Name: methods to investigate the regulatory role of small rnas and ribosomal occupancy of plasmodium falciparum
Uploaded: 2015-12-04T14:00:00.000+00:00
Duration: 10 min 22 s
Description: Watch this Scientific Journal Video about Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum at JoVE.com

This research was funded by Doris Duke Charitable Foundation, Burroughs Wellcome Fund, NIH R21DK080994, Duke Chancellor's pilot project fund, the Roche Foundation for Anemia Research and The Bill and Melinda Gates Foundation. G.L. is supported by Duke's UPGG and the NIH (Grant # 5R01AI090141-03) and K.A.W. by the NSF Graduate Research Fellowship Program.

1 : P.에서 작은 크기의 RNA의 분리 IDC 중 열대열 <ol><li> 무성 문화 29 말라리아 기생충을 얻습니다. 참고 : 필요한 문화의 크기가 원하는 응용 프로그램에 따라 다릅니다; 그러나 3 ~ 5 %의 기생충 5 % 적혈구 용적률에 10 ml의 문화는 실시간 PCR (RT-PCR)에 대한 충분한 RNA를 제공합니다. 기법은 초기에 최적화 배양 비동기되었지만 감염 사이클 동안 특정 시점이 요구되는 경우에는, 링 단계 기생충은 늦어도 10-12 시간 후 - 소르비톨 내습보다 동기화에 의해 동기화 될 수 없다. 동기화는 한주기 (약 48 시간) 29 일 후 반복해야합니다. </li><li> 풀 감염된 세포는 함께 (~ 5 × 10 9 적혈구 ~ 5 % 기생충에) 및 적혈구를 펠렛 브레이크없이 5 분 동안 800 XG에 튜브와 원심 분리기의 상단에 차가운 PBS를 입력합니다. </li><li> 원심 분리 후, 첨부,주의 깊게 흡입 피펫을 사용하여 상층 액을 제거진공로, 적혈구 펠렛 이후시키다하기 쉽습니다. 차가운 1X PBS로 한 번 더 펠렛을 씻으십시오. </li><li> 30 분 동안 얼음에 재현 탁 세포 (1X PBS)에 차가운 0.15 % 사포닌의 펠릿과 장소. </li><li> 4 ° C에서 12 분 동안 1,500 XG에 원심 분리기 세포, 차가운 PBS에 뜨는 (색상 어두운 빨간색이 될 것이다)과에 resuspend 펠렛을 제거합니다. 다시 한 번이 단계를 반복합니다. 참고 : 본 마이크로 RNA 기생충 내의 마이크로 RNA의 반사, 그리고 적혈구 오염되었는지 확인하기 위해, 기생충 분리 조건의 수는 시험 하였다 : 1) 사포닌 분해, 2) 사포닌 분해 RNaseA의 숙주 세포의 miRNAs의 치료 및 3과 결합 ) 메틸 - 베타 - 사이클로 덱스트린 처리는 호스트 적혈구에서 기생충을 제거한다. 모든 치료는 비슷한 결과를 주었다. </li><li> 를 Lyse 용해 완충액의 권장 600 μL를 사용하여 절연 기생충 펠릿. 용해 완충액의 부피는 1 ~ 2 %의 적혈구 용적 및 5 % 기생충에서 30 ㎖까지 배양 충분하다. 참고 : 큰 기생충 배양의 경우,이 양이 증가 될 수있다. 적어도 1 분 동안 볼 텍싱하여 철저한 기생충 펠릿의 완전한 용해를 보장하는 것이 중요하다. 또한, 추출을 용이하게하기 위해, 용해 된 샘플은 1.7 ml의 마이크로 원심 튜브에 전달 될 수있다. </li><li> 균질 첨가제 (2 M 아세트산 나트륨, pH를 4)의 60 μL, 또는 6 단계에서 사용되는 용해 완충액의 1/10 볼륨. </li><li> 10 분 동안 얼음에 샘플을 남겨주세요. </li><li> 600 μL, 또는 1 분 동안 각각의 샘플과 와류에 산 페놀 choloroform의 6 단계에서 첨가하여 용해 완충액의 양과 동일한 양을 추가한다. </li><li> 5 분 동안 10,000 XG에서 샘플을 원심 분리하여 수용액 및 유기 상을 분리합니다. 이 스핀 모든 헤모글로빈 / hemozoin가 유기상에 있도록 이상 키트 제안한 것보다 길다. </li><li> 상단 (수성) 층을 수집하고 새로운 튜브로 전송할 수 있습니다. 성상 프로 제시 색 (가능성이) 갈색, 흰색 또는 경우 반복 9, 10 단계TEIN 오염. </li><li> 피펫으로 상층 액의 양을 결정하고 100 % 에탄올 (~ 800 μL)의 1.25 볼륨을 추가하고 1.7 ml의 마이크로 원심 튜브 5 번 반전 섞는다. </li><li> 1 분 또는 진공 매니 폴드를 사용하여 14,000 XG에서 하나 원심 분리에 의해 제공 RNA 결합 필터 카트리지를 통해 각각의 샘플을 (상업적으로 사용할 수있는 여러 가지있는) 전달합니다. </li><li> miRNA의 700 μL 버퍼 (1)가 1 분 동안 14,000 XG에서 회전, 마이크로 원심을 사용하여 세척과 필터 카트리지를 씻으십시오. </li><li> 두 번 1 분마다 14,000 XG에 원심 분리하여 500 μL 세척 버퍼 2/3로 필터 카트리지를 씻으십시오. </li><li> 1 분마다 14,000 XG에 원심 분리, 50 μL의 두 세척에서 95 ºC로 예열 된 100 μL DEPC 물과 용출 RNA. 260 나노 미터에서의 UV 흡광도를 통한 RNA의 농도를 측정한다. 주 : RNA 겔 (TBE 우레아 또는 아크릴 변성 포름 알데히드 아가 로스 겔 어느) 수 bE는 고립의 RNA의 크기 분포를 평가하기 위해 사용된다. 참고 :이 RNA는 마이크로 어레이, RNA 시퀀싱, 북부 오점과 리보 뉴 클레아 제 보호 분석에 의한 분석에 적합하다. </li></ol> 2 : P.에서 작은 크기의 RNA의 정량 IDC 중 열대열 <ol><li> 260 nm의 자외선 분광 광도계를 사용하여 1 단계에서 고립 된 개인 샘플의 농도를 결정합니다. </li><li> 원하는 RNA 종에 대한 실시간 PCR 프라이머를 생성합니다. 의 mRNA 또는 융합의 miRNA-mRNA를 위해 우리가 SYBR 녹색을 위해 프라이머를 설계하는 동안 miRNA의 혼자, 우리는 미리 만들어진 miRNA의 qPCR에 분석을 사용했다. 반대 mRNA의 서열 (: ATCGAACATGCTGTGAACAT PKA-R)에서 miRNA의 하류 유전자 특이 프라이머 ~ 100 BP는 동안, 상기 융합 RNA를 들어, 정방향 프라이머는 miRNA의 순서 자체 (AAACCGTTACCATTACTGAGTT은 miR-451)이었다. </li><li> 사용하여 RNA 샘플 중 하나의 mRNA 및 / 또는 miRNA의 용의 miRNAs (RNA의 20 ~ 40 ng의 사용) 단독으로 또는 임의의 헥사에 대한 헤어핀 프라이머로부터 cDNA를 확인-mRNA 융합 종 (RNA 1 μg의 사용). 실내 온도로 냉각, 65 ℃에서 5 분 동안 RNA와 프라이머를 섞는다. 그 후, 역전사 효소를 추가 믹스 (0.5 μL 역전사, 0.5 μL의 RNase 억제제, 1 μL의 dNTPs의 (2.5 mM의 각각)을, 4 배 μL 완충액, 2 ㎕의 0.1 M DTT, 1 μL H 2 O). <ol><li> SYBR 녹색 또는의 TaqMan 프로브를 감지 할 수있는 열 순환기에 실행 샘플. 특정 유전자에 대한 PCR (30) 양적 녹색 SYBR은을 사용하여, 40 사이클, 3 단계 PCR, 15 초 동안 95 ° C, 가장 낮은 프라이머 어닐링 온도 영하 30 초 동안 5 ° C로 실행, 30 초 동안 68 ℃, 상업 SYBR 녹색 마스터 믹스. miRNA의 실시간 PCR은 40 사이클, 1 분 동안, 두 단계의 PCR로 15 초 동안 95 ° C에서 60 ° C를 실행 하였다. </li><li> ΔΔCt 방법을 사용하여 분석을 정량화하거나 랩는 GTPase (PF08_0110) 또는 18S rRNA의 (31)에 대해 그들을 정상화. </li></ol></li></ol> 3 : 소개말라리아 기생충에 작은 RNA를의 <ol><li> 형질 당 적혈구의 300 μL 펠렛 브레이크 1에서 5 분 동안 800 XG에서 원심 분리하여 완전한 말라리아 매체 (적혈구의 250 μL, 1.5 × 109 세포를, 궁극적으로 사용된다). </li><li> RPMI 완벽한 cytomix (120 밀리미터의 KCl에 재현 탁 회 적혈구를 씻으 0.15 mM의 CaCl2를 10 mM의 K 2 HPO 4 / KH 2 PO 4, 산도 7.6, 25 mM의 HEPES, pH가 7.6, 2 mM의 EGTA, pH가 7.6; 5 밀리미터의 MgCl 2, 브레이크 1에서 5 분 동안 800 XG에 원심 후 50 % 적혈구 용적률에서) KOH로 pH를 조정. </li><li> 0.2 cm의 전기 큐벳에 세포를 전송합니다. </li><li> 큐벳에 사용자 지정 합성 올리고 뉴클레오티드의 10 μg의 또는 해당하는 금액을 추가하고 문화를 재현 탁. </li><li> 310 V / 950 μF에 electroporator을 조정하고 각각의 큐벳에 펄스를 제공합니다. </li><li> 미리 예열 완전한 말에 큐벳 내 적혈구의 300 μl를 재현 탁아리아 미디어와 24 웰 플레이트에서 그들을 플레이트와 말라리아 혈액 가스 믹스 밀폐 용기에 37 ℃에서 부화 (3 % O 2, 5 % CO 2). </li><li> 4 시간 후, 1 %의 대략적인 최종 기생충에 동기화 후반 trophozoites로 형질 적혈구를 감염. </li><li> 감염 문화마다 4-6일 갓 형질 전환 된 적혈구를 추가하고 섹션 4에 나타낸 바와 같이, 유유-1 염색을 사용하여 FACS에 의해 %의 기생충을 결정합니다. </li></ol> 4 : 기생충 감염률시 적혈구 마이크로 RNA 효과의 결정 <ol><li> 1.7 ml의 microcentrifuge 관에 micropipettor과 장소에 의해 재 부유 문화의 100 μl를 가져 가라. 5 분 동안 800 XG에서 원심 분리하여 탁상의 microcentrifuge 1 1X PBS ㎖의 원심 분리기로 두 번 씻으십시오. </li><li> 0.025 %의 글루 타르 알데히드 1 ㎖에 재현 탁 펠렛. 실온에서 20 분 동안 샘플을 품어. 참고 : 샘플은 4 ℃에서 몇 주 동안 여기에 저장 될 수있다. 그 후, 감염된 R 펠렛5 분 800 XG에서 원심 분리하여 수익 증권. 1X PBS 1 ㎖로 두 번 세척 하였다. </li><li> 0.015 %의 사포닌 1 ㎖에 재현 탁 펠렛. 15 분 동안 4 ° C에서 품어. 펠렛을 5 분 동안 800 XG에서 원심 분리하여 적혈구를 감염. 1X PBS 1 ㎖로 두 번 세척 하였다. Repeat.4.3. 1X PBS 1 μL (1000 배)의 DNA 얼룩을 함유 한 용액에 재현 탁 세포. </li><li> 488 nm의 여기에서, 사이토 흐름에 기생충의 정도를 결정하고 ~ 530 nm의 (FL-1) 방출. </li><li> 첫째, 게이트 FSC와 SSC에 따라 흐름 cytometer는 적혈구에 초점을 맞 춥니 다. 그런 다음, FL-1 채널에서 형광에 의해 문이 적혈구에 기생충의도 (감염된 적혈구)를 측정한다. 참고 : 나중에 기생충은 초기 단계 기생충보다 10 배 더 형광, 그리고 감염되지 않은 적혈구 위 ~ 100 배. 또한, 저속에서 수집하여 잡음을 감소시키는 경향이있다. 마지막으로,이 방법은 3-H 결합 및 하이포크 산틴 김사 염색, 이전에보고 된 양을 13으로하고, 모든 기법 GAV와 비교 한비슷한 결과를 전자. </li></ol> 5 :의 miRNA-mRNA의 퓨전 제품의 비오틴 태그 및 용출 <ol><li> 직접 공유 5 &#39;말단에 연결 desthiobiotin와 사용자 지정 합성 RNA 올리고 뉴클레오티드 (DB-)를 주문한다. </li><li> 3 단계에 표시된대로, Desthiobiotin 접합 (DB-)의 miRNA 및 수정되지 않은 miRNA의 (음성 대조군)와 감염되지 않은 적혈구를 형질. </li><li> 피와 형질 전환 된 적혈구를 감염 원충은 0.5 % (1.1 단계)의 시작 기생충에 기생충. </li><li> 1 단계에서 설명한 바와 같이 기생충 RNA 나중에 사일 (96 시간)을 추출합니다. </li><li> 스트렙 트 아비딘 비드 패킹 50 μL와 기생충의 10 μg의 RNA를 부화, 마이크로 피펫을 통해 첨가하고, 4 ℃에서 1 시간 동안 마이크로 원심 튜브에 회 회전한다. </li><li> 30 초 동안 800 XG에 구슬을 펠렛 20 밀리미터의 KCl과 1 / 1,000의 RNase 억제제로 씻는다. </li><li> 2 MM의 비오틴과 200 μL RNA 캡처 용출 버퍼 (20 mM의 KCl을, 1/1과의 경쟁에 의해 구슬에서 용출 RNA를4에서, 000의 RNase 억제제 및 2 mM의 비오틴) ° C 하룻밤 회전. </li><li> 표시 (P)의 농축의 정도를 결정 2 단계에 표시된대로 SYBR 녹색 QRT-PCR과의 TaqMan qPCR에 의한 마이크로 RNA 농축 (양성 대조군)를 사용하여 원충 성적 증명서. </li></ol> 6 : P.의 리보솜 점유를 파악하기 위해 Polysome 분리 열대열 <ol><li> 5 ml의 15 % 수 크로스 용액 (400 mM의 아세트산 칼륨, 25 mM의 칼륨 HEPES, pH가 7.2, 15 mM의 아세트산 마그네슘, 200 μM 사이클로 헥시 미드, 1 mM의 DTT, 1mM의 PMSF, 40 U / ㎖의 RNase 억제제, 및 15 % 수 크로즈를 배치 ) SW41의 초 원심 분리기 튜브 (14 X 89mm)로. </li><li> 5 ㎖ 주사기를 사용하여 5 ml의 50 % 수 크로스 용액 (400 mM의 아세트산 칼륨, 25 mM의 칼륨 HEPES, pH가 7.2, 15 mM의 아세트산 마그네슘, 200 μM 사이클로 헥시 미드, 1 mM의 DTT, 1mM의 PMSF, 40 U / ㎖의 RNase를 추가 억제제 및 긴 강철 바늘을 사용하여 15 %의 자당 아래 50 % 수크로오스)를 선택한 다음, 바늘을 제거한다. </li><l난&gt;, 파라 필름 구배 튜브의 상단을 밀봉 롤링을 방지하는 안정 위치에서, 그면에 서서히 튜브 기울인 그래서 탁상에 수평으로 누워있다. 적어도 2 시간 동안 옆에 튜브를 유지합니다. 기다리는 동안, 단계 6.5로 시작합니다. </li><li> 2 시간 후, 천천히 수직 튜브를 기울여 전에 샘플 넣기 적어도 15 분 (14 단계)에 대한 냉각 할 수 있도록 얼음에 튜브를 전송합니다. </li><li> 100 ~ 500 총 RNA의 μg의, 또는 ~ 5 %의 기생충 대략 100 ㎖ 비동기 문화를 생성하기에 충분한 변형체 -infected 혈액 단계 문화를 수집합니다. 10 배 (2 mM)을 사이클로 헥시 미드 (CHX)를 포함하는 배양 배지의 볼륨 번째 1/10을 추가하고 10 분 동안 37 ° C에서 품어. <ol><li> 원심 분리하여 펠렛의 문화는 원심 분리기와 7 분 (브레이크 1) 500 XG에, 다음 PBS 200 μM의 CHX을 포함 1X 실내 온도로 두 번 씻는다. 200 μM의 CHX을 포함 1X PBS에서 기생충 문화를 재현 탁하고 얼음에 저장합니다. </li></ol></lI&gt; <li> RBC 펠렛의 양을 추정하고있다. 용해 완충액 (400 mM의 아세트산 칼륨, 25 mM의 칼륨 HEPES, pH가 7.2, 15 mM의 아세트산 마그네슘, 200 μM의 CHX, 1mM의 DTT, 1mM의 PMSF, 40 U / ㎖의 RNase 억제제, 1 % (v / v)의 IGEPAL CA를 추가 -630, 0.5 ml의 4.25 %의 최종 부피 RBC 펠릿에 DOC) (/ V w). 4에서 해물을 품어 회전하면서 10 분 동안 C를 °. </li><li> 마이크로 원심 튜브에 해물을 전송하고 16,000 XG 4에서의 microcentrifuge에서 원심 분리 10 분 동안 C를 °. </li><li> M 0.5 차가운 수크로오스 쿠션 용액 (400 mM의 아세트산 칼륨, 25 mM의 칼륨 HEPES, pH가 7.2, 15 mM의 아세트산 마그네슘, 200 μM 사이클로 헥시 미드, 1 mM의 DTT, 1mM의 PMSF, 40 U / ㎖의 RNase 1.25 mL를 피펫 팅하여 크로스 쿠션을 제조 SW55의 초 원심 분리기 튜브 (13 X 51mm)로 억제하고, 0.5 M 자당). </li><li> 조심스럽게 주사기 및 작은 (1-27) 게이지 바늘을 사용하여 수크로오스 쿠션의 상부에 (단계 7)에서 파쇄 상등액을 3.75 mL의 층을 포함한다. STOR섹션 1에 표시된 전자 -80 ° C에서 나머지 해물 (~ 500 μL)는 총 RNA 수준을 추출한다. </li><li> 4 사전 냉장 초 원심 분리기 로터로 샘플을로드 13.2 ml의 튜브를 저장할 수 ° C. 366,000 XG에서 샘플을 원심 분리기 146 분 동안 4 ° C. </li><li> 피펫을 사용하여, 15ML 원뿔 관에 뜨는을 전송합니다. 무료 (리보솜에 의해 언 바운드)의 RNA의 RN​​A 분리에 대한 -80 ° C에서 뜨는을 저장합니다. </li><li> 리보솜 재현 탁 완충액 (400 mM의 아세트산 칼륨, 25 mM의 칼륨 HEPES, pH가 7.2, 15 mM의 아세트산 마그네슘, 200 μM 사이클로 헥시 미드, 1 mM의 DTT, 1mM의 PMSF 및 40 U / ㎖의 RNase 억제제) 500 μL에 리보솜 펠렛을 재현 탁 5 분간 피펫 팅. </li><li> 16,000 XG 4에서 마이크로 원심에서 샘플을 원심 분리기 &#160; 10 분 동안 C를 °. </li><li> 얼음에 4 단계에서 기울기를 유지하면서 조심스럽게 그라데이션 USI 위에 리보솜 현탁액 층, 파라 필름 제거NG 주사기와 작은 (~ 27) 게이지 바늘. </li><li> 미리 냉장 초 원심 분리기 회 전자에 튜브를 넣고 20 XG 180 분 동안 4 ° C에서로드 구배 원심 분리. 스핀이 완료되면, 저장 4에서 구배 원심 준비가 될 때까지 ° C는 분별에로드합니다. </li><li> 분별 구배 초 원심 분리기에 빈 튜브 (이 이전 실행에서 사용되는 튜브 일 수 있음)을로드 한 후 100 × 103의 속도에서 5 분 동안의 RNA 분해 효소가없는 물을 세척한다. </li><li> 단계 6.16의 세척 동안 UV 흡광도 검출기의 감도를 설정한다. 좋은 시작 민감도는 0.2이지만,이 이후 (기생충 번호 등에 따라 상당히 달라질 수 있음) (254) 신호에 따라 타점 조절 될 필요가있다. </li><li> 검출기 감도가 설정되면 물 검출기를 통해 흐르는 동안, 제로 기준 신호를 설정한다. </li><li> 다음 라인이 비어 있고 REM까지 분획 수집기를 세정 후, 액체의 역류빈 초원 심 분리기 튜브를 비켜. </li><li> 이 바늘 장치를 종료 할 때까지 분별을 통해 60 % 자당 솔루션을 실행합니다. </li><li> - 조 이상 않도록주의하면서 로딩 챔버의 상단에있는 최초의 기울기를 포함하는 튜브를 삽입하고 도장을 조입니다. 그리고, 바늘로 튜브의 바닥을 관통. </li><li> (펌프의 전면 유속 조절기에 의해 제어 됨) 12.5 × 106에 유체 흐름의 속도를 재설정 한 후 18 초간의 분획을 수집하는 자동화 된 분획 수집기를 설정 (~ 330 μL / 분획) 마이크로 원심 튜브. </li><li> 앞으로 60 % 자당 용액의 흐름을 시작합니다. </li><li> 구배 용액의 첫번째 드롭 마이크로 원심 튜브로 떨어지면, 즉시 분획 수집 및 신호 (254)의 실시간 기록 모두를 시작한다. </li><li> 급락이 50 % 및 60 % 자당 용액의 계면에 해당하는 신호 (254)에서 관찰하면, 유체 흐름 (254)을 모두 정지 </sUB&gt; 녹화. </li><li> 그라데이션 분수에 보관 -80 &#160; 나중에 사용하기 위해 C를 °. </li><li> 60 % 수크로오스 용액을 초 원심 분리기 튜브에서 비운다까지 100 × 106의 유체 속도로 역류. </li><li> 분별 추가적인 구배가있는 경우, 로딩 챔버로부터 빈 초 원심 튜브를 제거하고 6.21 단계에서 다시 시작. 모든 샘플이 완료된 경우 단계 6.16 및 6.19에서 수행되었을 때, 장치를 세척한다. </li></ol>

<ol>
	<li>World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> World Malaria Report. , (2014).</li><li>Livincstone, F. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malaria+and+human+polymorphisms.">Malaria and human polymorphisms.</a> Annu Rev Genet. 5, 33-64 (1971).</li><li>Nagel, R. L., Roth, E. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malaria+and+red+cell+genetic+defects.">Malaria and red cell genetic defects.</a> Blood. 74, 1213-1221 (1989).</li><li>Aidoo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+effects+of+the+sickle+cell+gene+against+malaria+morbidity+and+mortality.">Protective effects of the sickle cell gene against malaria morbidity and mortality.</a> Lancet. 359, 1311-1312 (2002).</li><li>Tiffert, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+hydration+state+of+human+red+blood+cells+and+their+susceptibility+to+invasion+by+Plasmodium+falciparum.">The hydration state of human red blood cells and their susceptibility to invasion by Plasmodium falciparum.</a> Blood. 105, 4853-4860 (2005).</li><li>Fairhurst, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Abnormal+display+of+PfEMP-1+on+erythrocytes+carrying+haemoglobin+C+may+protect+against+malaria.">Abnormal display of PfEMP-1 on erythrocytes carrying haemoglobin C may protect against malaria.</a> Nature. 435, 1117-1121 (2005).</li><li>Cyrklaff, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemoglobins+S+and+C+interfere+with+actin+remodeling+in+Plasmodium+falciparum-infected+erythrocytes.">Hemoglobins S and C interfere with actin remodeling in Plasmodium falciparum-infected erythrocytes.</a> Science. 334, 1283-1286 (2011).</li><li>Friedman, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Erythrocytic+mechanism+of+sickle+cell+resistance+to+malaria.">Erythrocytic mechanism of sickle cell resistance to malaria.</a> Proceedings of the National Academy of Sciences of the United States of America. 75, 1994-1997 (1978).</li><li>Pasvol, G., Weatherall, D. J., Wilson, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+mechanism+for+the+protective+effect+of+haemoglobin+S+against+P.+falciparum+malaria.">Cellular mechanism for the protective effect of haemoglobin S against P. falciparum malaria.</a> Nature. 274, 701-703 (1978).</li><li>Lecellier, C. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cellular+microRNA+mediates+antiviral+defense+in+human+cells.">A cellular microRNA mediates antiviral defense in human cells.</a> Science. 308, 557-560 (2005).</li><li>Niu, Q. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+artificial+miroRNAs+in+transgenic+Arabidopsis+thaliana+confers+virus+resistance.">Expression of artificial miroRNAs in transgenic Arabidopsis thaliana confers virus resistance.</a> Nature biotechnology. 24, 1420-1428 (2006).</li><li>Zhao, G., Yu, D., Weiss, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNAs+in+erythropoiesis.">MicroRNAs in erythropoiesis.</a> Curr Opin Hematol. 17, 155-162 (2010).</li><li>Lee, Y. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LIN28B-mediated+expression+of+fetal+hemoglobin+and+production+of+fetal-like+erythrocytes+from+adult+human+erythroblasts+ex+vivo.">LIN28B-mediated expression of fetal hemoglobin and production of fetal-like erythrocytes from adult human erythroblasts ex vivo.</a> Blood. 122, 1034-1041 (2013).</li><li>Sangokoya, C., Doss, J. F., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iron-responsive+miR-485-3p+regulates+cellular+iron+homeostasis+by+targeting+ferroportin.">Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin.</a> PLoS genetics. 9, e1003408 (2013).</li><li>Chen, S. Y., Wang, Y., Telen, M. J., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genomic+analysis+of+erythrocyte+microRNA+expression+in+sickle+cell+diseases.">The genomic analysis of erythrocyte microRNA expression in sickle cell diseases.</a> PLoS ONE. 3, e2360 (2008).</li><li>Sangokoya, C., Telen, M. J., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=microRNA+miR-144+modulates+oxidative+stress+tolerance+and+associates+with+anemia+severity+in+sickle+cell+disease.">microRNA miR-144 modulates oxidative stress tolerance and associates with anemia severity in sickle cell disease.</a> Blood. 116, 4338-4348 (2010).</li><li>Deitsch, K., Driskill, C., Wellems, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+malaria+parasites+by+the+spontaneous+uptake+and+expression+of+DNA+from+human+erythrocytes.">Transformation of malaria parasites by the spontaneous uptake and expression of DNA from human erythrocytes.</a> Nucleic acids research. 29, 850-853 (2001).</li><li>Liang, X. H., Haritan, A., Uliel, S., Michaeli, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=trans+and+cis+splicing+in+trypanosomatids:+mechanism,+factors,+and+regulation.">trans and cis splicing in trypanosomatids: mechanism, factors, and regulation.</a> Eukaryotic cell. 2, 830-840 (2003).</li><li>Baum, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+genetics+and+comparative+genomics+reveal+RNAi+is+not+functional+in+malaria+parasites.">Molecular genetics and comparative genomics reveal RNAi is not functional in malaria parasites.</a> Nucleic acids research. 37, 3788-3798 (2009).</li><li>Hall, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+survey+of+the+Plasmodium+life+cycle+by+genomic,+transcriptomic,+and+proteomic+analyses.">A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses.</a> Science. 307, 82-86 (2005).</li><li>Caro, F., Ahyong, V., Betegon, M., DeRisi, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+regulatory+dynamics+of+translation+in+the+asexual+blood+stages.">Genome-wide regulatory dynamics of translation in the asexual blood stages.</a> eLife. 3, (2014).</li><li>Oehring, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organellar+proteomics+reveals+hundreds+of+novel+nuclear+proteins+in+the+malaria+parasite+Plasmodium+falciparum.">Organellar proteomics reveals hundreds of novel nuclear proteins in the malaria parasite Plasmodium falciparum.</a> Genome biology. 13, R108 (2012).</li><li>Lasonder, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+Plasmodium+falciparum+proteome+by+high-accuracy+mass+spectrometry.">Analysis of the Plasmodium falciparum proteome by high-accuracy mass spectrometry.</a> Nature. 419, 537-542 (2002).</li><li>Bozdech, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcriptome+of+the+intraerythrocytic+developmental+cycle+of+Plasmodium+falciparum.">The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum.</a> PLoS biology. 1, E5 (2003).</li><li>Gardner, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+the+human+malaria+parasite+Plasmodium+falciparum.">Genome sequence of the human malaria parasite Plasmodium falciparum.</a> Nature. 419, 498-511 (2002).</li><li>Zhang, M., Joyce, B. R., Sullivan, W. J., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+control+in+Plasmodium+and+toxoplasma+parasites.">Translational control in Plasmodium and toxoplasma parasites.</a> Eukaryotic cell. 12, 161-167 (2013).</li><li>Lacsina, J. R., LaMonte, G., Nicchitta, C. V., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+profiling+of+the+malaria+parasite+Plasmodium+falciparum.">Polysome profiling of the malaria parasite Plasmodium falciparum.</a> Molecular and biochemical parasitology. 179, 42-62 (2011).</li><li>Bunnik, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+profiling+reveals+translational+control+of+gene+expression+in+the+human+malaria+parasite+Plasmodium+falciparum.">Polysome profiling reveals translational control of gene expression in the human malaria parasite Plasmodium falciparum.</a> Genome biology. 14, R128 (2013).</li><li>LaMonte, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translocation+of+sickle+cell+erythrocyte+microRNAs+into+Plasmodium+falciparum+inhibits+parasite+translation+and+contributes+to+malaria+resistance.">Translocation of sickle cell erythrocyte microRNAs into Plasmodium falciparum inhibits parasite translation and contributes to malaria resistance.</a> Cell host &amp; microbe. 12, 187-199 (2012).</li><li>Lambros, C., Vanderberg, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synchronization+of+Plasmodium+falciparum+erythrocytic+stages+in+culture.">Synchronization of Plasmodium falciparum erythrocytic stages in culture.</a> The Journal of parasitology. 65, 418-420 (1979).</li><li>Bourgeois, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+three+real-time+PCR+methods+with+blood+smears+and+rapid+diagnostic+test+in+Plasmodium+sp.+infection.">Comparison of three real-time PCR methods with blood smears and rapid diagnostic test in Plasmodium sp. infection.</a> Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases. 16, 1305-1311 (2010).</li><li>Abruzzo, L. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Validation+of+oligonucleotide+microarray+data+using+microfluidic+low-density+arrays:+a+new+statistical+method+to+normalize+real-time+RT-PCR+data.">Validation of oligonucleotide microarray data using microfluidic low-density arrays: a new statistical method to normalize real-time RT-PCR data.</a> Biotechniques. 38, 785-792 (2005).</li><li>Sangokoya, C., LaMonte, G., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+microRNAs+of+human+mature+erythrocytes.">Isolation and characterization of microRNAs of human mature erythrocytes.</a> Methods in molecular biology. 667, 193-203 (2010).</li><li>Rathjen, T., Nicol, C., McConkey, G., Dalmay, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+short+RNAs+in+the+malaria+parasite+and+its+red+blood+cell+host.">Analysis of short RNAs in the malaria parasite and its red blood cell host.</a> FEBS Lett. 580, 5185-5188 (2006).</li><li>Xue, X., Zhang, Q., Huang, Y., Feng, L., Pan, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=No+miRNA+were+found+in+Plasmodium+and+the+ones+identified+in+erythrocytes+could+not+be+correlated+with+infection.">No miRNA were found in Plasmodium and the ones identified in erythrocytes could not be correlated with infection.</a> Malar J. 7, 47 (2008).</li></ol>

The authors have no competing financial interests to declare.

HBS는 P. 의한 심각한 말라리아에 대한 보호를 제공하기 때문에 주로, 말라리아 풍토병 지역에서 가장 일반적인 헤모글로빈 변형 중 하나이다 열대열. 기술 P.의 유전자 조절에 인간 마이크로 RNA의 역할을 특성화하는 데 필요한 원충이 원고에 걸쳐 자세히 설명되어 있습니다. 모든 작은 RNA를 포함하는 방식으로 전체 RNA를 추출하고, 비교적 간단 기생충 용해 절차를 수행?...

속 변형체의 apicomplexan 기생충에 의한 말라리아는 전 세계적으로 매년 약 200 만 명이 감염과 주변 60 만 명이 사망 한 원인이 가장 일반적인 인간의 기생 질환이다. 인간을 감염 다섯 변형체 종의 인간의 질병에 가장 관련성이 피입니다 열대열 및 P. 심한 말라리아 합병증에 대한 그들의 널리 분포하고 잠재적으로 인해 삼일 열,. 말라리아 기생충의 라이프 사이클은 모기와 인간 모두의 감염을 필요로한다. 감염된 모기에 물린 인간 때 기생충 복제의 초기 라운드가 발생 간 혈류를 통해 이동한다. 호스트로부터 간세포 merozoites 파열 후에, 그들은 무성 성적 어느 복제를 개시 근처 적혈구 세포를 감염. P. 48 시간 지속 복제의 무성 단계, 그것은 대부분의 말의 소스를 모두이기 때문에 원충이 연구의 초점이다아리아 증상과 쉽게 체외에서 효과적으로 요약된다. 개선 말라리아 치료 포함한 공중 보건 사업의 수가 다소 세계적 말라리아의 부담을 감소되었지만, 약제 내성 기생충 계속 출현 말라리아 제어 노력에 문제가있다. 새로운 치료 방법을 제안 할 수 있습니다 하나의 영역은 유전 적 변이가 말라리아에 대한 저항성을 부여하는 방법을 여러 가지의 연구이다. 말라리아 발병 지역에서는 적혈구 다형성의 다양한 2,3 아주 일반적이다. 겸상 적혈구 아마도 가장 눈에 띄는되는 이러한 돌연변이는 종종 증상이 말라리아 감염 4의 발병에 상당한 저항과 연결되어 있습니다. 그들은 말라리아 감염에 저항하는 적혈구의 원인이되는 기본 메커니즘은 불완전하게 이해된다. 헤모글로빈 돌연변이와 기생 적혈구 향상 세포 강성과 탈수를 통해 향상된 식균 작용의 대상이되는P.에 의해 감소 침략과 연관되어 5 원충. HBC 대립 유전자는 적혈구 표면과 세포 골격의 리모델링, 추가 기생충 개발 6,7 억제와 단백질 발현에 영향을 미친다. 마지막으로, P. 원충은 동형 접합 낫 내에서 제대로 성장 (HBSS)는 말라리아 저항의 고유 적혈구 요인을 제안, 체외에서 8,9 적혈구. 이러한 메커니즘은 모두 역할을하는 것으로 나타나는 반면 그러나, 이들은 완전히 말라리아 겸상 적혈구 성 뒤에 메커니즘을 설명하지 않는다. 제대로 이해 남아 적혈구 요인 중 하나 잠재적 인 세트는 성숙한 적혈구 내에서 miRNA의 존재의 큰 풀입니다. 마이크로 RNA는 3 &#39;UTR 내 염기쌍에 의해 번역 및 / 또는 대상의 mRNA의 안정성을 중재 19-25 NT 크기가 작은 비 코딩 RNA를,이다. 이들은 억제 O 포함한 포유 동물 면역 반응의 조절에 연루되어왔다F 바이러스 복제 10 및 식물에서 바이러스에 대한 내성을 부여하는 것으로 나타났다는 그들은 또한 적혈구 11,12 철 대사 (13)를 포함한 여러 적혈구 프로세스를 조절하는 것으로 나타났다. 이전의 연구는 식 극적으로 HBSS에 변경된 14, 15를 적혈구 적혈구의 miRNAs의 풍부하고 다양한 인구를 확인했다. 성숙한 적혈구가 활성화 전사 및 번역이 부족하기 때문에,이 적혈구의 miRNA의 기능 역할은 확실하지 않다. 중요한 물질 교환이 숙주 세포 및 P.간에 발생로서 intraerythrocytic 발달주기 (IDC) 16시 원충, 그것은 HBS의 적혈구 내에서 변경 miRNA의 프로파일이 직접 세포 고유 말라리아 저항에 기여할 수 있음을 추측했다. 이러한 연구는 궁극적으로, 기능적으로 분리 식별 m 이내에 인간의 miRNA의 역할을 연구하기 위해 파이프 라인의 개발을 주도alaria 기생충, P. 그 호스트 / 인간의 miRNAs는 궁극적으로 공유 퓨즈 다음 병진 기생충 mRNA의 성적 증명서 (17)를 억제 것으로 나타났다 원충. 이는 트랜스 - 스 플라이 싱에 의해 형성된 제 1 단면 종 키메라 사체의 예를 제공하고 본의 miRNA-mRNA의 융합 다른 기생충을 포함하는 다른 종에서 발생 될 수 있음을 연루. 모든 trypanosome의 mRNA는 트랜스 - 스 플라이 싱 스플 라이스 리더 (SL)과 폴리 시스 트론 성적 증명서 (18)의 분리를 조절한다. P. 이후 원충이 다이 서 (Dicer) / 전 (19, 20)에 대한 orthologs 부족, 그것은 적혈구의 miRNAs는 P. 유사한 SL 기계를 공중 납치 가능성이있다 원충은 표적 유전자에 통합합니다. (P)의 최근 연구 원충은 사실 5 &#39;스플 라이스 리더 시퀀스 (21)의 존재를 표시합니다. 이 연구는 transcriptomic 및 transla 모두를 포함하여, 인간 기생충의 miRNA-mRNA의 융합 성적 증명서의 발견에지도 방법의 자세한 사항조절적인 기법. 이러한 방법의 전체 목표는 P.의 유전자 조절, 표현형 및 번역 가능한 소형의 RNA의 효과를 조사한다 원충의 성적 증명서. 인간 기생충 키메라 사체의 초기 식별은 오히려 단지 작은 RNA를 격리 기술을 이용하여보다 총과 작은 양의 RNA를 포함 실시간 PCR, 전 사체의 서열 및 EST 라이브러리 캡처 같은 RNA 분석 기법의 사용에 의존. 하나의 큰 풀에 함께 모든 RNA를 분리, 별도로보다 오히려, 기생충 모두 전좌 작은 RNA를 인간의 식별뿐만 아니라 더 큰 서열의 일부로서 이러한 작은 RNA 서열의 존재를 허용했다. 이것은 이들 융합체의 작용 결과를 결정하기 위해 이러한 융합 된 mRNA의 번역 상태의 분석을 요구했다. 기생충의 게놈의 특성에 대한 광범위한 노력하는 동안D의 사체는 기생충의 생물학 22-25의 이해에 추가 한, 훨씬 덜은 경찰의 수명주기에 걸쳐 mRNA의 사체의 번역 규제에 대해 알려진 원충 (26). 기생충의 프로테옴이 제한된 이해는 기생충의 생물학의 이해와 항 말라리아 치료제의 다음 세대를위한 새로운 목표를 식별 할 수있는 능력을 모두 방해했다. 기생충의 세포 생물학의 이해에이 격차는 경찰에서 번역 규제를 조사하기 위해 적절한 기술의 부족으로 주로 인해 지속하고있다 열대열. 최근의 논문은 P.의 리보솜 배출량 측정의 사용을 설명 원충은 글로벌 번역 상태 (21)를 결정합니다. 성적 증명서의 번역 가능성 중 하나가 튼튼한 측정 polysom​​e 프로파일에 의해 결정 관련 리보솜의 수입니다. 그러나,이 기술은 적용된다 P. 원충 &lt;/ EM&gt;, 대부분의 polysom​​es를 복구 할 수 없으며 주로 monosomes을 캡처합니다. 최근 여러 그룹 27, 28은 피 최적화 된 polysomes을 보존하고 호스트 적혈구 (28)에서의 무성 개발 과정이 말라리아 기생충의 리보솜 점유 및 번역 가능성의 특성을 동시에 적혈구 및 기생충을 용균하여 원충 polysome 기술. 종합적으로,이 방법은 인간의 miRNA와 기생충의 mRNA의 관찰 융합은 이전에보고 된 방법 (27)를 사용하여 증명되었다 그 융합의 mRNA의 기생충 단백질 번역을 조절하고, HBA가 말라리아 저항의 주요 결정 요인이며, HBSS 17 적혈구 것을 보여줍니다. 이러한 방법은 그 융합의 RNA가 (P) 내에 있는지, RNA 접합 이벤트를 식별하고 기능적으로 탐구하고자하는 모든 시스템에 유용 할 것이다 원충 또는 다른 진핵 시스템.

<table><tbody><tr><td>&lt;strong&gt;REAGENTS-All reagents must be RNAse-free.&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Diethyl pyrocarbonate</td><td>Sigma</td><td>D5758</td><td>DEPC</td></tr><tr><td>DEPC-treated water (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>Yoyo-1 DNA fluorescent dye</td><td>Thermo Fisher</td><td></td><td></td></tr><tr><td>Gene Pulser II electroporator</td><td>Bio-Rad</td><td></td><td></td></tr><tr><td>0.2 cm Electroporation cuvettes</td><td></td><td></td><td></td></tr><tr><td>4 M potassium acetate</td><td>Mallinckrodt</td><td>6700</td><td></td></tr><tr><td>2 M potassium HEPES</td><td>Sigma</td><td>H0527</td><td>pH 7.2</td></tr><tr><td>1 M magnesium acetate</td><td>Sigma</td><td>M-2545</td><td></td></tr><tr><td>1 M dithiothreitol</td><td>Research Products International</td><td>D11000</td><td>DTT</td></tr><tr><td>100 mM phenylmethylsulfonate fluoride</td><td>Sigma</td><td>P7626</td><td>PMSF, dissolved in isopropanol</td></tr><tr><td>10% (v/v) Igepal CA-630</td><td>Sigma-Aldrich</td><td>I3021</td><td></td></tr><tr><td>10% (w/v) sodium deoxycholate</td><td>Sigma</td><td>D-6750</td><td>DOC</td></tr><tr><td>Cycloheximide</td><td>Sigma</td><td>C-7698</td><td>CHX</td></tr><tr><td>Sucrose</td><td>Mallinckrodt</td><td>8360-04</td><td></td></tr><tr><td>RNAseOUT (Invitrogen, cat. no. 100000840)</td><td>Invitrogen</td><td>100000840</td><td></td></tr><tr><td>RPMI-1640 w/ L-glutamine</td><td>Cellgro</td><td>10-040-CV</td><td></td></tr><tr><td>10% AlbuMAX I</td><td>Invitrogen</td><td>11020-039</td><td>w/v in sterile water</td></tr><tr><td>Gentamicin</td><td>Gibco</td><td>15750-060</td><td></td></tr><tr><td>HT supplement (100x) (Invitrogen, cat. no. 11067030)</td><td></td><td></td><td></td></tr><tr><td>45% (w/v) sucrose (Sigma, cat no. G8769)</td><td></td><td></td><td></td></tr><tr><td>1 M HEPES buffer (Gibco, cat. no. 15630-080)</td><td></td><td></td><td></td></tr><tr><td>1x phosphate buffered saline (PBS; Cellgro, cat. no. 2109310CV)</td><td></td><td></td><td></td></tr><tr><td>Corning 500 ml vacuum filter flask (VWR, cat. no. 430769)</td><td></td><td></td><td></td></tr><tr><td>Glass slides (VWR, cat. no. 48311-702)</td><td></td><td></td><td></td></tr><tr><td>Giemsa stain (50X) (VWR, cat no. m708-01)</td><td></td><td></td><td></td></tr><tr><td>mirVana miRNA isolation kit (Ambion, ThermoFisher Scientific).</td><td></td><td></td><td></td></tr><tr><td>5&#039; Biotin conjugated mature miRNA (sequence varies by miRNA of interest) (Dharmacon)</td><td></td><td></td><td></td></tr><tr><td>Biotin powder (Sigma-Aldrich)</td><td></td><td></td><td></td></tr><tr><td>1 M Potassium Chloride</td><td></td><td></td><td></td></tr><tr><td>Streptavidin Sepharose High Performance Beads (GE Healthcare)</td><td></td><td></td><td></td></tr><tr><td>Ribosome resuspension buffer (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>Lysis buffer (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>15% (w/v) sucrose gradient solution (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>50% (w/v) sucrose gradient solution (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>0.5 M sucrose cushion (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>60% (w/v) sucrose chase solution (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>Plasmodium cell culture media (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>RNA capture Wash Buffer (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>RNA Elution Buffer (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;REAGENT SETUP&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Solutions&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Plasmodium cell culture media&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>500 ml RPMI-1640 w/ L-glutamine</td><td></td><td></td><td></td></tr><tr><td>0.5 ml gentamicin</td><td></td><td></td><td></td></tr><tr><td>5 ml HT supplement</td><td></td><td></td><td></td></tr><tr><td>2.5 ml 45% glucose</td><td></td><td></td><td></td></tr><tr><td>25 ml 10% AlbuMAX I</td><td></td><td></td><td></td></tr><tr><td>12.5 ml 1 M HEPES</td><td></td><td></td><td></td></tr><tr><td>Sterile filter with 0.2 mm vacuum filter flask.</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Plasmodium cell culture media containing 10x CHX&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Same recipe as Plasmodium cell culture media above, with the addition of:</td><td></td><td></td><td></td></tr><tr><td>2 mM cycloheximide</td><td></td><td></td><td></td></tr><tr><td>Media is prepared as normal, then add CHX to a final concentration of 2 mM and filter.&amp;nbsp;</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;1x PBS containing cycloheximide&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Cycloheximide is added fresh to 1x PBS to a final concentration of 200 mM, and kept at 4 &lt;sup&gt;O&lt;/sup&gt;C until use.</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Ribosome resuspension buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>400 mM potassium acetate</td><td></td><td></td><td></td></tr><tr><td>25 mM potassium HEPES, pH 7.2</td><td></td><td></td><td></td></tr><tr><td>15 mM magnesium acetate</td><td></td><td></td><td></td></tr><tr><td>200 mM cycloheximide (add fresh)</td><td></td><td></td><td></td></tr><tr><td>1 mM DTT (add fresh)</td><td></td><td></td><td></td></tr><tr><td>1 mM PMSF (add fresh)</td><td></td><td></td><td></td></tr><tr><td>40 U/ml RNaseOUT (add fresh)</td><td></td><td></td><td></td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Lysis buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Same recipe as ribosome resuspension buffer above, with the addition of:</td><td></td><td></td><td></td></tr><tr><td>1% (v/v) Igepal CA-630</td><td></td><td></td><td></td></tr><tr><td>0.5% (w/v) DOC</td><td></td><td></td><td></td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Sucrose solutions&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Same recipe as ribosome resuspension buffer above, with the addition of varying amounts of sucrose:</td><td></td><td></td><td></td></tr><tr><td>15% (w/v) sucrose to make 15% sucrose gradient solution</td><td></td><td></td><td></td></tr><tr><td>50% (w/v) sucrose to make 50% sucrose gradient solution</td><td></td><td></td><td></td></tr><tr><td>0.5 M sucrose to make 0.5 M sucrose cushion</td><td></td><td></td><td></td></tr><tr><td>As above, cycloheximide, DTT, PMSF, and RNaseOUT must be added fresh.</td><td></td><td></td><td></td></tr><tr><td>The 60% sucrose chase solution requires only sucrose and water, no other components</td><td></td><td></td><td></td></tr><tr><td>60% (w/v) sucrose in DEPC-treated water to make 60% sucrose chase solution</td><td></td><td></td><td></td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;RNA Capture Wash Buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>20 mM&amp;nbsp; KCl</td><td></td><td></td><td></td></tr><tr><td>5 unit/ml Rnase Out (Invitrogen)</td><td></td><td></td><td></td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;RNA Capture Elution Buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Same recipe as RNA Capture Wash Buffer, with the addition of:</td><td></td><td></td><td></td></tr><tr><td>2 mM Biotin</td><td></td><td></td><td></td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;EQUIPMENT&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>SW55 Ti ultracentrifuge rotor (Beckman, cat. no. 342194)</td><td></td><td></td><td></td></tr><tr><td>SW41 Ti ultracentrifuge rotor (Beckman, cat. no. 331362)</td><td></td><td></td><td></td></tr><tr><td>Ultra-Clear&lt;sup&gt;TM&lt;/sup&gt; &amp;frac12; x 2 in (13 x 51 mm) ultracentrifuge tubes for the SW55 (Beckman, cat. no. 344057)</td><td></td><td></td><td></td></tr><tr><td>Polyallomer 9/16 x 3 &amp;frac12; in (14 x 89 mm) ultracentrifuge tubes for the SW41 (Beckman, cat. no. 331372)</td><td></td><td></td><td></td></tr><tr><td>L8-80M ultracentrifuge (Beckman)</td><td></td><td></td><td></td></tr><tr><td>Steel blunt syringe needle, 4 inch, 16 G (Aldrich, cat. no. Z261378)</td><td></td><td></td><td></td></tr><tr><td>1 ml syringe with 27 G&amp;frac12; needle (Becton Dickinson, cat no. 309623)</td><td></td><td></td><td></td></tr><tr><td>5 ml syringe (Becton Dickinson, cat. no. 309646)</td><td></td><td></td><td></td></tr><tr><td>Parafilm</td><td></td><td></td><td></td></tr><tr><td>Tube rotator, end-over-end</td><td></td><td></td><td></td></tr><tr><td>Microcentrifuge, refrigerated</td><td></td><td></td><td></td></tr><tr><td>Density gradient fractionation system (Teledyne Isco, cat. no. 69-3873-179)</td><td></td><td></td><td></td></tr><tr><td>TracerDAQ (Measurement Computing)</td><td></td><td></td><td></td></tr><tr><td>Eppendorf 5810R centrifuge</td><td></td><td></td><td></td></tr><tr><td>Eppendorf A-4-81 rotor (Eppendorf, cat. no. 022638807)</td><td></td><td></td><td></td></tr></tbody></table>

methods to investigate the regulatory role of small rnas and ribosomal occupancy of plasmodium falciparum

겸상 적혈구 대립 유전자에 대한 책임 유전 적 변이 (HBS)은 말라리아 기생충, 경찰에 의한 감염에 저항하는 적혈구 수 열대열. 다 요인으로 알려져있다이 저항의 분자 기초는 완전히 이해되지 못하고있다 유지. 최근의 연구는 한 번 말라리아 기생충에 전좌 적혈구 마이크로 RNA의 발현 차이는 유전자 조절 및 기생충 성장 모두에 영향을 미치는 것으로 나타났다. 이러한 miRNA가 나중에 기생충의 mRNA의 은밀한 부분 집합 5 &#39;RNA 융합을 통해 키메라 RNA 전 사체를 형성하여 mRNA의 번역을 억제하는 것으로 나타났다. 여기에서 사용 된 기술은 유전자 조절 및 P.의 병진 ​​전위에 기능적 역할 및 추정 메커니즘 기본 적혈구 마이크로 RNA 공부 원충, 호스트 적혈구에 수정 합성 마이크로 RNA의 형질을 포함하여 상세하게 설명한다. 마지막 polysom​​e 그라데이션 방법 TRA의 범위를 결정하는 데 사용되는이러한 성적 증명서의 nslation. 함께, 이러한 기술은 우리가 적혈구 마이크로 RNA의 조절 이상 수준이 겸상 적혈구 세포 고유 말라리아 저항에 기여 함을 입증 할 수 있었다.

P. 인간 마이크로 RNA의 글로벌 프로파일 열대열 여기에 제시된 기술은 다양한 조건에서 기생충에서 마이크로 RNA를 추출하는 데 사용되었다. 한가지 유의할 사항들은이 문서 및 원래 공부 (29) 모두에 제시된 마이크로 RNA 데이터 기준점 역임 32에 나타낸 바와 같이, 감염되지 않은 적혈구 용 RNA의 추출을 수행 하였다는 것이다. 그 이전의 연구는 HBS...

Watch this Scientific Journal Video about Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum at JoVE.com

Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

Human microRNAs translocate from host erythrocytes to Plasmodium falciparum parasites. Here, the techniques used to transfect synthetic microRNAs into host erythrocytes and isolate all RNAs from P. falciparum are described. In addition, this paper will detail a method of polysome isolation in P. falciparum to determine the ribosomal occupancy and translational potential of parasite transcripts.

방법은 작은 RNA를과의 리보솜 점유 규제 역할을 조사하기 위해<em&gt; 말라리아 원충</em

The genetic variation responsible for the sickle cell allele (HbS) enables erythrocytes to resist infection by the malaria parasite, P. falciparum. The ...

methods-to-investigate-regulatory-role-small-rnas-ribosomal-occupancy

Research

JoVE Journal

Immunology and Infection

Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

8.8K 조회수.  Duke University School of Medicine. Human microRNAs translocate from host erythrocytes to Plasmodium falciparum parasites. Here, the techniques used to transfect synthetic microRNAs into host erythrocytes and isolate all RNAs from P. falciparum are described. In addition, this paper will detail a method of polysome isolation in P. falciparum to determine the ribosomal occupancy and translational potential of parasite transcripts. 

비디오: Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

Novel RNA-Binding Proteins Isolation by the RaPID Methodology

RNA-binding proteins (RBPs) play important roles in every aspect of RNA metabolism and regulation. Their identification is a major challenge in modern biology. Only a few in vitro and in vivo methods enable the identification of RBPs associated with a particular target mRNA. However, their main limitations are the identification of RBPs in a non-cellular environment (in vitro) or the low efficiency isolation of RNA of interest (in vivo). An RNA-binding protein purification and identification (RaPID) methodology was designed to overcome these limitations in yeast and enable efficient isolation of proteins that are associated in vivo. To achieve this, the RNA of interest is tagged with MS2 loops, and co-expressed with a fusion protein of an MS2-binding protein and a streptavidin-binding protein (SBP). Cells are then subjected to crosslinking and lysed, and complexes are isolated through streptavidin beads. The proteins that co-purify with the tagged RNA can then be determined by mass spectrometry. We recently used this protocol to identify novel proteins associated with the ER-associated PMP1 mRNA. Here, we provide a detailed protocol of RaPID, and discuss some of its limitations and advantages.

RNA-protein interactions lie at the heart of many cellular processes. Here, we describe an in vivo method to isolate specific RNA and identify novel proteins that are associated with it. This could shed new light on how RNAs are regulated in the cell.

빠른 방법론에 의해 소설 RNA 결합 단백질 분리

RNA-binding proteins (RBPs) play important roles in every aspect of RNA metabolism and regulation. Their identification is a major challenge in modern ...

연구

유전학

Quantitative Immunofluorescence to Measure Global Localized Translation

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and organogenesis, as well as in multiple diseases. Numerous publications have convincingly shown that specific mechanisms tightly regulate mRNA translation. Increased interest in the translation-induced regulation of protein expression has led to the development of novel methods to study and follow de novo protein synthesis in cellulo. However, most of these methods are complex, making them costly and often limiting the number of mRNA targets that can be studied. This manuscript proposes a method that requires only basic reagents and a confocal fluorescence imaging system to measure and visualize the changes in mRNA translation that occur in any cell line under various conditions. This method was recently used to show localized translation in the subcellular structures of adherent cells over a short period of time, thus offering the possibility of visualizing de novo translation for a short period during a variety of biological processes or of validating changes in translational activity in response to specific stimuli.

This manuscript describes a method to visualize and quantify localized translation events in subcellular compartments. The approach proposed in this manuscript requires a basic confocal imaging system and reagents and is rapid and cost-effective.

정량적 면역 형광 측정 글로벌 현지화 번역

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and ...

생화학

Polysome Profiling in Leishmania, Human Cells and Mouse Testis

Proper protein expression at the right time and in the right amounts is the basis of normal cell function and survival in a fast-changing environment. For a long time, the gene expression studies were dominated by research on the transcriptional level. However, the steady-state levels of mRNAs do not correlate well with protein production, and the translatability of mRNAs varies greatly depending on the conditions. In some organisms, like the parasite Leishmania, the protein expression is regulated mostly at the translational level. Recent studies demonstrated that protein translation dysregulation is associated with cancer, metabolic, neurodegenerative and other human diseases. Polysome profiling is a powerful method to study protein translation regulation. It allows to measure the translational status of individual mRNAs or examine translation on a genome-wide scale. The basis of this technique is the separation of polysomes, ribosomes, their subunits and free mRNAs during centrifugation of a cytoplasmic lysate through a sucrose gradient. Here, we present a universal polysome profiling protocol used on three different models - parasite Leishmania major, cultured human cells and animal tissues. Leishmania cells freely grow in suspension and cultured human cells grow in adherent monolayer, while mouse testis represents an animal tissue sample. Thus, the technique is adapted to all of these sources. The protocol for the analysis of polysomal fractions includes detection of individual mRNA levels by RT-qPCR, proteins by Western blot and analysis of ribosomal RNAs by electrophoresis. The method can be further extended by examination of mRNAs association with the ribosome on a transcriptome level by deep RNA-seq and analysis of ribosome-associated proteins by mass spectroscopy of the fractions. The method can be easily adjusted to other biological models.

Polysome Profiling in Leishmania, Human Cells and Mouse Testis

The overall goal of polysome profiling technique is analysis of translational activity of individual mRNAs or transcriptome mRNAs during protein synthesis. The method is important for studies of protein synthesis regulation, translation activation and repression in health and multiple human diseases.

Polysome Leishmania, 인간 세포 및 마우스 고환에서 프로 파일링

Proper protein expression at the right time and in the right amounts is the basis of normal cell function and survival in a fast-changing environment. For ...

An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes

RNA-binding proteins (RBPs) play key roles in the post-transcriptional control of gene expression. Therefore, biochemical characterization of mRNA-protein complexes is essential to understanding mRNA regulation inferred by interacting proteins or non-coding RNAs. Herein, we describe a tandem RNA isolation procedure (TRIP) that enables the purification of endogenously formed mRNA-protein complexes from cellular extracts. The two-step protocol involves the isolation of polyadenylated mRNAs with antisense oligo(dT) beads and subsequent capture of an mRNA of interest with 3&#39;-biotinylated 2&#39;-O-methylated antisense RNA oligonucleotides, which can then be isolated with streptavidin beads. TRIP was used to recover in vivo crosslinked mRNA-ribonucleoprotein (mRNP) complexes from yeast, nematodes and human cells for further RNA and protein analysis. Thus, TRIP is a versatile approach that can be adapted to all types of polyadenylated RNAs across organisms to study the dynamic re-arrangement of mRNPs imposed by intracellular or environmental cues.

A tandem RNA isolation procedure (TRIP) for recovery of endogenously formed mRNA-protein complexes is described. Specifically, RNA-protein complexes are crosslinked in vivo, polyadenylated RNAs are isolated from extracts with oligo(dT) beads, and particular mRNAs are captured with modified RNA antisense oligonucleotides. Proteins bound to mRNAs are detected by immunoblot analysis.

진 핵 세포 mRNA 단백질 복합물을 복구 하는 Oligonucleotide 기반 협동 RNA 격리 절차

RNA-binding proteins (RBPs) play key roles in the post-transcriptional control of gene expression. Therefore, biochemical characterization of mRNA-protein ...

An Assay for Quantifying Protein-RNA Binding in Bacteria

In the initiation step of protein translation, the ribosome binds to the initiation region of the mRNA. Translation initiation can be blocked by binding of an RNA binding protein (RBP) to the initiation region of the mRNA, which interferes with ribosome binding. In the presented method, we utilize this blocking phenomenon to quantify the binding affinity of RBPs to their cognate and non-cognate binding sites. To do this, we insert a test binding site in the initiation region of a reporter mRNA and induce the expression of the test RBP. In the case of RBP-RNA binding, we observed a sigmoidal repression of the reporter expression as a function of RBP concentration. In the case of no-affinity or very low affinity between binding site and RBP, no significant repression was observed. The method is carried out in live bacterial cells, and does not require expensive or sophisticated machinery. It is useful for quantifying and comparing between the binding affinities of different RBPs that are functional in bacteria to a set of designed binding sites. This method may be inappropriate for binding sites with high structural complexity. This is due to the possibility of repression of ribosomal initiation by complex mRNA structure in the absence of RBP, which would result in lower basal reporter gene expression, and thus less-observable reporter repression upon RBP binding.

In this method, we quantify the binding affinity of RNA binding proteins (RBPs) to cognate and non-cognate binding sites using a simple, live, reporter assay in bacterial cells. The assay is based on repression of a reporter gene.

박테리아에서 단백질 RNA 결합을 정량화하기위한 분석

In the initiation step of protein translation, the ribosome binds to the initiation region of the mRNA. Translation initiation can be blocked by binding ...

Analysis of Single-cell Gene Transcription by RNA Fluorescent In Situ Hybridization (FISH)

Adhesion of Plasmodium falciparum infected erythrocytes (IE) to human endothelial receptors during malaria infections is mediated by expression of PfEMP1 protein variants encoded by the var genes.
The haploid P. falciparum genome harbors approximately 60 different var genes of which only one has been believed to be transcribed per cell at a time during the blood stage of the infection. How such mutually exclusive regulation of var gene transcription is achieved is unclear, as is the identification of individual var genes or sub-groups of var genes associated with different receptors and the consequence of differential binding on the clinical outcome of P. falciparum infections. Recently, the mutually exclusive transcription paradigm has been called into doubt by transcription assays based on individual P. falciparum transcript identification in single infected erythrocytic cells using RNA fluorescent in situ hybridization (FISH) analysis of var gene transcription by the parasite in individual nuclei of P. falciparum IE1.
Here, we present a detailed protocol for carrying out the RNA-FISH methodology for analysis of var gene transcription in single-nuclei of P. falciparum infected human erythrocytes. The method is based on the use of digoxigenin- and biotin- labeled antisense RNA probes using the TSA Plus Fluorescence Palette System2 (Perkin Elmer), microscopic analyses and freshly selected P. falciparum IE. The in situ hybridization method can be used to monitor transcription and regulation of a variety of genes expressed during the different stages of the P. falciparum life cycle and is adaptable to other malaria parasite species and other organisms and cell types.

Analysis of Single-cell Gene Transcription by RNA Fluorescent In Situ Hybridization FISH

Fluorescent in situ hybridization (FISH) to identify mRNA transcripts in individual cells allows analysis of polygenic activity such as the simultaneous transcription of more than one member of the var multigene family in Plasmodium falciparum infected erythrocytes 1. The technique is adaptable and can be used on different types of genes, cells and organisms.

RNA 형광하여 단일 세포 유전자 전사의 분석<em&gt; 현장에서</em&gt; 하이브리드 (물고기)

Adhesion of Plasmodium falciparum infected erythrocytes (IE) to human endothelial receptors during malaria infections is mediated by expression of PfEMP1 ...

생물학

Standard Membrane Feeding Assay for the Detection of Plasmodium falciparum Infection in Anopheles Mosquito Vectors

Malaria remains one of the most devastating diseases worldwide and, to date, the African region is still responsible for 94% of all cases worldwide. This parasitic disease requires a protozoan parasite, an Anopheles mosquito vector, and a vertebrate host. The Anopheles genus comprises more than 500 species, of which 60 are known as vectors of the parasite. The Plasmodium parasite genus consists of 250 species, and 48 of these are involved in disease transmission. Furthermore, the Plasmodium falciparum parasite has contributed toward an estimated 99.7% of malaria cases in sub-Saharan Africa in recent years. 
Gametocytes form part of the sexual stage of the parasite and are ingested by the female mosquito upon feeding on an infected human host. Further development of the parasite within the mosquito is enhanced by favorable environmental conditions in the midgut of the mosquito. Here, the fusion of the female and male gametes takes place, and the motile ookinetes originate. The ookinetes enter the midgut epithelium of the mosquito, and mature ookinetes form oocysts, which, in turn, produce motile sporozoites. These sporozoites migrate to the mosquito's salivary glands and are injected as a mosquito takes a blood meal. 
For drug discovery purposes, mosquitoes were artificially infected with gametocyte-infected blood in the standard membrane feeding assay (SMFA). To detect infection within the mosquito and/or to assess the efficacy of antimalarial compounds, the midguts of the female mosquitoes were removed post infection and were stained with mercurochrome. This method was used to enhance the visual detection of oocysts under the microscope for the accurate determination of oocyst prevalence and intensity.

Standard Membrane Feeding Assay for the Detection of Plasmodium falciparum Infection in Anopheles Mosquito Vectors

The standard membrane feeding assay (SMFA) is regarded as the gold standard for the assessment and identification of potential antimalarial compounds. This artificial feeding system is used to infect mosquitoes to further evaluate the effects of such compounds on the intensity and prevalence of the Plasmodium falciparum parasite.

Anopheles 모기 벡터에서 플라스모듐 팔시파룸 감염 검출을 위한 표준 막 공급 분석

Malaria remains one of the most devastating diseases worldwide and, to date, the African region is still responsible for 94% of all cases worldwide. This ...

면역학 및 감염병학

Polysome Fractionation and Analysis of Mammalian Translatomes on a Genome-wide Scale

mRNA translation plays a central role in the regulation of gene expression and represents the most energy consuming process in mammalian cells. Accordingly, dysregulation of mRNA translation is considered to play a major role in a variety of pathological states including cancer. Ribosomes also host chaperones, which facilitate folding of nascent polypeptides, thereby modulating function and stability of newly synthesized polypeptides. In addition, emerging data indicate that ribosomes serve as a platform for a repertoire of signaling molecules, which are implicated in a variety of post-translational modifications of newly synthesized polypeptides as they emerge from the ribosome, and/or components of translational machinery. Herein, a well-established method of ribosome fractionation using sucrose density gradient centrifugation is described. In conjunction with the in-house developed &#8220;anota&#8221; algorithm this method allows direct determination of differential translation of individual mRNAs on a genome-wide scale. Moreover, this versatile protocol can be used for a variety of biochemical studies aiming to dissect the function of ribosome-associated protein complexes, including those that play a central role in folding and degradation of newly synthesized polypeptides.

Ribosomes play a central role in protein synthesis. Polyribosome (polysome) fractionation by sucrose density gradient centrifugation allows direct determination of translation efficiencies of individual mRNAs on a genome-wide scale. In addition, this method can be used for biochemical analysis of ribosome- and polysome-associated factors such as chaperones and signaling molecules.

게놈 전체 규모에 Polysom​​e 분별과 포유류 Translatomes 분석

mRNA translation plays a central role in the regulation of gene expression and represents the most energy consuming process in mammalian cells. ...

Assessment of Selective mRNA Translation in Mammalian Cells by Polysome Profiling

Regulation of protein synthesis represents a key control point in cellular response to stress. In particular, discreet RNA regulatory elements were shown to allow to selective translation of specific mRNAs, which typically encode for proteins required for a particular stress response. Identification of these mRNAs, as well as the characterization of regulatory mechanisms responsible for selective translation has been at the forefront of molecular biology for some time. Polysome profiling is a cornerstone method in these studies. The goal of polysome profiling is to capture mRNA translation by immobilizing actively translating ribosomes on different transcripts and separate the resulting polyribosomes by ultracentrifugation on a sucrose gradient, thus allowing for a distinction between highly translated transcripts and poorly translated ones. These can then be further characterized by traditional biochemical and molecular biology methods. Importantly, combining polysome profiling with high throughput genomic approaches allows for a large scale analysis of translational regulation.

The ability of cells to adapt to stress is crucial for their survival. Regulation of mRNA translation is one such adaptation strategy, providing for rapid regulation of the proteome. Here, we provide a standardized polysome profiling protocol to identify specific mRNAs that are selectively translated under stress conditions.

Polysom​​e 프로파일 링 포유 동물 세포에 선택적 mRNA의 번역 평가

Regulation of protein synthesis represents a key control point in cellular response to stress. In particular, discreet RNA regulatory elements were shown ...

An Easy Method for Plant Polysome Profiling

Translation of mRNA to protein is a fundamental and highly regulated biological process. Polysome profiling is considered as a gold standard for the analysis of translational regulation. The method described here is an easy and economical way for fractionating polysomes from various plant tissues. A sucrose gradient is made without the need for a gradient maker by sequentially freezing each layer. Cytosolic extracts are then prepared in a buffer containing cycloheximide and chloramphenicol to immobilize the cytosolic and chloroplastic ribosomes to mRNA and are loaded onto the sucrose gradient. After centrifugation, six fractions are directly collected from the bottom to the top of the gradient, without piercing the ultracentrifugation tube. During collection, the absorbance at 260 nm is read continuously to generate a polysome profile that gives a snapshot of global translational activity. Fractions are then pooled to prepare three different mRNA populations: the polysomes, mRNAs bound to several ribosomes; the monosomes, mRNAs bound to one ribosome; and mRNAs that are not bound to ribosomes. mRNAs are then extracted. This protocol has been validated for different plants and tissues including Arabidopsis thaliana seedlings and adult plants, Nicotiana benthamiana, Solanum lycopersicum, and Oryza sativa leaves.

This protocol describes an easy method to extract and fractionate transcripts from plant tissues on the basis of the number of bound ribosomes. It allows a global estimate of translation activity and the determination of the translational status of specific mRNAs.

공장 Polysom​​e 프로파일 링을위한 쉬운 방법

Translation of mRNA to protein is a fundamental and highly regulated biological process. Polysome profiling is considered as a gold standard for the ...

방법은 작은 RNA를과의 리보솜 점유 규제 역할을 조사하기 위해

요약

더 많은 비디오 탐색

이 비디오의 챕터

빠른 방법론에 의해 소설 RNA 결합 단백질 분리

정량적 면역 형광 측정 글로벌 현지화 번역

Polysome Leishmania, 인간 세포 및 마우스 고환에서 프로 파일링

진 핵 세포 mRNA 단백질 복합물을 복구 하는 Oligonucleotide 기반 협동 RNA 격리 절차

박테리아에서 단백질 RNA 결합을 정량화하기위한 분석

RNA 형광하여 단일 세포 유전자 전사의 분석

Anopheles 모기 벡터에서 플라스모듐 팔시파룸 감염 검출을 위한 표준 막 공급 분석

게놈 전체 규모에 Polysome 분별과 포유류 Translatomes 분석

Polysome 프로파일 링 포유 동물 세포에 선택적 mRNA의 번역 평가

공장 Polysome 프로파일 링을위한 쉬운 방법

방법은 작은 RNA를과의 리보솜 점유 규제 역할을 조사하기 위해

요약

더 많은 비디오 탐색

이 비디오의 챕터

빠른 방법론에 의해 소설 RNA 결합 단백질 분리

정량적 면역 형광 측정 글로벌 현지화 번역

Polysome Leishmania, 인간 세포 및 마우스 고환에서 프로 파일링

진 핵 세포 mRNA 단백질 복합물을 복구 하는 Oligonucleotide 기반 협동 RNA 격리 절차

박테리아에서 단백질 RNA 결합을 정량화하기위한 분석

RNA 형광하여 단일 세포 유전자 전사의 분석

Anopheles 모기 벡터에서 플라스모듐 팔시파룸 감염 검출을 위한 표준 막 공급 분석

게놈 전체 규모에 Polysom​​e 분별과 포유류 Translatomes 분석

Polysom​​e 프로파일 링 포유 동물 세포에 선택적 mRNA의 번역 평가

공장 Polysom​​e 프로파일 링을위한 쉬운 방법

게놈 전체 규모에 Polysome 분별과 포유류 Translatomes 분석

Polysome 프로파일 링 포유 동물 세포에 선택적 mRNA의 번역 평가

공장 Polysome 프로파일 링을위한 쉬운 방법