few demethylase assays exist. Those that do exist tend to be qualitative in nature and cannot simultaneously discern between the different lysine methylation states (un-, mono-, di- and tri-). Mass spectrometry is commonly used to determine demethylase activity but current mass spectrometric assays do not address whether differentially methylated peptides ionize differently. Differential ionization of methylated peptides makes comparing methylation states difficult and certainly not quantitative (Figure 1A). Thus available assays are not optimized for the comprehensive analysis of demethylase activity.
Here we describe a method called MassSQUIRM (mass spectrometric quantitation using isotopic reductive methylation) that is based on reductive methylation of amine groups with deuterated formaldehyde to force all lysines to be di-methylated, thus making them essentially the same chemical species and therefore ionize the same (Figure 1B). The only chemical difference following the reductive methylation is hydrogen and deuterium, which does not affect MALDI ionization efficiencies. The MassSQUIRM assay is specific for demethylase reaction products with un-, mono- or di-methylated lysines. The assay is also applicable to lysine methyltransferases giving the same reaction products. Here, we use a combination of reductive methylation chemistry and MALDI mass spectrometry to measure the activity of LSD1, a lysine demethylase capable of removing di- and mono-methyl groups, on a synthetic peptide substrate 5. This assay is simple and easily amenable to any lab with access to a MALDI mass spectrometer in lab or through a proteomics facility. The assay has ~8-fold dynamic range and is readily scalable to plate format 5.

We present a method for using MALDI mass spectrometry and reductive methylation chemistry to quantify changes in lysine methylation.

יישום MassSQUIRM עבור מדידות כמותיות של פעילות Demethylase ליזין

Recently, epigenetic regulators have been discovered as key players in many different diseases 1-3. As a result, these enzymes are prime targets for small ...

אתר ספציפי ליסין אצטילציה של היסטונים עבור שחזור Nucleosome באמצעות הרחבת קוד גנטי ב Escherichia קולי

Summary

Explore More Videos

Chapters in this video

כינון של נוקלאוזום עם דיפרנציאלי איזוטופ שכותרתו היסטונים אחות

ניתוח של היסטון נוגדנים היסטון עם Microprays פפטיד

אופטימיזציה של שיתוף גנטי של חומר כימי רגשים לתוך GPCRs עבור צילום-crosslinking מיפוי וכימיה Bioorthogonal בתאים בתרבית של חיה

איתור של פוסט translational שינויים על nucleosomes אינטקט Native ידי ELISA

הדחקת שעתוק גנים על ידי ניתוב מחדש מכונות הסלולר עם המגבילים Epigenetic כימי

מכלול נוקלאוזומים באתרו עבור כוח מתאם של מולקולה בודדת ומיקרוסקופ פלואורסצנטי

מכלול נוקלאוזומים באתרו עבור כוח מתאם של מולקולה בודדת ומיקרוסקופ פלואורסצנטי

מכלול נוקלאוזומים באתרו עבור כוח מתאם של מולקולה בודדת ומיקרוסקופ פלואורסצנטי

פרוטוקול נתיישב לייצר חלבונים Site-Specifically Acetylated Escherichia Coli

יישום MassSQUIRM עבור מדידות כמותיות של פעילות Demethylase ליזין