사미르 Hamdan이 기술의 개발에 주었. E.을 대장균 단백질이 교수 닉 딕슨의 실험실에서 있으며, 울릉공 대학, 그리고 T7 단백질이 교수 찰스 리차드슨, 하버드 의과 대학에서입니다. 작품은 국립 보건원 (AMvO에 GM077248)과 제인 코핀 차일즈 재단 (JJL)에 의해 지원됩니다.

단일 분자 복제 실험을 수행하기 전에, 몇 가지 자료는 사전에 준비해야합니다. 1. DNA 복제 템플릿 복제 반응을위한 기판은 표준 분자 생물학 기법 1,2을 사용하여 준비 biotinylated, 꼬리 M13 롤링 서클입니다. 자료 : M13mp18 단일 좌초 DNA, Biotinylated 꼬리 oligonucleotide의 프라이머 (5&#39; - 비오틴 - T 36 AATTCGTAAT CATGGTCATAGCTGTTTCCT - 3 &#39;), T7의 DNA 중합 효소, 열 차단, Isoamyl / 페놀 알콜 / 클로로포름 <ol><li> TBS 버퍼 (330 NM 꼬리 oligo 33 NM M13)에 oligo의 10 배 초과를 추가하여 M13에 biotinylated oligo 꼬리를 어닐링. </li><li> 65 ° C 열 블록에서 가열하여 혼합합니다. 일단 가열, 열 블록을 해제하고 느린 냉각이 제대로 뇌관 어닐링 수 있습니다. </li><li> 64 NM T7의 DNA 중합 효소 및 dNTPs와 MgCl 2 포함 T7 복제 버퍼의 혼합물로 준비하는 M13을 추가합니다. </li><li> 37 반응 ° 12분 C를 품어 100 MM EDTA (에틸렌 다이아 민 테트라 초산)과 끄지. </li><li> 정화 채워진 - 인 제품의 DNA 페놀 / 클로로포름 / isoamyl 알콜 추출 및 TE 버퍼 또는 기타 적합한 저장 버퍼로 dialyze과 DNA 농도 (M13을 준비하는 잔여 복구 각 유기농 단계를 백 추출)을 결정과 함께. </li><li> 템플릿 준비 중 하나는 반복은 쉽게 단일 분자 실험의 수천 수백 정도, nanomolar 농도 템플릿의 몇 밀리리터를 만들 수 있습니다. </li></ol> 2. 기능화 Coverslips 유리 coverslip에 DNA를 부착, 유리 먼저 다음 biotinylated PEG 분자에 결합하는 aminosilane와 작용합니다. 이 코팅은 표면에 1,3와 함께 DNA와 복제 단백질의 특이 현상이 상호 작용을 줄일 수 있습니다. 재료 : 유리 coverslips, 스테 이닝 항아리, 3 aminopropyltriethoxysilane, 메톡시 - PEG5k - NHS 에스테르, 비오틴 - PEG5k - NHSester, 아세톤, 1M 코, 에탄올, 오븐, 목욕 sonicator을 <ol><li> 단지를 얼룩 및 에탄올과 함께 항아리를 채우는 그들을 배치하여 유리 coverslips을 철저히 청소. 30 분 Sonicate과 단지를 씻어 1 M 코와 함께 입력합니다. 30 분 모두 세척을 반복 Sonicate. </li><li> 첫 번째 작용화 반응 들면, 물의 모든 흔적은 삭제해야합니다. 10 분 아세톤과 sonicate로 항아리를 채우십시오. 아세톤과 함께 다시 항아리를 씻어. </li><li> 아세톤의 실란 시약의 2 % V / V 솔루션을 준비합니다. 얼룩 단지 추가 2 분 선동. 이 반응은 커플 유리에 aminosilane의 알콕시 그룹을 다음 커플링 단계 반응 아민을 떠나. 물을 큰 초과로 반응을 끄다. </li><li> 110 ° C 30 분간 오븐에서 그들을 베이킹하여 coverslips 건조. </li><li> 100 MM NaHCO 3 산도 8.2의 비오틴 PEG 혼합물 : 50:1 메톡시를 준비합니다. 0.2 % 주위 W / V biotinylated PEG을 목표로. </li><li> 마른 silanized coverslip 및 장소 위에 다른 coverslip에 PEG 혼합물의 피펫 100 μL. 유리 coverslip 스페이서를 포함하면 coverslips의 분리를 허용합니다. </li><li> 3 시간 동안 PEG 솔루션에 coverslips 부화 후 coverslips의 각 쌍을 분리하고 물로 씻어 광범위. 한 번만 측면이 PEG와 코팅 될 것이다 coverslips가 측면을 유지하는 작용주의하십시오. </li><li> 진공에서 coverslips하고 저장을 건조. 표면은 적어도 한 달 동안 안정적으로 유지하므로 coverslips 수십는 일괄로 작성하고 필요에 따라 사용할 수 있습니다. </li></ol> 이 자료는 미리 만든 다음 각각의 실험을 위해 사용해야합니다. 모든 단일 분자 실험을 시작하려면, 흐름 챔버를 조립하여 시작합니다. 3. 흐름 챔버 준비 실험 기능화 coverslip, 양면 테이프, 석영 튜브 슬라이드와 함께 건설 간단한 흐름 챔버를 사용하여 수행됩니다. 하나의 흐름 챔버는 각 단일 분자 실험 1,4에 대한 준비가되어 있습니다. 재료 : 양면 테이프, 면도날, 튜브, 빠른 건조 에폭시를위한 구멍이있는 석영 슬라이드, 기능화 coverslip (위 참조), Streptavidin 솔루션 (PBS 1 MG / ML 25 μL), 튜브, 차단 버퍼 (20 MM 트리스 산도 7.5, 2 MM EDTA (에틸렌 다이아 민 테트라 초산), 50 MM NaCl, 0.2 MG / ML BSA, 0.005 % 트윈 - 20) <ol><li> 나중 단계에 대한 기포를 제거하기 위해 건조기에 차단 버퍼의 20-25 ML을 배치하여 시작합니다. </li><li> PEG - 기능화 coverslip을 가지고 표면을 통해 PBS로 희석된 streptavidin 솔루션의 확산 125. streptavidin은 표면 biotins를 바인딩할 수 있도록, 챔버의 다른 부분을 준비하면서 20 분 동안 부화 이것을 둡니다. </li><li> 더블 사이드의 조각 컷D 테이프는 석영 슬라이드의 크기를 일치시킵니다. 흐름 챔버의 외곽선이 테이프 (1 MG / ML)에서 발행한 수 있도록 연필로 테이프에 튜브 구멍의 위치를​​ 표시합니다. </li><li> 구멍 주변 2mm 전체 사각형을 확인합니다. 이것은 흐름 채널 역할을하므로, 튜브의 입구 및 출구 주위에 바로 측면을 만들고 방을 떠날해야합니다. 원하는 경우, 여러 채널 또는 다른 크기를 사용할 수 있습니다. </li><li> 채널에 노 접착제 protrudes 있는지 바로 깨끗한 상처를 만드는 그려진 윤곽을 따라 잘라. </li><li> 석영 철저하게 사용하는 아세톤 또는 이전 유량 셀 구조에서 접착제를 제거하기 위해 에탄올을 청소하십시오. </li><li> 채널 개요 최고의 정렬을 찾아 접착제 후원의 한쪽을 제거하고 조심스럽게 석영 슬라이드에 테이프를 넣으십시오. 입구와 콘센트 구멍이 남아 차단을 해제해야로서 제대로 테이프를 정렬하기 위해주의하십시오. </li><li> 흐름 세포의 입구 및 출구에 대한 튜브의 길이를 자르고. 그것은 튜브가 챔버 바닥에 대한 평면 눌러 않도록 대해 30 ° 각도로 튜브의 끝을 잘라하는 데 도움이됩니다. 다음 단계에서 흐름 세포에 쉽게 부착 그들을 일시 중지를 지원 일종의에 튜브를 삽입합니다. </li><li> 물로 깨끗이 streptavidin - 코팅 coverslip을 씻어 압축 공기를 사용하여 건조. 한 측면이 작용이라는 걸 기억하고, coverslip을 넘겨하지 않도록주의합니다. 테이프 백업의 다른 측면을 제거하고 coverslip 위에 석영 슬라이드를 놓으십시오. </li><li> 가볍게 접착제에 갇혀있는 공기를 밖으로 밀어 coverslip을 누르십시오. 이것은 흐름 채널로 받고있는 공기 방울을 방지하는 데 도움이됩니다. </li><li> 에폭시와 챔버의 측면을 봉쇄. 에폭시와 장소에서 석영과 인감 구멍에 상처 튜브를 삽입합니다. 이것은 몇 분 동안 건조해야합니다. </li><li> 일단 건조, 튜브 중 하나를 통해 degassed 차단 버퍼의 일부를 당겨 표면을 차단하고 시작합니다. 21 게이지 바늘은 0.76 mm의 튜브 내부에 완벽하게 맞는 데요. 공기 방울을 제거하기 위해 몇 시간을 플러시하고, 챔버가 최소 절반 시간 동안 부화 수 있습니다. </li></ol> 4. 단일 분자 복제 실험 자료 : 준비 흐름 챔버, SYTOX 오렌지, TIRF 현미경, 532 nm의 레이저, CCD 카메라, 이미지 수집 소프트웨어와 컴퓨터, 롤링 - 원형 DNA 기판, 복제 단백질 <ol><li> 흐름 세포가 차단되고 나면 모든 것이 단일 분자 실험을 시작할 준비가되어 있습니다. </li><li> 흐름 세포를 가지고 현미경 스테이지에 배치하십시오. 무대 클립 장소에 챔버를 잡고 흐름 채널이 바로 Y - 축을 따라 위치되어 있는지 확인합니다. </li><li> 큰 직경의 튜브 커넥터 또는 바늘을 사용하여 주사기 펌프로 유량 셀 콘센트 튜브를 연결합니다. 버퍼를 차단의 입구를 삽입하고 튜브에 공기를 제거하는 주사기에 다시 가져옵니다. 콘센트 튜브의 부드러운 영화는 흐름 세포에 갇혀있는 공기 방울을 취소 도움이 될 것입니다. </li><li> 차단 버퍼 1 ML 25 시까지 재고 DNA 템플릿을 희석. DNA의 좋은 표면 범위를 허용하는 중간 유량의 챔버로 흐름. 0.025 ML / 30 분 분 잘 작동합니다. 이것은 coverslips의 각 배치에 대해 표면에있는 또는 실험을 위해 얼마나 많은 원하는 얼마나 많은 DNA 분자에 따라 다양한하실 수 있습니다. </li><li> DNA가되면, 차단 버퍼를 사용하여 여분의 DNA를 씻으십시오. 모두 무료로 DNA를 제거하기 위해 최소한 200 흐름 - 세포 볼륨에 씻으십시오. </li><li> 복제 버퍼를 degassing 시작합니다. E.을위한 대장균 복제 실험, 37에서이 작업을 수행 ° C 온수 흐름 챔버에서 거품의 위험을 줄일 수 있습니다. </li><li> 레이저와 카메라를 켜십시오. 냉각 CCD는 사용하기 전에 온도에 도달해야합니다. </li><li> 37 ° C의 실험을 수행하는 경우에 히터를 켭니다. 목적은 흐름 세포 접촉에 또는 나중에 방열판 수 있어야합니다. </li><li> 세정 degassing 후, 반응이 준비하실 수 있습니다. 믹스 세포핵, DTT, 그리고 복제 버퍼에 SYTOX. 다음 단백질을 추가하고 부드럽게 섞는다. </li><li> 흐름 세포에 반응 혼합물을 흐름. 이 흐름 속도는 dsDNA를 스트레칭 충분해야합니다. 2 mm 폭 100 μm의 높이 흐름 채널에 대한 0.04 ML / 분 잘 작동합니다. </li><li> 챔버를 입력하고 영상을 시작으로 혼합 시간을 허용합니다. 좋은 팁은 채널의 측면보기의 필드를 이동하고 접착 재료에 집중하는 것입니다. 이것은 초점을위한 표면 근처에 있도록합니다. </li><li> 레이저 전력, 현미경의 초점을, 그리고 TIRF 각도를 조정합니다. 스테인드 DNA의 photocleavage을 피하기 위해 낮은 전원을 유지. DNA 복제의 속도에 따라 몇 분 동안 1-5 프레임 / 초에서 취득. 원하는 경우, 더 이상 복제의 탄도를 얻을 이상의 분자를 볼 수있는 새로운 분야로 이동 반복합니다. </li><li> 반응 혼합물은 거의 비어 후, 그것은 S로 더 많은 버퍼에 유동하는 것이 좋습니다YTOX 볼의 다른 분야를 볼 수 있습니다. 다른 복제 분자의 여러 이미지를 촬영하면 processivity 결정에 대한 통계를 제공합니다. </li></ol> 5. 대표 결과 적극적으로 복제 분자가 쉽게 스테인드 DNA의 성장 노선으로 볼 수 있습니다. 우리의 실험에서는, M13 기판의 25 오후 흐르는 것은보기의 60x, 125 μm의 x 125 픽셀 μm의 필드 (그림 1) 100-1000 분자를 제공합니다. E.을 사용하여 복제 실험을 수행 37 대장균 replisome 단백질 ° C (자세한 내용은 자료를 참조) 한 시야당 50-50 복제 분자를 제공합니다. 훨씬 더 효율적으로 기판에 시작 T7 replisome의 동일한 농도에서, 우리는 현장 복제에 분자의&gt; 70 %를 관찰합니다. 이러한 조건은 개별 분자 해결 및 분석하기 어려울 수 있도록 높은 제품 밀도를 얻을 수 있으므로, T7 실험은 낮은 단백질 농도에서 수행됩니다. 데이터 분석 : 속도 데이터를 취득하려면 DNA 대 시간의 끝점을 계획하고 경사 (그림 2)를 계산합니다. processivity 들어, DNA의 전체 길이를 결정합니다. 이들 숫자는 모두 기본 쌍으로 변환해야합니다. 실험을 수행하기 전에, 당신은 적절한 배율의 카메라의 픽셀 크기를 알아야합니다. basepair 변환, 좋은 견적은 단순히 DNA의 crystallographic 길이 ​​2.9 BP / NM을 기반으로 변환됩니다. 그러나, 층류 완전히 DNA를 스트레칭하지 않습니다, DNA의 길이 보정은, 알려진 길이 DNA, 예를 들어 48,502 BP λ DNA를 복용 biotinylated oligo와 흐름 세포에 부착하고에서 자사 SYTOX 묻은 길이를 측정하여 수행되어야하므로 복제 실험에 사용되는 유량. 기본 쌍 / 픽셀의 수를 결정하는 것은 복제 속도와 processivities의 정확한 계산을하실 수 있습니다. 다수의 이미지 및 동영상을 촬영하는 것은 속도와 processivity 배포판 (그림 2) 1하려하고 있으므로, 제품 분자의 큰 숫자를 제공합니다. <img src="/files/ftp_upload/1529/1529fig1.jpg" alt="그림 1" /> 그림 1 : (심판 1.) 압연 - 서클 복제 분석의) 만화. (SA, streptavidin). 리딩 - 스트랜드 합성은 원형과 표면을 연결하는 꼬리를 확장합니다. 꼬리는 보온 스트랜드 효소에 의해 dsDNA로 변환하고 층류로 뻗어있다. SYTOX 오렌지와 532 나노미터 여기로보기 B) 예 필드. 소형 형광 명소 닿는 아닌 복제 기판입니다. 제품의 극단적인 길이 분야마다 제품 (각 흐름 세포&gt; 5000과 같은 필드를 포함합니다)의 큰 번호를 적어 둡니다. <img src="/files/ftp_upload/1529/1529fig2.jpg" alt="그림 2" /> 그림 2 : (심판의 적응 1.) A, B) T7 (a)와 E.의 전형적인 복제 분자의 Kymographs 대장균 (B) 실험. C)) 및 B)에서 분자의 종점 궤도 시간 대 꾸몄다. 궤도는 복제 속도를 얻기 위해 선형 회귀 장착되어 있습니다. 표시 예제 99.4 BP의 BP -1과 467.1의 -1입니다. ) 25.3 ± 1.7 kbp (T7), 85.3 ± 6.1 kbp (E. 대장균 : D) 복제 제품의 길이 배포판은 processivity를 얻는 하나의 지수 붕괴로 맞습니다. E) 단일 분자 궤도의 속도 배포판은 단일 Gaussians와 맞습니다. 의미 : 75.9 ± 4.8 BP S -1 (T7), 535.5 ± 39 BP S -1 (E. 대장균).

<ol>
	<li>Tanner, N. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+single-molecule+observation+of+rolling-circle+DNA+replication.">Real-time single-molecule observation of rolling-circle DNA replication.</a> Nucleic Acids Res. 37, e27 (2009).</li><li>Tabor, S., Huber, H. E., Richardson, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Escherichia+coli+thioredoxin+confers+processivity+on+the+DNA+polymerase+activity+of+the+gene+5+protein+of+bacteriophage+t7.">Escherichia coli thioredoxin confers processivity on the DNA polymerase activity of the gene 5 protein of bacteriophage t7.</a> J Biol Chem. 262, 16212-16223 (1987).</li><li>Sofia, S. J., Premnath, V. V., Merrill, E. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Poly(ethylene+oxide)+grafted+to+silicon+surfaces:+Grafting+density+and+protein+adsorption.">Poly(ethylene oxide) grafted to silicon surfaces: Grafting density and protein adsorption.</a> Macromolecules. 31, 5059-5070 (1998).</li><li>Tanner, N. A., van Oijen, A. M., Vengrova, S., Dalgaard, J. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+observation+of+prokaryotic+DNA+replication.">Single-molecule observation of prokaryotic DNA replication.</a> DNA replication: Methods and protocols. 521, 397-410 (2009).</li><li>Hamdan, S. M., Loparo, J. J., Takahashi, M., Richardson, C. C., van Oijen, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+DNA+replication+loops+reveal+temporal+control+of+lagging-strand+synthesis.">Dynamics of DNA replication loops reveal temporal control of lagging-strand synthesis.</a> Nature. 457, 336-339 (2009).</li><li>Heller, R. C., Marians, K. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication+fork+reactivation+downstream+of+a+blocked+nascent+leading+strand.">Replication fork reactivation downstream of a blocked nascent leading strand.</a> Nature. 439, 557-562 (2006).</li></ol>

하나의 중요한 통제 관심의 복제 단백질에 얼룩, SYTOX 오렌지의 효과를 분석하는 것입니다. 이 작업을 수행하는 간단한 방법은 설명 흐름 셀에지만 SYTOX의 누락으로 복제 실험을 수행하는 것입니다. 반응 혼합물은 챔버를 통해 거듭 후 DNA를 얼룩 및 복제 분자의 길이 분포를 조사하는 SYTOX와 버퍼를 추가합니다. 또는 표준 대량 반응은 복제 속도와 효율성에 대한 SYTOX의 효과를 확인하는 데 사용할 수 있습니다. 여기에서 설명한 실험은 하나의 흐름 채널을 사용합니다. 이것은 다중 채널 흐름 회의소를 만들거나 PDMS microfluidic 또는 이와 유사한 장치를 사용하여 쉽게 변경할 수 있습니다. 채널의 수를 늘리면 크게 단백질 농도, 돌연변이, 또는 억제제 분자의 심사를 용이 및 복제 데이터 수집의 인텔리을 증가시킵니다. 언급했듯이, 우리는 E.을 수행 37 대장균 복제 실험 ° C 가정 내장된 알루미늄 흐름 셀 히터, 저항 가열 요소 (카트리지 히터) 및 가변 전원 공급 장치를 사용합니다. 이것은 좋은 온도 안정성을 제공하고 객관적인 히터의 구매를 방지합니다. 히터를 보정하기 위해, 우리는 간단하게, 석영 플로우 셀 상단의 중앙에 구멍을 뚫고 흐름 채널에 열전대를 삽입하고 정상으로 버퍼를 흘렀을. 증가 전압에서 유량 셀 버퍼 온도를 측정하는 것은 정확하게 난방 수 있습니다.

T7 복제 : 5 MM dithiothreitol 40 MM 트리스 산도 7.5, 50 MM 칼륨 글루 탐 산염, 10 MM 마그네슘 염화물, 100 μg / ML BSA, 600 μm의의 dNTPs, 300 μm의 ATP, 300 μm의 CTP, 15 nm의 SYTOX 오렌지 바로 앞에 추가 사용합니다. 5 NM gp4 (hexamer), 40 NM 효소 (1:1 gp5 : thioredoxin), 360 nm의 gp2.5 1.5 단백질로 추가됩니다. E. 대장균 복제 : 50 MM의 HEPES 산도 7.9, 12 MM 마그네슘 아세테이트, 80 MM의 칼륨 염화물, 100 μg / ML BSA 10 MM dithiothreitol와 40 μm의의 dNTPs, 200 μm의 rNTPs, 15 nm의 SYTOX 오렌지를 사용하기 전에 바로 추가했습니다. 단백질은 추가로 30 NM DnaB (hexamer), 180 nm의 DnaC (모노머) 30 NM αεθ 15 NM τ 2 γ 1 δδ&#39;χψ 또는 τ 3 δδ&#39;χψ, 30 NM의 β (이량체), 300 NM DnaG, 250 NM SSB (tetramer), 20 NM PriA, 40 NM PriB, 320 NM PriC, 480 NM DnaT 1,6

visualizing single-molecule dna replication with fluorescence microscopy

우리는 단일 분자 수준에서 DNA 복제를 관찰하기위한 간단한 형광 현미경 기반의 실시간 방법을 설명합니다. 원형, 포크드 DNA 템플릿은 기능화 유리 coverslip에 붙어 및 ​​복제 단백질과 세포핵 (그림 1)의 도입 이후에 광범위하게 복제됩니다. 성장하는 제품을 두 번 스트랜드 DNA (dsDNA)가 층류로 확장하고 intercalating 염료를 사용하여 시각입니다. 실시간으로 성장 DNA 끝의 위치를​​ 측정하는 것은 복제 속도의 정확한 결정 (그림 2) 수 있습니다. 또한, 완성된 DNA 제품의 길이는 복제의 processivity에보고합니다. 해당 실험은 매우 간단하고 신속하게 수행하고 합리적으로 민감한 카메라에서만 형광 현미경을 필요로하실 수 있습니다.

Watch this Scientific Journal Video about Visualizing Single-molecule DNA Replication with Fluorescence Microscopy at JoVE.com

Visualizing Single-molecule DNA Replication with Fluorescence Microscopy

이 프로토콜은 실시간으로 개인 replisomes하여 DNA 복제를 시각화하기위한 간단한 단일 분자 형광 현미경 기술을 보여줍니다.

형광 현미경과 함께 머릿속으로 단일 분자의 DNA 복제

We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA ...

visualizing-single-molecule-dna-replication-with-fluorescence

Research

JoVE Journal

Biology

22.3K 조회수.  Harvard Medical School. 이 프로토콜은 실시간으로 개인 replisomes하여 DNA 복제를 시각화하기위한 간단한 단일 분자 형광 현미경 기술을 보여줍니다.

비디오: Visualizing Single-molecule DNA Replication with Fluorescence Microscopy

Visualizing Single Molecular Complexes In Vivo Using Advanced Fluorescence Microscopy

Full insight into the mechanisms of living cells can be achieved only by investigating the key processes that elicit and direct events at a cellular level. To date the shear complexity of biological systems has caused precise single-molecule experimentation to be far too demanding, instead focusing on studies of single systems using relatively crude bulk ensemble-average measurements. However, many important processes occur in the living cell at the level of just one or a few molecules; ensemble measurements generally mask the stochastic and heterogeneous nature of these events. Here, using advanced optical microscopy and analytical image analysis tools we demonstrate how to monitor proteins within a single living bacterial cell to a precision of single molecules and how we can observe dynamics within molecular complexes in functioning biological machines. The techniques are directly relevant physiologically. They are minimally-perturbative and non-invasive to the biological sample under study and are fully attuned for investigations in living material, features not readily available to other single-molecule approaches of biophysics. In addition, the biological specimens studied all produce fluorescently-tagged protein at levels which are almost identical to the unmodified cell strains ("genomic encoding"), as opposed to the more common but less ideal approach for generating significantly more protein than would occur naturally ('plasmid expression'). Thus, the actual biological samples which will be investigated are significantly closer to the natural organisms, and therefore the observations more relevant to real physiological processes.

Visualizing Single Molecular Complexes In Vivo Using Advanced Fluorescence Microscopy

Here we demonstrate the protocols for performing single-molecule fluorescence microscopy on living bacterial cells to enable functional molecular complexes to be detected, tracked and quantified.

단일 분자 단지를 떠올리 VIVO에서 고급 형광 현미경을 사용하여

Full insight into the mechanisms of living cells can be achieved only by investigating the key processes that elicit and direct events at a cellular ...

연구

생물학

Automated System for Single Molecule Fluorescence Measurements of Surface-immobilized Biomolecules

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, such as nucleic acids and proteins. Single molecule FRET (sm-FRET) measurements on immobilized molecules permit long observations of the system -effectively until both dyes photobleach- resulting in time-traces that report on biomolecular dynamics with a broad range of timescales from milliseconds to minutes. To facilitate the acquisition of large number of traces for statistical analyses, the process must be automated and the sample environment should be tightly controlled over the entire measurement time (~12 hours). This is accomplished using an automated scanning confocal microscope that allows the interrogation of thousands of single molecules overnight, and a microfluidic cell that permits the controlled exchange of buffer, with restricted oxygen content and maintains a constant temperature throughout the entire measuring period. Here we show how to assemble the microfluidic device and how to activate its surface for DNA immobilization. Then we explain how to prepare a buffer to maximize the photostability and lifetime of the fluorophores. Finally, we show the steps involved in preparing the setup for the automated acquisition of time-resolved single molecule FRET traces of DNA molecules.

In this article we describe how we obtain FRET traces from individual DNA molecules immobilized to a surface using an automated scanning confocal microscope.

표면 고정화 Biomolecules의 단일 분자 형광 측정을위한 자동화된 시스템

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, ...

Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system. Linearized &lambda; DNA is modified to have a biotin on the end of one strand, and a digoxigenin moiety on the other end of the same strand. The biotinylated end is attached to a functionalized glass coverslip and the digoxigeninated end to a small bead. The assembly of these DNA-bead tethers on the surface of a flow cell allows a laminar flow to be applied to exert a drag force on the bead. As a result, the DNA is stretched close to and parallel to the surface of the coverslip at a force that is determined by the flow rate (Figure 1). The length of the DNA is measured by monitoring the position of the bead. Length differences between single- and double-stranded DNA are utilized to obtain real-time information on the activity of the replication proteins at the fork. Measuring the position of the bead allows precise determination of the rates and processivities of DNA unwinding and polymerization (Figure 2).

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system.

효소 복제 DNA의 직접 관찰 어세을 스트레칭 단일 분자 DNA를 사용하여

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system. ...

Time-lapse Imaging of Mitosis After siRNA Transfection

Changes in cellular organization and chromosome dynamics that occur during mitosis are tightly coordinated to ensure accurate inheritance of genomic and cellular content. Hallmark events of mitosis, such as chromosome movement, can be readily tracked on an individual cell basis using time-lapse fluorescence microscopy of mammalian cell lines expressing specific GFP-tagged proteins. In combination with RNAi-based depletion, this can be a powerful method for pinpointing the stage(s) of mitosis where defects occur after levels of a particular protein have been lowered. In this protocol, we present a basic method for assessing the effect of depleting a potential mitotic regulatory protein on the timing of mitosis. Cells are transfected with siRNA, placed in a stage-top incubation chamber, and imaged using an automated fluorescence microscope. We describe how to use software to set up a time-lapse experiment, how to process the image sequences to make either still-image montages or movies, and how to quantify and analyze the timing of mitotic stages using a cell-line expressing mCherry-tagged histone H2B. Finally, we discuss important considerations for designing a time-lapse experiment. This strategy is complementary to other approaches and offers the advantages of 1) sensitivity to changes in kinetics that might not be observed when looking at cells as a population and 2) analysis of mitosis without the need to synchronize the cell cycle using drug treatments. The visual information from such imaging experiments not only allows the sub-stages of mitosis to be assessed, but can also provide unexpected insight that would not be apparent from cell cycle analysis by FACS.

Here we describe a basic protocol to image and quantify the mitotic timing of live mammalian tissue culture cells after siRNA transfection.

siRNA Transfection 후의 유사 분열의 시간 저속 영상

Changes in cellular organization and chromosome dynamics that occur during mitosis are tightly coordinated to ensure accurate inheritance of genomic and ...

Cell Electrofusion Visualized with Fluorescence Microscopy

Cell electrofusion is a safe, non-viral and non-chemical method that can be used for preparing hybrid cells for human therapy. Electrofusion involves application of short high-voltage electric pulses to cells that are in close contact. Application of short, high-voltage electric pulses causes destabilization of cell plasma membranes. Destabilized membranes are more permeable for different molecules and also prone to fusion with any neighboring destabilized membranes. Electrofusion is thus a convenient method to achieve a non-specific fusion of very different cells in vitro. In order to obtain fusion, cell membranes, destabilized by electric field, must be in a close contact to allow merging of their lipid bilayers and consequently their cytoplasm. In this video, we demonstrate efficient electrofusion of cells in vitro by means of modified adherence method. In this method, cells are allowed to attach only slightly to the surface of the well, so that medium can be exchanged and cells still preserve their spherical shape. Fusion visualization is assessed by pre-labeling of the cytoplasm of cells with different fluorescent cell tracker dyes; half of the cells are labeled with orange CMRA and the other half with green CMFDA. Fusion yield is determined as the number of dually fluorescent cells divided with the number of all cells multiplied by two.

In this video we demonstrate efficient electrofusion of cells in vitro by means of modified adherence method using electroporation and the subsequent detection of fused cells visualization with fluorescence microscopy.

세포는 형광 현미경 Electrofusion와 시각

Cell electrofusion is a safe, non-viral and non-chemical method that can be used for preparing hybrid cells for human therapy. Electrofusion involves ...

Monitoring Plasmid Replication in Live Mammalian Cells over Multiple Generations by Fluorescence Microscopy

Few naturally-occurring plasmids are maintained in mammalian cells. Among these are genomes of gamma-herpesviruses, including Epstein-Barr virus (EBV) and Kaposi's Sarcoma-associated herpesvirus (KSHV), which cause multiple human malignancies 1-3. These two genomes are replicated in a licensed manner, each using a single viral protein and cellular replication machinery, and are passed to daughter cells during cell division despite their lacking traditional centromeres 4-8.
Much work has been done to characterize the replications of these plasmid genomes using methods such as Southern blotting and fluorescence in situ hybridization (FISH). These methods are limited, though. Quantitative PCR and Southern blots provide information about the average number of plasmids per cell in a population of cells. FISH is a single-cell assay that reveals both the average number and the distribution of plasmids per cell in the population of cells but is static, allowing no information about the parent or progeny of the examined cell.
Here, we describe a method for visualizing plasmids in live cells. This method is based on the binding of a fluorescently tagged lactose repressor protein to multiple sites in the plasmid of interest 9. The DNA of interest is engineered to include approximately 250 tandem repeats of the lactose operator (LacO) sequence. LacO is specifically bound by the lactose repressor protein (LacI), which can be fused to a fluorescent protein. The fusion protein can either be expressed from the engineered plasmid or introduced by a retroviral vector. In this way, the DNA molecules are fluorescently tagged and therefore become visible via fluorescence microscopy. The fusion protein is blocked from binding the plasmid DNA by culturing cells in the presence of IPTG until the plasmids are ready to be viewed.
This system allows the plasmids to be monitored in living cells through several generations, revealing properties of their synthesis and partitioning to daughter cells. Ideal cells are adherent, easily transfected, and have large nuclei. This technique has been used to determine that 84% of EBV-derived plasmids are synthesized each generation and 88% of the newly synthesized plasmids partition faithfully to daughter cells in HeLa cells. Pairs of these EBV plasmids were seen to be tethered to or associated with sister chromatids after their synthesis in S-phase until they were seen to separate as the sister chromatids separated in Anaphase10. The method is currently being used to study replication of KSHV genomes in HeLa cells and SLK cells. HeLa cells are immortalized human epithelial cells, and SLK cells are immortalized human endothelial cells. Though SLK cells were originally derived from a KSHV lesion, neither the HeLa nor SLK cell line naturally harbors KSHV genomes11. In addition to studying viral replication, this visualization technique can be used to investigate the effects of the addition, removal, or mutation of various DNA sequence elements on synthesis, localization, and partitioning of other recombinant plasmid DNAs.

A method of observing individual DNA molecules in live cells is described. The technique is based on the binding of a fluorescently tagged lac repressor protein to binding sites engineered into the DNA of interest. This method can be adapted to follow many recombinant DNAs in live cells over time.

형광 현미경으로 여러 세대 이상 라이브 포유류의 세포에 플라스미드 복제 모니터링

Few naturally-occurring plasmids are maintained in mammalian cells.  Among these are genomes of gamma-herpesviruses, including Epstein-Barr virus  (EBV) ...

Combining Single-molecule Manipulation and Imaging for the Study of Protein-DNA Interactions

The paper describes the combination of optical tweezers and single molecule fluorescence detection for the study of protein-DNA interaction. The method offers the opportunity of investigating interactions occurring in solution (thus avoiding problems due to closeby surfaces as in other single molecule methods), controlling the DNA extension and tracking interaction dynamics as a function of both mechanical parameters and DNA sequence. The methods for establishing successful optical trapping and nanometer localization of single molecules are illustrated. We illustrate the experimental conditions allowing the study of interaction of lactose repressor (lacI), labeled with Atto532, with a DNA molecule containing specific target sequences (operators) for LacI binding. The method allows the observation of specific interactions at the operators, as well as one-dimensional diffusion of the protein during the process of target search. The method is broadly applicable to the study of protein-DNA interactions but also to molecular motors, where control of the tension applied to the partner track polymer (for example actin or microtubules) is desirable.

Here we describe the instrumentation and methods for detecting single fluorescently-labeled protein molecules interacting with a single DNA molecule suspended between two optically trapped microspheres.

단백질-DNA 상호 작용의 연구에 대한 단일 분자 조작 및 이미지를 결합

The paper describes the combination of optical tweezers and single molecule fluorescence detection for the study of protein-DNA interaction. The method ...

Studying DNA Looping by Single-Molecule FRET

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.

This study presents a detailed experimental procedure to measure looping dynamics of double-stranded DNA using single-molecule Fluorescence Resonance Energy Transfer (FRET). The protocol also describes how to extract the looping probability density called the J factor.

단일 분자 FRET에 의해 DNA 루핑을 공부

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into ...

Visualizing Stromule Frequency with Fluorescence Microscopy

Stromules, or "stroma-filled tubules", are narrow, tubular extensions from the surface of the chloroplast that are universally observed in plant cells but whose functions remain mysterious. Alongside growing attention on the role of chloroplasts in coordinating plant responses to stress, interest in stromules and their relationship to chloroplast signaling dynamics has increased in recent years, aided by advances in fluorescence microscopy and protein fluorophores that allow for rapid, accurate visualization of stromule dynamics. Here, we provide detailed protocols to assay stromule frequency in the epidermal chloroplasts of Nicotiana benthamiana, an excellent model system for investigating chloroplast stromule biology. We also provide methods for visualizing chloroplast stromules in vitro by extracting chloroplasts from leaves. Finally, we outline sampling strategies and statistical approaches to analyze differences in stromule frequencies in response to stimuli, such as environmental stress, chemical treatments, or gene silencing. Researchers can use these protocols as a starting point to develop new methods for innovative experiments to explore how and why chloroplasts make stromules.

Protocols to investigate the dynamics of chloroplast stromules, the stroma-filled tubules that extend from the surface of chloroplasts, are described.

형광 현미경으로 Stromule 주파수를 시각화

Stromules, or "stroma-filled tubules", are narrow, tubular extensions from the surface of the chloroplast that are universally observed in plant cells but ...

Method for Labeling Transcripts in Individual Escherichia coli Cells for Single-molecule Fluorescence In Situ Hybridization Experiments

A method is described for labeling individual messenger RNA (mRNA) transcripts in fixed bacteria for use in single-molecule fluorescence in situ hybridization (smFISH) experiments in E. coli. smFISH allows the measurement of cell-to-cell variability in mRNA copy number of genes of interest, as well as the subcellular location of the transcripts. The main steps involved are fixation of the bacterial cell culture, permeabilization of cell membranes, and hybridization of the target transcripts with sets of commercially available short fluorescently-labeled oligonucleotide probes. smFISH can allow the imaging of the transcripts of multiple genes in the same cell, with limitations imposed by the spectral overlap between different fluorescent markers. Following completion of the protocol illustrated below, cells can be readily imaged using a microscope coupled with a camera suitable for low-intensity fluorescence. These images, together with cell contours obtained from segmentation of phase contrast frames, or from cell membrane staining, allow the calculation of the mRNA copy number distribution of a sample of cells using open-source or custom-written software. The labeling method described here can also be applied to image transcripts with stochastic optical reconstruction microscopy (STORM).

Method for Labeling Transcripts in Individual Escherichia coli Cells for Single-molecule Fluorescence In Situ Hybridization Experiments

This manuscript describes a method for labeling individual messenger RNA (mRNA) transcripts with fluorescently-labeled DNA probes, for use in single-molecule fluorescence in situ hybridization (smFISH) experiments in E. coli. smFISH is a visualization method that allows the simultaneous detection, localization, and quantification of single mRNA molecules in fixed individual cells.