이 작품은 연구 자원을위한 국가 센터 (FW에) 부여 UL1TR000124을 통해 번역 상 과학, 건강의 국립 연구소를, 전진을위한 국가 센터에 의해 지원되었다; 펠릭스 &amp; 밀드레드 깨갱 기증 교수 및 (DTWW에) 반스 가족 기금 (MT에) 상 수 T90DE022734에서 국립 보건원 (National Institutes of Health)의 치과 및 두개 안면 연구소의 국립 연구소. 내용은 전적으로 저자의 책임이며 반드시 국립 보건원의 공식 견해를 대변하지 않습니다.

1. 자기 비드 기반 엑소 추출 <ol><li> 비드를 재현 탁하는 마이크로 원심 분리 튜브에 인산 완충 생리 식염수 (PBS) 완충액 495 ㎕를 스트렙 타비 딘으로 코팅 된 자성 미립자의 5 μL의 혼합 된 용액을 피펫. 자기 랙을 사용하여 세 번 세척하고 PBS 500 μL와 구슬을 재현 탁. 랙 샘플 튜브를 마이크로 원심 수납 할 하우징 유닛의 측면에 자석의 배열이다. <ol><li> 각각의 세척을 위해, 먼저 튜브 1 분 동안 선반에 앉아서 조심스럽게 구슬을 방해하지 않고 뜨는 버퍼를 제거하기 위해 피펫 팁을 사용하자. </li><li> 측면에 자석이없는 일반 랙에 튜브를 놓습니다. 튜브에 PBS의 500 μl를 추가하고 함께 해결책과 구슬을 혼합하는 피펫을 사용합니다. 다시 용액으로부터 비드를 분리하는 자기 선반에 다시 넣어 튜브. </li><li> PBS의 자화 및 재 부유를 통해 버퍼의이 제거를 수행합니다3 회 총. 이 자성 입자의 초기 세척을 수행한다. </li></ol></li><li> 자기 랙의 비자 성 부분 상에 배치 된 튜브, PBS 완충액 490 μL로 비드를 재현 탁. 피펫 구슬의 혼합물에 1.0 ㎎ / ㎖ 농도의 스톡 오티 닐화 마우스 항 인간 CD63 항체 5 μL. 용액에 구슬과 항체를 혼합하는 피펫을 사용합니다. </li><li> 샘플 회에 구슬과 비오틴 항체 혼합물의 microcentrifuge 튜브를 놓습니다. 90 ° 5 초 동안 기울를 1 초 동안 5 °에서 진동에 왕복 회전에 대한 샘플 회전의 회전 매개 변수를 설정합니다. 실온에서 30 분 동안 이러한 매개 변수에 샘플 비드 혼합 튜브를 회전합니다. </li><li> 결합 후 결합되지 않은 항체를 제거합니다. <ol><li> RT에서 회전 30 분 후, 5 분 동안 다시 자기 랙에 튜브를 배치합니다. </li><li> 마이크로 피펫을 이용하여 액체 상을 제거하여 구슬 세 세척을 수행하고, 500 μ 씻어; PBS의 리터. 트리플 세척 한 후, 랙의 자화되지 않은 부분에 490 카제인 PBS의 μL과 장소에 구슬을 재현 탁. </li></ol></li><li> 항체 코팅 구슬을 사용 엑소 추출. <ol><li> 타겟 샘플 ID와 각 튜브 레이블. 마이크로 원심 튜브에 혈청 또는 타액의 10 μL 샘플을 피펫. 여러 번 피펫 팅하여 샘플 및 자기 구슬을 혼합하는 피펫을 사용합니다. </li><li> 회 전자에 샘플 및 안티 인간 CD63 항체 구슬 튜브를 삽입하고 실온에서 2 시간 동안 회전합니다. 단계 1.2에 기재된 바와 같이 동일한 회 파라미터를 사용한다. </li><li> 회전 샘플의 2 시간 후, 솔루션에서 별도의 구슬 자화 마이크로 피펫과 액상을 제거하고, 트리스 - 염산 완충액 500 μL에 구슬을 재 부유하여 트리플 세척을 수행합니다. 결과 구슬은 이제 엑소 좀 바인딩 및 전기장 방출 및 측정을위한 준비가되어 있습니다. </li></ol></li></ol> 2. 전기장 유도 출시차 Exosomal 내용의 측정 <ol><li> GADPH 프라이머와 전극의 초기 프리 코팅 <ol><li> 플라스틱 잘은 개별 전극의 교차 오염을 방지하기 위해 전극 배열을 적용합니다. 이 실험을 위해, 베어 금으로 제조 작업, 카운터 및 기준 전극으로 구성된 어레이의 각 전극 부 16 센서 전극 어레이를 사용한다. </li><li> 초순수 증류수로 튜브에 재고 시약을 피펫 팅 100 nm의 DNA 프로브, 0.3 M KCl을, 10 mM의 피롤의 재고 혼합물을 준비합니다. 와동에 의해 철저하게 섞는다. 참고 : 본 연구를 위해, 선택된 DNA 프로브 엑소 좀 내에 존재하는 것으로 알려져 참조 GAPDH 유전자에 대응한다. 사용되는 프로브 서열은 다음과 &#39;- 비오틴 AGGTCCACCACTGACACGTTG 5&#39;-3. 모든 전극에이 혼합물을 사용합니다. </li><li> 피펫 각 금 전극의 표면 상에 모노머-DNA 프로브 혼합물을 60 μL. 작업, (C)의 적절한 범위가되도록하여 전극을 검사액체 혼합물에 의해 ounter, 전극과 기준 전극. </li><li> 프로브 Electropolymerize 단량체 혼합물을 전극 표면에 환상 구형파 (CSW) 전계 프로파일을 적용하여 전극 표면에 전도성 고분자 층을 생성한다. 이 전기장은 9 초 동안 350 MV를 적용하고 바로 1 초 동안 950 MV로 전환 구성되어 있습니다. 인가 전기장의 100 초, 총 10 사이클 용 전극이 환상 구형파 프로파일을 적용한다. </li><li> 전극의 표면으로부터 액체를 제거하는 센서 표면을 증류수와 질소 가스와 건조로 3 회 헹군다. 그 액체가 제대로 전극에서 제거되어 있는지 확인합니다. </li></ol></li><li> 엑소화물 하역 <ol><li> 로드 5 비드 - 엑소 좀 복잡한 혼합물의 495 μL에 검출기 프로브의 1 μM의 μL와 혼합 피펫을 사용합니다. 주 : 검출기 프로브가 3 &#39;말단에 형광 분자에 접합 된 DNA 프라이머 서열이다. 검출기 확률값본 연구를 위해 사용 된 전자 서열 엑소 좀 내에있는 GAPDH mRNA에 대응한다. 형광 검출기 공액 프로브의 서열은 : 5&#39;- 플루오 레세 GCAGTGGGGACACGGAAGGCC-3 &#39;. </li><li> 피펫 아래 자석 배열과 금 전극 표면 상에 프로브와 엑소 - 비드 복합체의 60 μL. 이 자석 어레이가 센서의 작용 극에 대응하도록 정렬 된 여섯 2.54 mm 직경 네오디뮴 자석으로 이루어져있다.도 2a는 자석 비드 - 엑소 용액의 배치를 도시한다. </li><li> 샘플이 전극 표면에로드되면, -300 MV에서 9 초 및 200 MV (200 초 총)에서 1 초에 CSW 전기장의 20주기를 적용합니다. 해제 exosomal화물은 전극의 표면에 프라이머 혼성화한다. 엑소 좀의 표면 마커는 조사의 대상이되는 경우. 실험의이 부분을 건너 2b는이 과정을 도시한다. </li> &lt;리&gt; 워시 오프 트리플 증류수로 전극 표면을 세정함으로써, 전극 표면에 결합되지 않은 분석 물질. 질소 가스와 함께 전극을 건조. </li></ol></li><li> 기자 항체 및 판독 <ol><li> (1,000 희석 1 HRP) 카제인 / PBS에 희석 고추 냉이 과산화 효소에 결합 150 단위 / ml의 방지 형광 항체의 60 μl를 추가합니다. </li><li> 프로브 샌드위치 복잡한 안티 플루 HRP에 전기장 구동 결합을 사용합니다. 1 초와 전극 표면에 5 사이클을 1 초 동안 500 MV에 대해 -200 MV를 적용합니다. 그림 2a는 단백질과 핵산 시스템 모두에 대해 캡처 및 검출기 프로브 단지를 보여줍니다. </li><li> 증류수 및 질소 가스를 이용하여 건식 세척 트리플 센서면. </li><li> 언 바운드 초과 방지 형광 항체의 워시 오프에 이어, 3,3 &#39;, 5,5&#39;- 테트라 메틸 벤지딘 (TMB) 기판의 60 μl를 추가합니다. 멀티 채널 피펫을 사용하여 각 센서 표면에이 기판을 넣습니다. </li><li> . 16 개의 채널을 동시에 측정 할 수있는 전기 화학적 텐쇼을 60 초 동안 사용하여 -200 Mv로, 전극 전류를 측정함으로써, 현재의 판독 전류 측정을 수행 2C는 판독시 전류 프로파일의 일례도이다. </li></ol></li></ol><img alt="그림 2" src="/files/ftp_upload/52439/52439fig2highres.jpg" /> EFIRM 방법 그림 2. 구성 요소. (A) 항 - 인간 CD63 코팅 자성 미립자를 사용하여 체액에서 엑소 좀을 추출하고 입자 엑소 좀 복잡한에 적용 순환 광장 파도를 사용 엑소화물을 하역하는 방법. 릴리스 엑소에서 RNA / DNA / 단백질 표적을 검출하기 위해 사용되는 바이오 센서의 전극 (B) 방식. 큰 전류 크기가 t에 해당 (C) EFIRM 방법론에서 전류 측정 판독의 대표적인 예생체 분자의 높은 수준 O. 이 그림은 웨이 등 알에서입니다. (14)는 <a href="https://www.jove.com/files/ftp_upload/52439/52439fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>

<ol>
	<li>Rabinowits, G., Ger&#231;el-Taylor, C., Day, J. M., Taylor, D. D., Kloecker, G. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exosomal+MicroRNA:+A+Diagnostic+Marker+for+Lung+Cancer.">Exosomal MicroRNA: A Diagnostic Marker for Lung Cancer.</a> Clinical Lung Cancer. 10 (1), 42-46 (2009).</li><li>Thakur, B. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Double-stranded+DNA+in+exosomes:+a+novel+biomarker+in+cancer+detection.">Double-stranded DNA in exosomes: a novel biomarker in cancer detection.</a> Cell Research. 24 (6), 766-769 (2014).</li><li>Lau, C. S., Wong, D. T. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Breast+Cancer+Exosome-like+Microvesicles+and+Salivary+Gland+Cells+Interplay+Alters+Salivary+Gland+Cell-Derived+Exosome-like+Microvesicles+In.">Breast Cancer Exosome-like Microvesicles and Salivary Gland Cells Interplay Alters Salivary Gland Cell-Derived Exosome-like Microvesicles In.</a> Vitro. PLoS ONE. 7 (3), e33037 (2012).</li><li>Bala, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+microRNAs+in+exosomes+indicate+hepatocyte+injury+and+inflammation+in+alcoholic,+drug-induced,+and+inflammatory+liver+diseases.">Circulating microRNAs in exosomes indicate hepatocyte injury and inflammation in alcoholic, drug-induced, and inflammatory liver diseases.</a> Hepatolog. 56 (5), 1946-1957 (2012).</li><li>Dear, J. W., Street, J. M., Bailey, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Urinary+exosomes:+A+reservoir+for+biomarker+discovery+and+potential+mediators+of+intrarenal+signalling.">Urinary exosomes: A reservoir for biomarker discovery and potential mediators of intrarenal signalling.</a> Proteomics. 13 (10-11), 1572-1580 (2013).</li><li>L&#228;sser, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+saliva,+plasma+and+breast+milk+exosomes+contain+RNA:+uptake+by+macrophages.">Human saliva, plasma and breast milk exosomes contain RNA: uptake by macrophages.</a> Journal of Translational Medicine. 9 (1), 9 (2011).</li><li>Palanisamy, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nanostructural+and+Transcriptomic+Analyses+of+Human+Saliva+Derived+Exosomes.">Nanostructural and Transcriptomic Analyses of Human Saliva Derived Exosomes.</a> PLoS ONE. 5 (1), e8577 (2010).</li><li>Camussi, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exosomes/microvesicles+as+a+mechanism+of+cell-to-cell+communication.">Exosomes/microvesicles as a mechanism of cell-to-cell communication.</a> Kidney International. 78 (9), 838-848 (2010).</li><li>Lau, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+pancreatic+cancer-derived+exosomes+in+salivary+biomarker+development.">Role of pancreatic cancer-derived exosomes in salivary biomarker development.</a> The Journal of Biological Chemistry. 288 (37), 26888-26897 (2013).</li><li>Th&#233;ry, C., Amigorena, S., Raposo, G., Clayton, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+Characterization+of+Exosomes+from+Cell+Culture+Supernatants+and+Biological+Fluids.">Isolation and Characterization of Exosomes from Cell Culture Supernatants and Biological Fluids.</a> Current Protocols in Cell Biology. 3 (22), (2001).</li><li>Park, N. J., Li, Y., Yu, T., Brinkman, B. M. N., Wong, D. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+RNA+in+Saliva.">Characterization of RNA in Saliva.</a> Clinical Chemistry. 52 (6), 988-994 (2006).</li><li>Wei, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bio/Abiotic+Interface+Constructed+from+Nanoscale+DNA+Dendrimer+and+Conducting+Polymer+for+Ultrasensitive+Biomolecular+Diagnosis.">Bio/Abiotic Interface Constructed from Nanoscale DNA Dendrimer and Conducting Polymer for Ultrasensitive Biomolecular Diagnosis.</a> Small. 5 (15), 1784-1790 (2009).</li><li>Wei, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrochemical+Sensor+for+Multiplex+Biomarkers+Detection.">Electrochemical Sensor for Multiplex Biomarkers Detection.</a> Clinical Cancer Research. 15 (13), 4446-4452 (2009).</li><li>Wei, F., Yang, J., Wong, D. T. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+exosomal+biomarker+by+electric+field-induced+release+and+measurement+(EFIRM).">Detection of exosomal biomarker by electric field-induced release and measurement (EFIRM).</a> Biosensors and Bioelectronics. 44, 115-121 (2013).</li></ol>

데이비드 웡 RNAmeTRIX 주식, 분자 진단 회사의 공동 설립자이다. PeriRx LLC는 RNAmeTRIX에서 분자 진단에 관한 지적 재산권을 재사용 권. 데이비드 웡 PeriRx 컨설턴트입니다.

결과가 나타내는 바와 같이, 항 인간 CD63 코팅 된 자성 나노 입자는 특히 70 ~ 100 nm의 범위의 크기를 갖는 작은 입자를 포착 할 수있다. 이 캡처 된 입자는 엑소 좀 이전에 관찰 된 프로파일과 일치한다. 또한, 입자의 캡처 다음 저전압 CSW의 사용은 비드 표면에서 제거화물 릴리스 전통적인 용해 완충액 기반 방법과 동일한 DNA 분해 프로파일을 일으키는 것으로 도시되어있다. 이 데이터는 exosomal화물 ...

An erratum was issued for <a href="http://www.jove.com/video/52439">Detection of Exosomal Biomarker by Electric Field-induced Release and Measurement (EFIRM)</a>. The disclosures were updated.

An erratum was issued for <a href="http://www.jove.com/video/52439">Detection of Exosomal Biomarker by Electric Field-induced Release and Measurement (EFIRM)</a>.

Errata: Detection of Exosomal Biomarker by Electric Field-induced Release and Measurement (EFIRM)

엑소 조사 RNA 1, 2 DNA 및 단백질 3화물을 운반 지질 마이크로 소포를 검사 조사의 새로운 분야입니다. 엑소 생물학의 이전 조사는 혈액 4, 소변 5, 모유 6, 침 7로 biofluids에서 엑소 좀의 식별을 주도했다. 연구는 원격으로 본체 (8)의 서로 다른 시스템 간의 통신을 명상, 엑소 좀 다른 세포질 통로에 역할을한다는 것을 증명하고있다. 역할의 엑소 좀은 세포 간 통신에서 재생하기 때문에, 그들이 질병 상태와 상관 생체 분자 표적 (단백질, RNA 및 DNA)를 패키지 가설이 성립된다. 시험관 3 및 동물 모델 (9) 연구는이 가설을 확증하기 위해 나타납니다. 바이오 마커 발견에 대한 콘텐츠를 조사 exosomal, 그것은 선택적 엑소 biofluids로부터 격리를위한 방법론을 개발하는 것이 필요하다, 유도 expulsi엑소 좀에서화물 및 엑소 생체 분자의 정량에. 이 일의 범위에서, 엑소 좀은 구조가 약 70 ~ 100 nm의 직경을 갖는 표면 마커 CD63을 갖는 것으로 정의한다. 연구진은 일반적으로 첫 번째 초 원심 분리 (10)에 의해 엑소 좀을 정화하고 용해 버퍼 키트의 사용을 통해 exosomal 내용을 처리합니다. 용해 버퍼 방법의 사용은 분에서 시간에 이르기까지 배양 시간이 필요합니다. 이 과정은 잠재적으로 엑소화물을 손상 및 열화를 샘플링 될 수 있습니다. 예를 들어, 주변의 세포 외 환경으로 용해 완충액을 통해 방출 타액 엑소의 RNA는 exosomal의 RNA 후 - 용균 측정 안정화 시약 (11)의 첨가없이 특히 어려운 태스크를 버퍼링하게 1 분 아래의 반감기를 갖는다. 용해 및 안정화를위한 다양한 시약을 추가하는 복리 효과는 복잡 에이전트를 소개하고 analy을 방해 할 수 있습니다exosomal 내용의 동생. 또 다른 방법은 빠르게 exosomal 내용을 하역하고 안전하게 특성에 대한화물을 보존 도움이 될 수 있습니다. 본 연구에서는 exosomal 콘텐츠 릴리스 불균일 전기장의 사용을 제안한다. 전기 필드는 편광 및 세포막을 형성하는 지질 이중층을 방해하는 기능을 수행하는 것으로 알려져있다. 우리의 실험 작업은 엑소 좀의 마이크로 소포 구조를 방해하고 수행화물을 해제하기위한 비 균일 순환 구형파 (CSW)의 사용을 탐구한다. 이 방법은 대부분의 생체 분자가 중단되지 않을 것임을 의미하는 수백 밀리 볼트 범위의 전압을 사용합니다. 우리는 환상 구형파의 사용량이 주변 환경으로의 유체 타액 엑소 mRNA의 함량의 방출을 작동 할 수 있다는 것을 입증한다. exosomal 함량이 릴리스 원활 바이오 마커의 발현 정도를 정량화하는데 사용될 수있다 전극 시스템과 통합되어 12,13.이 제안 된 방법은 엑소 콘텐츠의 빠른, 민감한, 그리고 용해 버퍼 무료로 분석 할 수 있습니다. <img alt="그림 1" src="/files/ftp_upload/52439/52439fig1highres.jpg" /> EFIRM 워크 플로우 1. 개요를 그림.. EFIRM 방법은 크게 정화 및 분석 엑소 좀에 필요한 세 가지 주요 단계로 구분된다. 이 CSW exosomal 기반 컨텐츠 방출 및 분석 방법은 엑소 격리를위한 자기 고유의 CD63 마이크로 비드와 함께 사용된다. 이러한 CD63-친화 비즈 타액 샘플 (및 기타 biofluids)에서 엑소 좀의 선택적 분리를 위해 할 수 있습니다. 인큐베이션과 자화 비드 엑소 좀을 이용하여 추출 후, 비드는도 1. 컨텐츠 방출 실험과 분석을 기초 부 CSW위한 전기 화학적 센서 시스템으로 마이그레이션 작업의 개요를 제공 아르EFIRM 방법의 흐름.

<table border="0" cellpadding="0" cellspacing="0" width="802">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:347px;">Name of Material/ Equipment</td>
			<td style="width:157px;">Company</td>
			<td style="width:132px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Helios 16-Channel Reader System with Chip Interface&#160;</td>
			<td style="width:157px;">Genefluidics, USA</td>
			<td style="width:132px;">&#160;RS-1000-16</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">16X Sensor Chip, Bare Gold, pack of 5 chips</td>
			<td style="width:157px;">Genefluidics, USA</td>
			<td>SC1000-16X-B</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Biotinylated anti-human CD63 Antibody</td>
			<td style="width:157px;">Ancell, USA</td>
			<td style="width:132px;">215-030</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Dynabeads MyOne Streptavidin T1</td>
			<td>Invitrogen, USA</td>
			<td>65601</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Neodynium Magnetics ( 1/10&#34; dia. x 1/32&#34; thick)</td>
			<td style="width:157px;">K&#38;J Magnetics, USA</td>
			<td>DH101</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:347px;">Ultrapure Distilled Water</td>
			<td style="width:157px;">Life Technologies, USA</td>
			<td>10977-023</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Mettler Toldeo 3M KcL Solution</td>
			<td style="width:157px;">Fisher Scientific, USA</td>
			<td>1911512</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Pyrrole</td>
			<td style="width:157px;">Sigma-Aldrich, USA</td>
			<td style="width:132px;">W338605-100g</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Anti-Fluorescein-POD, Fab fragments</td>
			<td style="width:157px;">Roche, Germany</td>
			<td>11426346910</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:347px;">3, 3&#8242;, 5, 5&#8242; tetramethylbenzidine substrate (TMB/H2O2, low activity)&#160;</td>
			<td style="width:157px;">Neogen, Usa</td>
			<td style="width:132px;">330175</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:347px;">Phosphate Buffered Saline Solution</td>
			<td style="width:157px;">Life Technologies, USA</td>
			<td align="right" style="width:132px;">10010023</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Casein/PBS</td>
			<td style="width:157px;">Fisher Scientific, USA</td>
			<td>37532</td>
			<td></td>
		</tr>
	</tbody>
</table>

detection of exosomal biomarker by electric field-induced release and measurement (efirm)

엑소 좀은 세포 간 의사 소통의 매개 역할을 microvesicular 구조입니다. 그것은 그들이 질병 차별적 인 바이오 마커를 가지고 있는지 확인 엑소 좀의 내부화물을 연구하는 관심입니다. exosomal 분석을 수행하기위한, 그것을 추출하여 내부 콘텐츠를 손상시키지 않고 타겟 biofluids에서 엑소 좀을 분석하기위한 방법을 개발하는 것이 필요하다. 전계 방출 유도 및 측정 (EFIRM)는 구체적 biofluids에서 엑소 좀을 추출 그들의화물을 하역하고, 내부 RNA / 단백질 함량을 테스트하기위한 방법이다. 항 인간 CD63에 특이적인 항체를 사용하여 자성 미립자, 엑소 좀은 제 biofluids으로부터 침전된다. 다음 추출, 저전압 전기 순환 구형파 (CSW)는 기공을 막 중단 및화물 하역의 원인에 적용됩니다. 엑소 좀의 함유량 ...로서 대한 전극 표면에 고정화 DNA 프라이머 또는 혼성화 항체분자 내용의 ntification. EFIRM 방법은 용해 완충액없이 분석 엑소 좀의 추출 및 언화물 유리하다. 이 방법은 엑소 모두 RNA와 단백질의 특이 표적 바이오 마커 검출을 수행 할 수있다. 크기 기반의 기술과 반대로 EFIRM 특히 그 표면 마커에 기초하여 엑소 좀을 추출한다. 투과 전자 현미경 (TEM) 분석은 엑소 및 캡쳐 및 분석을위한 방법의 기능을 설명한다. EFIRM 방법은 인간 폐암 H640 세포를 주입 구 마우스의 분석 식염수 컨트롤을 수신 (11) 쥐에 대해 자신의 엑소 프로파일을 테스트하기 위해 (엑소 마커 인간 CD63-GFP를 발현하는 형질 감염된 세포주) exosomal 도포 하였다. exosomal 바이오 마커의 상승 된 레벨 (참고 GAPDH 유전자 및 단백질 표면 마커 인간 CD63-GFP)는 H640 모두 혈청 및 타액 샘플 주입을 위해 쥐를 발견 하였다. 또한, SalI로버지니아 및 혈청 샘플은 선형성 (R = 0.79)가 입증되었다. 이러한 결과는 말초 질환의 검출을위한 타액 엑소 바이오 마커의 실행 가능성에 대한 암시이다.

TEM을 사용하여 구슬의 엑소 캡처의 검증 항 인간 CD63 자성 비드를 이용하여 타액에서 엑소 좀의 분리는 투과 전자 현미경 (TEM) 이미지를 이용하여 추출 프로토콜 다음 검증 하였다. TEM은 엑소 좀의 알려진 프로파일과 일치 바로 인접 (도 3a를 참조하고, 3B) 70 ~ 100 나노 입자와 자성 비드를 보여줍니다. 아니 70 ~ 100 nm의 과립은 이전에 그들?...

Watch this Scientific Journal Video about Detection of Exosomal Biomarker by Electric Field-induced Release and Measurement EFIRM at JoVE.com

Detection of Exosomal Biomarker by Electric Field-induced Release and Measurement EFIRM

Exosomes are microvesicular structures found within biofluids that potentially carry important disease discriminatory biomarkers. Here, a novel method is used to specifically extract exosomes and rapidly test the exosomal cargo for both RNA/protein targets following the disruption of exosomes using non-uniform electric cyclic square waves.

전기장에 의한 해제 및 측정 (EFIRM)에 의해 Exosomal 바이오 마커의 검출

Exosomes are microvesicular structures that play a mediating role in intercellular communication. It is of interest to study the internal cargo of ...

detection-exosomal-biomarker-electric-field-induced-release

Research

JoVE Journal

Bioengineering

Detection of Exosomal Biomarker by Electric Field-induced Release and Measurement (EFIRM)

18.4K 조회수.  University of California, Los Angeles. Exosomes are microvesicular structures found within biofluids that potentially carry important disease discriminatory biomarkers. Here, a novel method is used to specifically extract exosomes and rapidly test the exosomal cargo for both RNA/protein targets following the disruption of exosomes using non-uniform electric cyclic square waves. 

비디오: Detection of Exosomal Biomarker by Electric Field-induced Release and Measurement EFIRM

Developing Custom Chinese Hamster Ovary-host Cell Protein Assays using Acoustic Membrane Microparticle Technology

Custom assays for unique proteins are often limited to time consuming manual detection and quantitation techniques such as ELISA or Western blots due to the complexity of development on alternate platforms. BioScale's proprietary Acoustic Membrane MicroParticle (AMMP) technology allows sandwich immunoassays to be easily developed for use on the ViBE platform, providing better sensitivity, reproducibility, and automated operation. Provided as an example, this protocol outlines the procedure for developing a custom Chinese Hamster Ovary- Host Cell Protein (CHO-HCP) assay. The general principles outlined here can be followed for the development of a wide variety of immunoassays.
An AMMP assay measures antigen concentration by measuring changes in oscillation frequency caused by the binding of microparticles to the sensor surface to calculate. It consists of four major components: (1) a cartridge that contains a functionalized eight sensor chip (2) antibody labeled magnetic microparticles, (3) hapten tagged antibody that binds to the surface of the functionalized chip (4) samples containing the antigen of interest. BioScale's biosensor is a resonant device that contains eight individual membranes with separate fluidic paths. The membranes change oscillation frequency in response to mass accumulating on the surface and this frequency change is used to quantitate the amount of added mass.
To facilitate use in a wide variety of immunoassays the sensor is functionalized with an anti-hapten antibody. Assay specific antibodies are modified through the covalent conjugation of a hapten tag to one antibody and biotin to the other. The biotin label is used to bind the antibody to streptavidin coupled magnetic beads which, in combination with the hapten-tagged antibody, are used to capture the analyte in a sandwich. The complex binds to the chip through the anti-hapten/hapten interaction. At the end of each assay run the sensors are cleaned with a dilute acid enabling the sequential analysis of columns from a 96-well plate.
Here, we present the method for developing a custom CHO-HCP AMMP assay for bioprocess development. Developing AMMP assays or modifying existing assays into AMMP assays can provide better performance (reproducibility, sensitivity) in complex samples and reduced operator time. The protocol shows the steps for development and the discussion section reviews representative results. For a more in-depth explanation of assay optimization and customization parameters contact BioScale. This kit offers generic bioprocess development assays such as Residual Protein A, Product titer, and CHO-HCP.

Development of custom assays on the ViBE platform for more sensitive, reproducible, automated results in complex matrices is described. The universal cartridge allows assays to be easily adapted for use with custom assays. This versatility enables rapid development and validation of novel assays or automated versions of existing manual assays, exemplified in this video.

어쿠스틱 막 Microparticle 기술을 사용하여 개발 사용자 지정 중국어 햄스터 난소 - 숙주 세포의 단백질 Assays

Custom assays for unique proteins are often limited to time consuming manual detection and quantitation techniques such as ELISA or Western blots due to ...

연구

생체공학

Measurement of Aggregate Cohesion by Tissue Surface Tensiometry

Rigorous measurement of intercellular binding energy can only be made using methods grounded in thermodynamic principles in systems at equilibrium. We have developed tissue surface tensiometry (TST) specifically to measure the surface free energy of interaction between cells. The biophysical concepts underlying TST have been previously described in detail1,2. The method is based on the observation that mutually cohesive cells, if maintained in shaking culture, will spontaneously assemble into clusters. Over time, these clusters will round up to form spheres. This rounding-up behavior mimics the behavior characteristic of liquid systems. Intercellular binding energy is measured by compressing spherical aggregates between parallel plates in a custom-designed tissue surface tensiometer. The same mathematical equation used to measure the surface tension of a liquid droplet is used to measure surface tension of 3D tissue-like spherical aggregates. The cellular equivalent of liquid surface tension is intercellular binding energy, or more generally, tissue cohesivity. Previous studies from our laboratory have shown that tissue surface tension (1) predicts how two groups of embryonic cells will interact with one another1-5, (2) can strongly influence the ability of tissues to interact with biomaterials6, (3) can be altered not only through direct manipulation of cadherin-based intercellular cohesion7, but also by manipulation of key ECM molecules such as FN8-11 and 4) correlates with invasive potential of lung cancer12, fibrosarcoma13, brain tumor14 and prostate tumor cell lines15. In this article we will describe the apparatus, detail the steps required to generate spheroids, to load the spheroids into the tensiometer chamber, to initiate aggregate compression, and to analyze and validate the tissue surface tension measurements generated.

We describe a method of measuring binding energy, expressible as tissue surface tension, between cells within 3D tissue-like aggregates. Differences in tissue surface tension have been demonstrated to correlate with invasiveness of lung, muscle, and brain tumors, and are fundamental determinants of establishing spatial relationships between different cell types.

조직 표면 Tensiometry에 의해 집계 응집력의 측정

Rigorous measurement of intercellular binding energy can only be made using methods grounded in thermodynamic principles in systems at equilibrium.  We ...

Electric Field-controlled Directed Migration of Neural Progenitor Cells in 2D and 3D Environments

Endogenous electric fields (EFs) occur naturally in vivo and play a critical role during tissue/organ development and regeneration, including that of the central nervous system1,2. These endogenous EFs are generated by cellular regulation of ionic transport combined with the electrical resistance of cells and tissues. It has been reported that applied EF treatment can promote functional repair of spinal cord injuries in animals and humans3,4. In particular, EF-directed cell migration has been demonstrated in a wide variety of cell types5,6, including neural progenitor cells (NPCs)7,8. Application of direct current (DC) EFs is not a commonly available technique in most laboratories. We have described detailed protocols for the application of DC EFs to cell and tissue cultures previously5,11. Here we present a video demonstration of standard methods based on a calculated field strength to set up 2D and 3D environments for NPCs, and to investigate cellular responses to EF stimulation in both single cell growth conditions in 2D, and the organotypic spinal cord slice in 3D. The spinal cordslice is an ideal recipient tissue for studying NPC ex vivo behaviours, post-transplantation, because the cytoarchitectonic tissue organization is well preserved within these cultures9,10. Additionally, this ex vivo model also allows procedures that are not technically feasible to track cells in vivo using time-lapse recording at the single cell level. It is critically essential to evaluate cell behaviours in not only a 2D environment, but also in a 3D organotypic condition which mimicks the in vivo environment. This system will allow high-resolution imaging using cover glass-based dishes in tissue or organ culture with 3D tracking of single cell migration in vitro and ex vivo and can be an intermediate step before moving onto in vivo paradigms.

This protocol demonstrates methods used to establish 2D and 3D environments in custom-designed electrotactic chambers, which can track cells in vivo/ex vivo using time-lapse recording at the single cell level, in order to investigate galvanotaxis/electrotaxis and other cellular responses to direct current (DC) electric fields (EFs).

2D 및 3D 환경에서 신경 전구 세포의 전기장 제어 감독 마이 그 레이션

Endogenous electric fields (EFs) occur naturally in vivo and play a critical role during tissue/organ development and regeneration, including that of the ...

Combinatorial Synthesis of and High-throughput Protein Release from Polymer Film and Nanoparticle Libraries

Polyanhydrides are a class of biomaterials with excellent biocompatibility and drug delivery capabilities. While they have been studied extensively with conventional one-sample-at-a-time synthesis techniques, a more recent high-throughput approach has been developed enabling the synthesis and testing of large libraries of polyanhydrides1. This will facilitate more efficient optimization and design process of these biomaterials for drug and vaccine delivery applications. The method in this work describes the combinatorial synthesis of biodegradable polyanhydride film and nanoparticle libraries and the high-throughput detection of protein release from these libraries. In this robotically operated method (Figure 1), linear actuators and syringe pumps are controlled by LabVIEW, which enables a hands-free automated protocol, eliminating user error. Furthermore, this method enables the rapid fabrication of micro-scale polymer libraries, reducing the batch size while resulting in the creation of multivariant polymer systems. This combinatorial approach to polymer synthesis facilitates the synthesis of up to 15 different polymers in an equivalent amount of time it would take to synthesize one polymer conventionally. In addition, the combinatorial polymer library can be fabricated into blank or protein-loaded geometries including films or nanoparticles upon dissolution of the polymer library in a solvent and precipitation into a non-solvent (for nanoparticles) or by vacuum drying (for films). Upon loading a fluorochrome-conjugated protein into the polymer libraries, protein release kinetics can be assessed at high-throughput using a fluorescence-based detection method (Figures 2 and 3) as described previously1. This combinatorial platform has been validated with conventional methods2 and the polyanhydride film and nanoparticle libraries have been characterized with 1H NMR and FTIR. The libraries have been screened for protein release kinetics, stability and antigenicity; in vitro cellular toxicity, cytokine production, surface marker expression, adhesion, proliferation and differentiation; and in vivo biodistribution and mucoadhesion1-11. The combinatorial method developed herein enables high-throughput polymer synthesis and fabrication of protein-loaded nanoparticle and film libraries, which can, in turn, be screened in vitro and in vivo for optimization of biomaterial performance.

This method describes the combinatorial synthesis of biodegradable polyanhydride film and nanoparticle libraries and the high-throughput detection of protein release from these libraries.

조합의 합성과 고분자 필름과 Nanoparticle 도서관에서 높은 처리량 단백질 출시

Polyanhydrides are a class of biomaterials with excellent biocompatibility and drug delivery capabilities. While they have been studied extensively with ...

Measurement of Tension Release During Laser Induced Axon Lesion to Evaluate Axonal Adhesion to the Substrate at Piconewton and Millisecond Resolution

The formation of functional connections in a developing neuronal network is influenced by extrinsic cues. The neurite growth of developing neurons is subject to chemical and mechanical signals, and the mechanisms by which it senses and responds to mechanical signals are poorly understood. Elucidating the role of forces in cell maturation will enable the design of scaffolds that can promote cell adhesion and cytoskeletal coupling to the substrate, and therefore improve the capacity of different neuronal types to regenerate after injury.
Here, we describe a method to apply simultaneous force spectroscopy measurements during laser induced cell lesion. We measure tension release in the partially lesioned axon by simultaneous interferometric tracking of an optically trapped probe adhered to the membrane of the axon. Our experimental protocol detects the tension release with piconewton sensitivity, and the dynamic of the tension release at millisecond time resolution. Therefore, it offers a high-resolution method to study how the mechanical coupling between cells and substrates can be modulated by pharmacological treatment and/or by distinct mechanical properties of the substrate.

We measured the tension release in an axon that was partially lesioned with a laser dissector by simultaneous force spectroscopy measurement performed on an optically-trapped probe adhered to the membrane of the axon. The developed experimental protocol evaluates the axon adhesion to the culture substrate.

레이저 유도 축삭 병변 동안 긴장 릴리스의 측정 Piconewton 및 밀리 초 단위의 해상도로 기판에 축삭 접착을 평가하는

The formation of functional connections in a developing neuronal network is influenced by extrinsic cues. The neurite growth of developing neurons is ...

Optical Detection of E. coli Bacteria by Mesoporous Silicon Biosensors

A label-free optical biosensor based on a nanostructured porous Si is designed for rapid capture and detection of Escherichia coli K12 bacteria, as a model microorganism. The biosensor relies on direct binding of the target bacteria cells onto its surface, while no pretreatment (e.g.&#160;by cell lysis) of the studied sample is required. A mesoporous Si thin film is used as the optical transducer element of the biosensor. Under white light illumination, the porous layer displays well-resolved Fabry-P&#233;rot fringe patterns in its reflectivity spectrum. Applying a fast Fourier transform (FFT) to reflectivity data results in a single peak. Changes in the intensity of the FFT peak are monitored. Thus, target bacteria capture onto the biosensor surface, through antibody-antigen interactions, induces measurable changes in the intensity of the FFT peaks, allowing for a &#39;real time&#39; observation of bacteria attachment.
The mesoporous Si film, fabricated by an electrochemical anodization process, is conjugated with monoclonal antibodies, specific to the target bacteria. The immobilization, immunoactivity and specificity of the antibodies are confirmed by fluorescent labeling experiments. Once the biosensor is exposed to the target bacteria, the cells are directly captured onto the antibody-modified porous Si surface. These specific capturing events result in intensity changes in the thin-film optical interference spectrum of the biosensor. We demonstrate that these biosensors can detect relatively low bacteria concentrations (detection limit of 104 cells/ml) in less than an hour.

Optical Detection of E. coli Bacteria by Mesoporous Silicon Biosensors

A label-free optical biosensor for rapid bacteria detection is introduced. The biosensor is based on a nanostructured porous Si, which is designed to directly capture the target bacteria cells onto its surface. We use monoclonal antibodies, immobilized onto the porous transducer, as the capture probes. Our studies demonstrate the applicability of these biosensors for the detection of low bacterial concentrations within minutes with no prior sample processing (such as cell lysis).

의 광학 검출<em&gt; E. 대장균</em메조 포러스 실리콘 바이오 센서에 의해&gt; 박테리아

A label-free optical biosensor based on a nanostructured porous Si is designed for rapid capture and detection of Escherichia coli K12 bacteria, as a ...

Measurement of Maximum Isometric Force Generated by Permeabilized Skeletal Muscle Fibers

Analysis of the contractile properties of chemically skinned, or permeabilized, skeletal muscle fibers offers a powerful means by which to assess muscle function at the level of the single muscle cell. Single muscle fiber studies are useful in both basic science and clinical studies. For basic studies, single muscle fiber contractility measurements allow investigation of fundamental mechanisms of force production, and analysis of muscle function in the context of genetic manipulations. Clinically, single muscle fiber studies provide useful insight into the impact of injury and disease on muscle function, and may be used to guide the understanding of muscular pathologies. In this video article we outline the steps required to prepare and isolate an individual skeletal muscle fiber segment, attach it to force-measuring apparatus, activate it to produce maximum isometric force, and estimate its cross-sectional area for the purpose of normalizing the force produced.

Analysis of the contractile properties of chemically skinned, or permeabilized, skeletal muscle fibers offers a powerful means by which to assess muscle function at the level of the single muscle cell. In this article we outline a valid and reliable technique to prepare and test permeabilized skeletal muscle fibers in vitro.

투과성이 골격 근육 섬유에 의해 생성 된 최대 아이소 포스의 측정

Analysis of the contractile properties of chemically skinned, or permeabilized, skeletal muscle fibers offers a powerful means by which to assess muscle ...

Fabrication of a Dipole-assisted Solid Phase Extraction Microchip for Trace Metal Analysis in Water Samples

This paper describes a fabrication protocol for a dipole-assisted solid phase extraction (SPE) microchip available for trace metal analysis in water samples. A brief overview of the evolution of chip-based SPE techniques is provided. This is followed by an introduction to specific polymeric materials and their role in SPE. To develop an innovative dipole-assisted SPE technique, a chlorine (Cl)-containing SPE functionality was implanted into a poly(methyl methacrylate) (PMMA) microchip. Herein, diverse analytical techniques including contact angle analysis, Raman spectroscopic analysis, and laser ablation-inductively coupled plasma-mass spectrometry (LA-ICP-MS) analysis were employed to validate the utility of the implantation protocol of the C-Cl moieties on the PMMA. The analytical results of the X-ray absorption near-edge structure (XANES) analysis also demonstrated the feasibility of the Cl-containing PMMA used as an extraction medium by virtue of the dipole-ion interactions between the highly electronegative C-Cl moieties and the positively charged metal ions.

The fabrication protocol of a dipole-assisted solid phase extraction microchip for the trace metal analysis is presented.

물 샘플에서 추적 금속 분석을위한 쌍극자를 이용한 고체 단계 추출 마이크로 칩의 제작

This paper describes a fabrication protocol for a dipole-assisted solid phase extraction (SPE) microchip available for trace metal analysis in water ...

Detection of Endotoxin in Nano-formulations Using Limulus Amoebocyte Lysate (LAL) Assays

When present in pharmaceutical products, a Gram-negative bacterial cell wall component endotoxin (often also called lipopolysaccharide) can cause inflammation, fever, hypo- or hypertension, and, in extreme cases, can lead to tissue and organ damage that may become fatal. The amounts of endotoxin in pharmaceutical products, therefore, are strictly regulated. Among the methods available for endotoxin detection and quantification, the Limulus Amoebocyte Lysate (LAL) assay is commonly used worldwide. While any pharmaceutical product can interfere with the LAL assay, nano-formulations represent a particular challenge due to their complexity. The purpose of this paper is to provide a practical guide to researchers inexperienced in estimating endotoxins in engineered nanomaterials and nanoparticle-formulated drugs. Herein, practical recommendations for performing three LAL formats including turbidity, chromogenic and gel-clot assays are discussed. These assays can be used to determine endotoxin contamination in nanotechnology-based drug products, vaccines, and adjuvants.

Detection of Endotoxin in Nano-formulations Using Limulus Amoebocyte Lysate LAL Assays

Detection of endotoxins in engineered nanomaterials represents one of the grand challenges in the field of nanomedicine. Here, we present a case study that describes the framework composed of three different LAL formats to estimate potential endotoxin contamination in nanoparticles.

나노 제형에도 Limulus Amoebocyte Lysate (LAL) 분석 실험을 사용 하 여

When present in pharmaceutical products, a Gram-negative bacterial cell wall component endotoxin (often also called lipopolysaccharide) can cause ...

Electric-Field-Induced Neural Precursor Cell Differentiation in Microfluidic Devices

Physiological electric fields (EF) play vital roles in cell migration, differentiation, division, and death. This paper describes a microfluidic cell culture system that was used for a long-term cell differentiation study using microscopy. The microfluidic system consists of the following major components: an optically transparent electrotactic chip, a transparent indium-tin-oxide (ITO) heater, a culture media-filling pump, an electrical power supply, a high-frequency power amplifier, an EF multiplexer, a programmable X-Y-Z motorized stage, and an inverted phase-contrast microscope equipped with a digital camera. The microfluidic system is beneficial in simplifying the overall experimental setup and, in turn, the reagent and sample consumption. This work involves the differentiation of neural stem and progenitor cells (NPCs) induced by direct current (DC) pulse stimulation. In the stem cell maintenance medium, the mouse NPCs (mNPCs) differentiated into neurons, astrocytes, and oligodendrocytes after the DC pulse stimulation. The results suggest that simple DC pulse treatment could control the fate of mNPCs and could be used to develop therapeutic strategies for nervous system disorders. The system can be used for cell culture in multiple channels, for long-term EF stimulation, for cell morphological observation, and for automatic time-lapse image acquisition. This microfluidic system not only shortens the required experimental time, but also increases the accuracy of control on the microenvironment.

In this study, we present a protocol for the differentiation of neural stem and progenitor cells (NPCs) solely induced by direct current (DC) pulse stimulation in a microfluidic system.

미세 유체 장치에서 전기장 유발 신경 전구체 세포 분화

Physiological electric fields (EF) play vital roles in cell migration, differentiation, division, and death. This paper describes a microfluidic cell ...