사미르 Hamdan이 기술의 개발에 주었. E.을 대장균 단백질이 교수 닉 딕슨의 실험실에서 있으며, 울릉공 대학, 그리고 T7 단백질이 교수 찰스 리차드슨, 하버드 의과 대학에서입니다. 작품은 국립 보건원 (AMvO에 GM077248)과 제인 코핀 차일즈 재단 (JJL)에 의해 지원됩니다.

단일 분자 복제 실험을 수행하기 전에, 몇 가지 자료는 사전에 준비해야합니다. 1. DNA 복제 템플릿 복제 반응을위한 기판은 표준 분자 생물학 기법 1,2을 사용하여 준비 biotinylated, 꼬리 M13 롤링 서클입니다. 자료 : M13mp18 단일 좌초 DNA, Biotinylated 꼬리 oligonucleotide의 프라이머 (5&#39; - 비오틴 - T 36 AATTCGTAAT CATGGTCATAGCTGTTTCCT - 3 &#39;), T7의 DNA 중합 효소, 열 차단, Isoamyl / 페놀 알콜 / 클로로포름 <ol><li> TBS 버퍼 (330 NM 꼬리 oligo 33 NM M13)에 oligo의 10 배 초과를 추가하여 M13에 biotinylated oligo 꼬리를 어닐링. </li><li> 65 ° C 열 블록에서 가열하여 혼합합니다. 일단 가열, 열 블록을 해제하고 느린 냉각이 제대로 뇌관 어닐링 수 있습니다. </li><li> 64 NM T7의 DNA 중합 효소 및 dNTPs와 MgCl 2 포함 T7 복제 버퍼의 혼합물로 준비하는 M13을 추가합니다. </li><li> 37 반응 ° 12분 C를 품어 100 MM EDTA (에틸렌 다이아 민 테트라 초산)과 끄지. </li><li> 정화 채워진 - 인 제품의 DNA 페놀 / 클로로포름 / isoamyl 알콜 추출 및 TE 버퍼 또는 기타 적합한 저장 버퍼로 dialyze과 DNA 농도 (M13을 준비하는 잔여 복구 각 유기농 단계를 백 추출)을 결정과 함께. </li><li> 템플릿 준비 중 하나는 반복은 쉽게 단일 분자 실험의 수천 수백 정도, nanomolar 농도 템플릿의 몇 밀리리터를 만들 수 있습니다. </li></ol> 2. 기능화 Coverslips 유리 coverslip에 DNA를 부착, 유리 먼저 다음 biotinylated PEG 분자에 결합하는 aminosilane와 작용합니다. 이 코팅은 표면에 1,3와 함께 DNA와 복제 단백질의 특이 현상이 상호 작용을 줄일 수 있습니다. 재료 : 유리 coverslips, 스테 이닝 항아리, 3 aminopropyltriethoxysilane, 메톡시 - PEG5k - NHS 에스테르, 비오틴 - PEG5k - NHSester, 아세톤, 1M 코, 에탄올, 오븐, 목욕 sonicator을 <ol><li> 단지를 얼룩 및 에탄올과 함께 항아리를 채우는 그들을 배치하여 유리 coverslips을 철저히 청소. 30 분 Sonicate과 단지를 씻어 1 M 코와 함께 입력합니다. 30 분 모두 세척을 반복 Sonicate. </li><li> 첫 번째 작용화 반응 들면, 물의 모든 흔적은 삭제해야합니다. 10 분 아세톤과 sonicate로 항아리를 채우십시오. 아세톤과 함께 다시 항아리를 씻어. </li><li> 아세톤의 실란 시약의 2 % V / V 솔루션을 준비합니다. 얼룩 단지 추가 2 분 선동. 이 반응은 커플 유리에 aminosilane의 알콕시 그룹을 다음 커플링 단계 반응 아민을 떠나. 물을 큰 초과로 반응을 끄다. </li><li> 110 ° C 30 분간 오븐에서 그들을 베이킹하여 coverslips 건조. </li><li> 100 MM NaHCO 3 산도 8.2의 비오틴 PEG 혼합물 : 50:1 메톡시를 준비합니다. 0.2 % 주위 W / V biotinylated PEG을 목표로. </li><li> 마른 silanized coverslip 및 장소 위에 다른 coverslip에 PEG 혼합물의 피펫 100 μL. 유리 coverslip 스페이서를 포함하면 coverslips의 분리를 허용합니다. </li><li> 3 시간 동안 PEG 솔루션에 coverslips 부화 후 coverslips의 각 쌍을 분리하고 물로 씻어 광범위. 한 번만 측면이 PEG와 코팅 될 것이다 coverslips가 측면을 유지하는 작용주의하십시오. </li><li> 진공에서 coverslips하고 저장을 건조. 표면은 적어도 한 달 동안 안정적으로 유지하므로 coverslips 수십는 일괄로 작성하고 필요에 따라 사용할 수 있습니다. </li></ol> 이 자료는 미리 만든 다음 각각의 실험을 위해 사용해야합니다. 모든 단일 분자 실험을 시작하려면, 흐름 챔버를 조립하여 시작합니다. 3. 흐름 챔버 준비 실험 기능화 coverslip, 양면 테이프, 석영 튜브 슬라이드와 함께 건설 간단한 흐름 챔버를 사용하여 수행됩니다. 하나의 흐름 챔버는 각 단일 분자 실험 1,4에 대한 준비가되어 있습니다. 재료 : 양면 테이프, 면도날, 튜브, 빠른 건조 에폭시를위한 구멍이있는 석영 슬라이드, 기능화 coverslip (위 참조), Streptavidin 솔루션 (PBS 1 MG / ML 25 μL), 튜브, 차단 버퍼 (20 MM 트리스 산도 7.5, 2 MM EDTA (에틸렌 다이아 민 테트라 초산), 50 MM NaCl, 0.2 MG / ML BSA, 0.005 % 트윈 - 20) <ol><li> 나중 단계에 대한 기포를 제거하기 위해 건조기에 차단 버퍼의 20-25 ML을 배치하여 시작합니다. </li><li> PEG - 기능화 coverslip을 가지고 표면을 통해 PBS로 희석된 streptavidin 솔루션의 확산 125. streptavidin은 표면 biotins를 바인딩할 수 있도록, 챔버의 다른 부분을 준비하면서 20 분 동안 부화 이것을 둡니다. </li><li> 더블 사이드의 조각 컷D 테이프는 석영 슬라이드의 크기를 일치시킵니다. 흐름 챔버의 외곽선이 테이프 (1 MG / ML)에서 발행한 수 있도록 연필로 테이프에 튜브 구멍의 위치를​​ 표시합니다. </li><li> 구멍 주변 2mm 전체 사각형을 확인합니다. 이것은 흐름 채널 역할을하므로, 튜브의 입구 및 출구 주위에 바로 측면을 만들고 방을 떠날해야합니다. 원하는 경우, 여러 채널 또는 다른 크기를 사용할 수 있습니다. </li><li> 채널에 노 접착제 protrudes 있는지 바로 깨끗한 상처를 만드는 그려진 윤곽을 따라 잘라. </li><li> 석영 철저하게 사용하는 아세톤 또는 이전 유량 셀 구조에서 접착제를 제거하기 위해 에탄올을 청소하십시오. </li><li> 채널 개요 최고의 정렬을 찾아 접착제 후원의 한쪽을 제거하고 조심스럽게 석영 슬라이드에 테이프를 넣으십시오. 입구와 콘센트 구멍이 남아 차단을 해제해야로서 제대로 테이프를 정렬하기 위해주의하십시오. </li><li> 흐름 세포의 입구 및 출구에 대한 튜브의 길이를 자르고. 그것은 튜브가 챔버 바닥에 대한 평면 눌러 않도록 대해 30 ° 각도로 튜브의 끝을 잘라하는 데 도움이됩니다. 다음 단계에서 흐름 세포에 쉽게 부착 그들을 일시 중지를 지원 일종의에 튜브를 삽입합니다. </li><li> 물로 깨끗이 streptavidin - 코팅 coverslip을 씻어 압축 공기를 사용하여 건조. 한 측면이 작용이라는 걸 기억하고, coverslip을 넘겨하지 않도록주의합니다. 테이프 백업의 다른 측면을 제거하고 coverslip 위에 석영 슬라이드를 놓으십시오. </li><li> 가볍게 접착제에 갇혀있는 공기를 밖으로 밀어 coverslip을 누르십시오. 이것은 흐름 채널로 받고있는 공기 방울을 방지하는 데 도움이됩니다. </li><li> 에폭시와 챔버의 측면을 봉쇄. 에폭시와 장소에서 석영과 인감 구멍에 상처 튜브를 삽입합니다. 이것은 몇 분 동안 건조해야합니다. </li><li> 일단 건조, 튜브 중 하나를 통해 degassed 차단 버퍼의 일부를 당겨 표면을 차단하고 시작합니다. 21 게이지 바늘은 0.76 mm의 튜브 내부에 완벽하게 맞는 데요. 공기 방울을 제거하기 위해 몇 시간을 플러시하고, 챔버가 최소 절반 시간 동안 부화 수 있습니다. </li></ol> 4. 단일 분자 복제 실험 자료 : 준비 흐름 챔버, SYTOX 오렌지, TIRF 현미경, 532 nm의 레이저, CCD 카메라, 이미지 수집 소프트웨어와 컴퓨터, 롤링 - 원형 DNA 기판, 복제 단백질 <ol><li> 흐름 세포가 차단되고 나면 모든 것이 단일 분자 실험을 시작할 준비가되어 있습니다. </li><li> 흐름 세포를 가지고 현미경 스테이지에 배치하십시오. 무대 클립 장소에 챔버를 잡고 흐름 채널이 바로 Y - 축을 따라 위치되어 있는지 확인합니다. </li><li> 큰 직경의 튜브 커넥터 또는 바늘을 사용하여 주사기 펌프로 유량 셀 콘센트 튜브를 연결합니다. 버퍼를 차단의 입구를 삽입하고 튜브에 공기를 제거하는 주사기에 다시 가져옵니다. 콘센트 튜브의 부드러운 영화는 흐름 세포에 갇혀있는 공기 방울을 취소 도움이 될 것입니다. </li><li> 차단 버퍼 1 ML 25 시까지 재고 DNA 템플릿을 희석. DNA의 좋은 표면 범위를 허용하는 중간 유량의 챔버로 흐름. 0.025 ML / 30 분 분 잘 작동합니다. 이것은 coverslips의 각 배치에 대해 표면에있는 또는 실험을 위해 얼마나 많은 원하는 얼마나 많은 DNA 분자에 따라 다양한하실 수 있습니다. </li><li> DNA가되면, 차단 버퍼를 사용하여 여분의 DNA를 씻으십시오. 모두 무료로 DNA를 제거하기 위해 최소한 200 흐름 - 세포 볼륨에 씻으십시오. </li><li> 복제 버퍼를 degassing 시작합니다. E.을위한 대장균 복제 실험, 37에서이 작업을 수행 ° C 온수 흐름 챔버에서 거품의 위험을 줄일 수 있습니다. </li><li> 레이저와 카메라를 켜십시오. 냉각 CCD는 사용하기 전에 온도에 도달해야합니다. </li><li> 37 ° C의 실험을 수행하는 경우에 히터를 켭니다. 목적은 흐름 세포 접촉에 또는 나중에 방열판 수 있어야합니다. </li><li> 세정 degassing 후, 반응이 준비하실 수 있습니다. 믹스 세포핵, DTT, 그리고 복제 버퍼에 SYTOX. 다음 단백질을 추가하고 부드럽게 섞는다. </li><li> 흐름 세포에 반응 혼합물을 흐름. 이 흐름 속도는 dsDNA를 스트레칭 충분해야합니다. 2 mm 폭 100 μm의 높이 흐름 채널에 대한 0.04 ML / 분 잘 작동합니다. </li><li> 챔버를 입력하고 영상을 시작으로 혼합 시간을 허용합니다. 좋은 팁은 채널의 측면보기의 필드를 이동하고 접착 재료에 집중하는 것입니다. 이것은 초점을위한 표면 근처에 있도록합니다. </li><li> 레이저 전력, 현미경의 초점을, 그리고 TIRF 각도를 조정합니다. 스테인드 DNA의 photocleavage을 피하기 위해 낮은 전원을 유지. DNA 복제의 속도에 따라 몇 분 동안 1-5 프레임 / 초에서 취득. 원하는 경우, 더 이상 복제의 탄도를 얻을 이상의 분자를 볼 수있는 새로운 분야로 이동 반복합니다. </li><li> 반응 혼합물은 거의 비어 후, 그것은 S로 더 많은 버퍼에 유동하는 것이 좋습니다YTOX 볼의 다른 분야를 볼 수 있습니다. 다른 복제 분자의 여러 이미지를 촬영하면 processivity 결정에 대한 통계를 제공합니다. </li></ol> 5. 대표 결과 적극적으로 복제 분자가 쉽게 스테인드 DNA의 성장 노선으로 볼 수 있습니다. 우리의 실험에서는, M13 기판의 25 오후 흐르는 것은보기의 60x, 125 μm의 x 125 픽셀 μm의 필드 (그림 1) 100-1000 분자를 제공합니다. E.을 사용하여 복제 실험을 수행 37 대장균 replisome 단백질 ° C (자세한 내용은 자료를 참조) 한 시야당 50-50 복제 분자를 제공합니다. 훨씬 더 효율적으로 기판에 시작 T7 replisome의 동일한 농도에서, 우리는 현장 복제에 분자의&gt; 70 %를 관찰합니다. 이러한 조건은 개별 분자 해결 및 분석하기 어려울 수 있도록 높은 제품 밀도를 얻을 수 있으므로, T7 실험은 낮은 단백질 농도에서 수행됩니다. 데이터 분석 : 속도 데이터를 취득하려면 DNA 대 시간의 끝점을 계획하고 경사 (그림 2)를 계산합니다. processivity 들어, DNA의 전체 길이를 결정합니다. 이들 숫자는 모두 기본 쌍으로 변환해야합니다. 실험을 수행하기 전에, 당신은 적절한 배율의 카메라의 픽셀 크기를 알아야합니다. basepair 변환, 좋은 견적은 단순히 DNA의 crystallographic 길이 ​​2.9 BP / NM을 기반으로 변환됩니다. 그러나, 층류 완전히 DNA를 스트레칭하지 않습니다, DNA의 길이 보정은, 알려진 길이 DNA, 예를 들어 48,502 BP λ DNA를 복용 biotinylated oligo와 흐름 세포에 부착하고에서 자사 SYTOX 묻은 길이를 측정하여 수행되어야하므로 복제 실험에 사용되는 유량. 기본 쌍 / 픽셀의 수를 결정하는 것은 복제 속도와 processivities의 정확한 계산을하실 수 있습니다. 다수의 이미지 및 동영상을 촬영하는 것은 속도와 processivity 배포판 (그림 2) 1하려하고 있으므로, 제품 분자의 큰 숫자를 제공합니다. <img src="/files/ftp_upload/1529/1529fig1.jpg" alt="그림 1" /> 그림 1 : (심판 1.) 압연 - 서클 복제 분석의) 만화. (SA, streptavidin). 리딩 - 스트랜드 합성은 원형과 표면을 연결하는 꼬리를 확장합니다. 꼬리는 보온 스트랜드 효소에 의해 dsDNA로 변환하고 층류로 뻗어있다. SYTOX 오렌지와 532 나노미터 여기로보기 B) 예 필드. 소형 형광 명소 닿는 아닌 복제 기판입니다. 제품의 극단적인 길이 분야마다 제품 (각 흐름 세포&gt; 5000과 같은 필드를 포함합니다)의 큰 번호를 적어 둡니다. <img src="/files/ftp_upload/1529/1529fig2.jpg" alt="그림 2" /> 그림 2 : (심판의 적응 1.) A, B) T7 (a)와 E.의 전형적인 복제 분자의 Kymographs 대장균 (B) 실험. C)) 및 B)에서 분자의 종점 궤도 시간 대 꾸몄다. 궤도는 복제 속도를 얻기 위해 선형 회귀 장착되어 있습니다. 표시 예제 99.4 BP의 BP -1과 467.1의 -1입니다. ) 25.3 ± 1.7 kbp (T7), 85.3 ± 6.1 kbp (E. 대장균 : D) 복제 제품의 길이 배포판은 processivity를 얻는 하나의 지수 붕괴로 맞습니다. E) 단일 분자 궤도의 속도 배포판은 단일 Gaussians와 맞습니다. 의미 : 75.9 ± 4.8 BP S -1 (T7), 535.5 ± 39 BP S -1 (E. 대장균).

<ol>
	<li>Tanner, N. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+single-molecule+observation+of+rolling-circle+DNA+replication.">Real-time single-molecule observation of rolling-circle DNA replication.</a> Nucleic Acids Res. 37, e27 (2009).</li><li>Tabor, S., Huber, H. E., Richardson, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Escherichia+coli+thioredoxin+confers+processivity+on+the+DNA+polymerase+activity+of+the+gene+5+protein+of+bacteriophage+t7.">Escherichia coli thioredoxin confers processivity on the DNA polymerase activity of the gene 5 protein of bacteriophage t7.</a> J Biol Chem. 262, 16212-16223 (1987).</li><li>Sofia, S. J., Premnath, V. V., Merrill, E. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Poly(ethylene+oxide)+grafted+to+silicon+surfaces:+Grafting+density+and+protein+adsorption.">Poly(ethylene oxide) grafted to silicon surfaces: Grafting density and protein adsorption.</a> Macromolecules. 31, 5059-5070 (1998).</li><li>Tanner, N. A., van Oijen, A. M., Vengrova, S., Dalgaard, J. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+observation+of+prokaryotic+DNA+replication.">Single-molecule observation of prokaryotic DNA replication.</a> DNA replication: Methods and protocols. 521, 397-410 (2009).</li><li>Hamdan, S. M., Loparo, J. J., Takahashi, M., Richardson, C. C., van Oijen, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+DNA+replication+loops+reveal+temporal+control+of+lagging-strand+synthesis.">Dynamics of DNA replication loops reveal temporal control of lagging-strand synthesis.</a> Nature. 457, 336-339 (2009).</li><li>Heller, R. C., Marians, K. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication+fork+reactivation+downstream+of+a+blocked+nascent+leading+strand.">Replication fork reactivation downstream of a blocked nascent leading strand.</a> Nature. 439, 557-562 (2006).</li></ol>

하나의 중요한 통제 관심의 복제 단백질에 얼룩, SYTOX 오렌지의 효과를 분석하는 것입니다. 이 작업을 수행하는 간단한 방법은 설명 흐름 셀에지만 SYTOX의 누락으로 복제 실험을 수행하는 것입니다. 반응 혼합물은 챔버를 통해 거듭 후 DNA를 얼룩 및 복제 분자의 길이 분포를 조사하는 SYTOX와 버퍼를 추가합니다. 또는 표준 대량 반응은 복제 속도와 효율성에 대한 SYTOX의 효과를 확인하는 데 사용할 수 있습니다. 여기에서 설명한 실험은 하나의 흐름 채널을 사용합니다. 이것은 다중 채널 흐름 회의소를 만들거나 PDMS microfluidic 또는 이와 유사한 장치를 사용하여 쉽게 변경할 수 있습니다. 채널의 수를 늘리면 크게 단백질 농도, 돌연변이, 또는 억제제 분자의 심사를 용이 및 복제 데이터 수집의 인텔리을 증가시킵니다. 언급했듯이, 우리는 E.을 수행 37 대장균 복제 실험 ° C 가정 내장된 알루미늄 흐름 셀 히터, 저항 가열 요소 (카트리지 히터) 및 가변 전원 공급 장치를 사용합니다. 이것은 좋은 온도 안정성을 제공하고 객관적인 히터의 구매를 방지합니다. 히터를 보정하기 위해, 우리는 간단하게, 석영 플로우 셀 상단의 중앙에 구멍을 뚫고 흐름 채널에 열전대를 삽입하고 정상으로 버퍼를 흘렀을. 증가 전압에서 유량 셀 버퍼 온도를 측정하는 것은 정확하게 난방 수 있습니다.

T7 복제 : 5 MM dithiothreitol 40 MM 트리스 산도 7.5, 50 MM 칼륨 글루 탐 산염, 10 MM 마그네슘 염화물, 100 μg / ML BSA, 600 μm의의 dNTPs, 300 μm의 ATP, 300 μm의 CTP, 15 nm의 SYTOX 오렌지 바로 앞에 추가 사용합니다. 5 NM gp4 (hexamer), 40 NM 효소 (1:1 gp5 : thioredoxin), 360 nm의 gp2.5 1.5 단백질로 추가됩니다. E. 대장균 복제 : 50 MM의 HEPES 산도 7.9, 12 MM 마그네슘 아세테이트, 80 MM의 칼륨 염화물, 100 μg / ML BSA 10 MM dithiothreitol와 40 μm의의 dNTPs, 200 μm의 rNTPs, 15 nm의 SYTOX 오렌지를 사용하기 전에 바로 추가했습니다. 단백질은 추가로 30 NM DnaB (hexamer), 180 nm의 DnaC (모노머) 30 NM αεθ 15 NM τ 2 γ 1 δδ&#39;χψ 또는 τ 3 δδ&#39;χψ, 30 NM의 β (이량체), 300 NM DnaG, 250 NM SSB (tetramer), 20 NM PriA, 40 NM PriB, 320 NM PriC, 480 NM DnaT 1,6

visualizing single-molecule dna replication with fluorescence microscopy

우리는 단일 분자 수준에서 DNA 복제를 관찰하기위한 간단한 형광 현미경 기반의 실시간 방법을 설명합니다. 원형, 포크드 DNA 템플릿은 기능화 유리 coverslip에 붙어 및 ​​복제 단백질과 세포핵 (그림 1)의 도입 이후에 광범위하게 복제됩니다. 성장하는 제품을 두 번 스트랜드 DNA (dsDNA)가 층류로 확장하고 intercalating 염료를 사용하여 시각입니다. 실시간으로 성장 DNA 끝의 위치를​​ 측정하는 것은 복제 속도의 정확한 결정 (그림 2) 수 있습니다. 또한, 완성된 DNA 제품의 길이는 복제의 processivity에보고합니다. 해당 실험은 매우 간단하고 신속하게 수행하고 합리적으로 민감한 카메라에서만 형광 현미경을 필요로하실 수 있습니다.

Watch this Scientific Journal Video about Visualizing Single-molecule DNA Replication with Fluorescence Microscopy at JoVE.com

Visualizing Single-molecule DNA Replication with Fluorescence Microscopy

이 프로토콜은 실시간으로 개인 replisomes하여 DNA 복제를 시각화하기위한 간단한 단일 분자 형광 현미경 기술을 보여줍니다.

형광 현미경과 함께 머릿속으로 단일 분자의 DNA 복제

We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA ...

visualizing-single-molecule-dna-replication-with-fluorescence

Research

JoVE Journal

Biology

22.4K 조회수.  Harvard Medical School. 이 프로토콜은 실시간으로 개인 replisomes하여 DNA 복제를 시각화하기위한 간단한 단일 분자 형광 현미경 기술을 보여줍니다.

비디오: Visualizing Single-molecule DNA Replication with Fluorescence Microscopy

Visualizing Protein-DNA Interactions in Live Bacterial Cells Using Photoactivated Single-molecule Tracking

Protein-DNA interactions are at the heart of many fundamental cellular processes. For example, DNA replication, transcription, repair, and chromosome organization are governed by DNA-binding proteins that recognize specific DNA structures or sequences. In vitro experiments have helped to generate detailed models for the function of many types of DNA-binding proteins, yet, the exact mechanisms of these processes and their organization in the complex environment of the living cell remain far less understood. We recently introduced a method for quantifying DNA-repair activities in live Escherichia coli cells using Photoactivated Localization Microscopy (PALM) combined with single-molecule tracking. Our general approach identifies individual DNA-binding events by the change in the mobility of a single protein upon association with the chromosome. The fraction of bound molecules provides a direct quantitative measure for the protein activity and abundance of substrates or binding sites at the single-cell level. Here, we describe the concept of the method and demonstrate sample preparation, data acquisition, and data analysis procedures.

Photoactivated localization microscopy (PALM) combined with single-molecule tracking allows direct observation and quantification of protein-DNA interactions in live Escherichia coli cells.

Photoactivated 단일 분자 추적을 사용하여 라이브 박테리아 세포에있는 단백질-DNA 상호 작용을 시각화

Protein-DNA interactions are at the heart of many fundamental cellular processes. For example, DNA replication, transcription, repair, and chromosome ...

연구

면역학 및 감염병학

Single-Molecule Dwell-Time Analysis of Restriction Endonuclease-Mediated DNA Cleavage

This novel total internal reflection fluorescence microscopy-based assay facilitates the simultaneous measurement of the length of the catalytic cycle for hundreds of individual restriction endonuclease (REase) molecules in one experiment. This assay does not require protein labeling and can be carried out with a single imaging channel. In addition, the results of multiple individual experiments can be pooled to generate well-populated dwell-time distributions. Analysis of the resulting dwell-time distributions can help elucidate the DNA cleavage mechanism by revealing the presence of kinetic steps that cannot be directly observed. Example data collected using this assay with the well-studied REase, EcoRV - a dimeric Type IIP restriction endonuclease that cleaves the palindromic sequence GAT&#8595;ATC (where &#8595; is the cut site) - are in agreement with prior studies. These results suggest that there are at least three steps in the pathway to DNA cleavage that is initiated by introducing magnesium after EcoRV binds DNA in its absence, with an average rate of 0.17 s-1 for each step.

Using quantum-dot-labeled DNA and total internal reflection fluorescence microscopy, we can investigate the reaction mechanism of restriction endonucleases while using unlabeled protein. This single-molecule technique allows for massively multiplexed observation of individual protein-DNA interactions, and data can be pooled to generate well-populated dwell-time distributions.

Single-Molecule Dwell-Time Analysis of restriction Endonuclease-mediated DNA cleavage(제한 엔도뉴클레아제 매개 DNA 절단의 단일 분자 체류 시간 분석)

This novel total internal reflection fluorescence microscopy-based assay facilitates the simultaneous measurement of the length of the catalytic cycle for ...

생화학

Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system. Linearized &lambda; DNA is modified to have a biotin on the end of one strand, and a digoxigenin moiety on the other end of the same strand. The biotinylated end is attached to a functionalized glass coverslip and the digoxigeninated end to a small bead. The assembly of these DNA-bead tethers on the surface of a flow cell allows a laminar flow to be applied to exert a drag force on the bead. As a result, the DNA is stretched close to and parallel to the surface of the coverslip at a force that is determined by the flow rate (Figure 1). The length of the DNA is measured by monitoring the position of the bead. Length differences between single- and double-stranded DNA are utilized to obtain real-time information on the activity of the replication proteins at the fork. Measuring the position of the bead allows precise determination of the rates and processivities of DNA unwinding and polymerization (Figure 2).

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system.

효소 복제 DNA의 직접 관찰 어세을 스트레칭 단일 분자 DNA를 사용하여

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system. ...

생물학

완전히 재구성된 Cdc45/MCM2-7/GIN(CMG)의 모션 이미징

Hybrid Ensemble and Single-molecule Assay to Image the Motion of Fully Reconstituted CMG

Eukaryotes have one replicative helicase known as CMG, which centrally organizes and drives the replisome, and leads the way at the front of replication forks. Obtaining a deep mechanistic understanding of the dynamics of CMG is critical to elucidating how cells achieve the enormous task of efficiently and accurately replicating their entire genome once per cell cycle. Single-molecule techniques are uniquely suited to quantify the dynamics of CMG due to their unparalleled temporal and spatial resolution. Nevertheless, single-molecule studies of CMG motion have thus far relied on pre-formed CMG purified from cells as a complex, which precludes the study of the steps leading up to its activation. Here, we describe a hybrid ensemble and single-molecule assay that allowed imaging at the single-molecule level of the motion of fluorescently labeled CMG after fully reconstituting its assembly and activation from 36 different purified S. cerevisiae polypeptides. This assay relies on the double functionalization of the ends of a linear DNA substrate with two orthogonal attachment moieties, and can be adapted to study similarly complex DNA-processing mechanisms at the single-molecule level.

저자 스포트라이트: Investigating the motion Dynamics of the eukaryotic replisome components at the single-molecule level

We report a hybrid ensemble and single-molecule assay to directly image and quantify the motion of fluorescently labeled, fully reconstituted Cdc45/Mcm2-7/GINS (CMG) helicase on linear DNA molecules held in place in an optical trap.

완전히 재구성된 CMG의 움직임을 이미지화하기 위한 하이브리드 앙상블 및 단일 분자 분석

Eukaryotes have one replicative helicase known as CMG, which centrally organizes and drives the replisome, and leads the way at the front of replication ...

<meta charset="utf8"></head><body>ssDNA-RPA Tract Growth에서 관찰된 CMG 매개 DNA 풀기

Single-Molecule Real-Time Visualization of DNA Unwinding by CMG Helicase

Faithful genome duplication is essential for preserving the genetic stability of dividing cells. DNA replication is carried out during the S phase by a dynamic complex of proteins termed the replisome. At the heart of the replisome is the&#160;CDC45-MCM2-7-GINS (CMG) helicase, which separates the two strands of the DNA double helix such that DNA polymerases can copy each strand. During genome duplication, replisomes must overcome a plethora of obstacles and challenges. Each of these threatens genome stability, as failure to replicate DNA completely and accurately can lead to mutations, diseases, or cell death. Therefore, it is of great interest to understand how CMG functions in the replisome during both normal replication and replication stress. Here, we describe a total internal reflection fluorescence (TIRF) microscopy assay using recombinant purified proteins, which allows for real-time visualization of surface-tethered stretched DNA molecules by individual CMG complexes. This assay provides a powerful platform to investigate CMG behavior at the single-molecule level, allowing helicase dynamics to be directly observed with real-time control over reaction conditions.

<meta charset="utf8"></head><body>저자 스포트라이트: Unraveling the Dynamics of Eukaryotic DNA Replication Through Single-Molecule Visualization (단일 분자 시각화를 통한 진핵생물 DNA 복제의 역학 규명)

This protocol demonstrates performing a single-molecule assay for live visualization of DNA unwinding by CMG helicase. It describes (1) preparing a DNA substrate, (2) purifying fluorescently labeled Drosophila melanogaster CMG helicase, (3) preparing a microfluidic flow cell for total internal reflection fluorescence (TIRF) microscopy, and (4) the single-molecule DNA unwinding assay.

CMG Helicase를 이용한 DNA 풀림의 단일 분자 실시간 시각화

Faithful genome duplication is essential for preserving the genetic stability of dividing cells. DNA replication is carried out during the S phase by a ...

Visualization of DNA Replication in the Vertebrate Model System DT40 using the DNA Fiber Technique

Maintenance of replication fork stability is of utmost importance for dividing cells to preserve viability and prevent disease. The processes involved not only ensure faithful genome duplication in the face of endogenous and exogenous DNA damage but also prevent genomic instability, a recognized causative factor in tumor development.
Here, we describe a simple and cost-effective fluorescence microscopy-based method to visualize DNA replication in the avian B-cell line DT40. This cell line provides a powerful tool to investigate protein function in vivo by reverse genetics in vertebrate cells1. DNA fiber fluorography in DT40 cells lacking a specific gene allows one to elucidate the function of this gene product in DNA replication and genome stability. Traditional methods to analyze replication fork dynamics in vertebrate cells rely on measuring the overall rate of DNA synthesis in a population of pulse-labeled cells. This is a quantitative approach and does not allow for qualitative analysis of parameters that influence DNA synthesis. In contrast, the rate of movement of active forks can be followed directly when using the DNA fiber technique2-4. In this approach, nascent DNA is labeled in vivo by incorporation of halogenated nucleotides (Fig 1A). Subsequently, individual fibers are stretched onto a microscope slide, and the labeled DNA replication tracts are stained with specific antibodies and visualized by fluorescence microscopy (Fig 1B). Initiation of replication as well as fork directionality is determined by the consecutive use of two differently modified analogues. Furthermore, the dual-labeling approach allows for quantitative analysis of parameters that influence DNA synthesis during the S-phase, i.e. replication structures such as ongoing and stalled forks, replication origin density as well as fork terminations. Finally, the experimental procedure can be accomplished within a day, and requires only general laboratory equipment and a fluorescence microscope.

DT40, a model vertebrate genetic system, provides a powerful tool to analyze protein function. Here we describe a simple method that allows qualitative analysis of parameters that influence DNA synthesis during the S-phase in DT40 cells at the single molecule level.

DNA 복제의 시각화는 척추 모델 시스템 DT40의 DNA 섬유 기술을 사용하여

Maintenance of replication fork stability is of utmost importance for dividing cells to preserve viability and prevent disease. The processes involved not ...

형광 현미경과 함께 머릿속으로 단일 분자의 DNA 복제

요약

더 많은 비디오 탐색

이 비디오의 챕터

Photoactivated 단일 분자 추적을 사용하여 라이브 박테리아 세포에있는 단백질-DNA 상호 작용을 시각화

Single-Molecule Dwell-Time Analysis of restriction Endonuclease-mediated DNA cleavage(제한 엔도뉴클레아제 매개 DNA 절단의 단일 분자 체류 시간 분석)

효소 복제 DNA의 직접 관찰 어세을 스트레칭 단일 분자 DNA를 사용하여

완전히 재구성된 CMG의 움직임을 이미지화하기 위한 하이브리드 앙상블 및 단일 분자 분석

완전히 재구성된 CMG의 움직임을 이미지화하기 위한 하이브리드 앙상블 및 단일 분자 분석

완전히 재구성된 CMG의 움직임을 이미지화하기 위한 하이브리드 앙상블 및 단일 분자 분석

CMG Helicase를 이용한 DNA 풀림의 단일 분자 실시간 시각화

CMG Helicase를 이용한 DNA 풀림의 단일 분자 실시간 시각화

CMG Helicase를 이용한 DNA 풀림의 단일 분자 실시간 시각화

DNA 복제의 시각화는 척추 모델 시스템 DT40의 DNA 섬유 기술을 사용하여