This research was funded by Doris Duke Charitable Foundation, Burroughs Wellcome Fund, NIH R21DK080994, Duke Chancellor's pilot project fund, the Roche Foundation for Anemia Research and The Bill and Melinda Gates Foundation. G.L. is supported by Duke's UPGG and the NIH (Grant # 5R01AI090141-03) and K.A.W. by the NSF Graduate Research Fellowship Program.

1 : P.에서 작은 크기의 RNA의 분리 IDC 중 열대열 <ol><li> 무성 문화 29 말라리아 기생충을 얻습니다. 참고 : 필요한 문화의 크기가 원하는 응용 프로그램에 따라 다릅니다; 그러나 3 ~ 5 %의 기생충 5 % 적혈구 용적률에 10 ml의 문화는 실시간 PCR (RT-PCR)에 대한 충분한 RNA를 제공합니다. 기법은 초기에 최적화 배양 비동기되었지만 감염 사이클 동안 특정 시점이 요구되는 경우에는, 링 단계 기생충은 늦어도 10-12 시간 후 - 소르비톨 내습보다 동기화에 의해 동기화 될 수 없다. 동기화는 한주기 (약 48 시간) 29 일 후 반복해야합니다. </li><li> 풀 감염된 세포는 함께 (~ 5 × 10 9 적혈구 ~ 5 % 기생충에) 및 적혈구를 펠렛 브레이크없이 5 분 동안 800 XG에 튜브와 원심 분리기의 상단에 차가운 PBS를 입력합니다. </li><li> 원심 분리 후, 첨부,주의 깊게 흡입 피펫을 사용하여 상층 액을 제거진공로, 적혈구 펠렛 이후시키다하기 쉽습니다. 차가운 1X PBS로 한 번 더 펠렛을 씻으십시오. </li><li> 30 분 동안 얼음에 재현 탁 세포 (1X PBS)에 차가운 0.15 % 사포닌의 펠릿과 장소. </li><li> 4 ° C에서 12 분 동안 1,500 XG에 원심 분리기 세포, 차가운 PBS에 뜨는 (색상 어두운 빨간색이 될 것이다)과에 resuspend 펠렛을 제거합니다. 다시 한 번이 단계를 반복합니다. 참고 : 본 마이크로 RNA 기생충 내의 마이크로 RNA의 반사, 그리고 적혈구 오염되었는지 확인하기 위해, 기생충 분리 조건의 수는 시험 하였다 : 1) 사포닌 분해, 2) 사포닌 분해 RNaseA의 숙주 세포의 miRNAs의 치료 및 3과 결합 ) 메틸 - 베타 - 사이클로 덱스트린 처리는 호스트 적혈구에서 기생충을 제거한다. 모든 치료는 비슷한 결과를 주었다. </li><li> 를 Lyse 용해 완충액의 권장 600 μL를 사용하여 절연 기생충 펠릿. 용해 완충액의 부피는 1 ~ 2 %의 적혈구 용적 및 5 % 기생충에서 30 ㎖까지 배양 충분하다. 참고 : 큰 기생충 배양의 경우,이 양이 증가 될 수있다. 적어도 1 분 동안 볼 텍싱하여 철저한 기생충 펠릿의 완전한 용해를 보장하는 것이 중요하다. 또한, 추출을 용이하게하기 위해, 용해 된 샘플은 1.7 ml의 마이크로 원심 튜브에 전달 될 수있다. </li><li> 균질 첨가제 (2 M 아세트산 나트륨, pH를 4)의 60 μL, 또는 6 단계에서 사용되는 용해 완충액의 1/10 볼륨. </li><li> 10 분 동안 얼음에 샘플을 남겨주세요. </li><li> 600 μL, 또는 1 분 동안 각각의 샘플과 와류에 산 페놀 choloroform의 6 단계에서 첨가하여 용해 완충액의 양과 동일한 양을 추가한다. </li><li> 5 분 동안 10,000 XG에서 샘플을 원심 분리하여 수용액 및 유기 상을 분리합니다. 이 스핀 모든 헤모글로빈 / hemozoin가 유기상에 있도록 이상 키트 제안한 것보다 길다. </li><li> 상단 (수성) 층을 수집하고 새로운 튜브로 전송할 수 있습니다. 성상 프로 제시 색 (가능성이) 갈색, 흰색 또는 경우 반복 9, 10 단계TEIN 오염. </li><li> 피펫으로 상층 액의 양을 결정하고 100 % 에탄올 (~ 800 μL)의 1.25 볼륨을 추가하고 1.7 ml의 마이크로 원심 튜브 5 번 반전 섞는다. </li><li> 1 분 또는 진공 매니 폴드를 사용하여 14,000 XG에서 하나 원심 분리에 의해 제공 RNA 결합 필터 카트리지를 통해 각각의 샘플을 (상업적으로 사용할 수있는 여러 가지있는) 전달합니다. </li><li> miRNA의 700 μL 버퍼 (1)가 1 분 동안 14,000 XG에서 회전, 마이크로 원심을 사용하여 세척과 필터 카트리지를 씻으십시오. </li><li> 두 번 1 분마다 14,000 XG에 원심 분리하여 500 μL 세척 버퍼 2/3로 필터 카트리지를 씻으십시오. </li><li> 1 분마다 14,000 XG에 원심 분리, 50 μL의 두 세척에서 95 ºC로 예열 된 100 μL DEPC 물과 용출 RNA. 260 나노 미터에서의 UV 흡광도를 통한 RNA의 농도를 측정한다. 주 : RNA 겔 (TBE 우레아 또는 아크릴 변성 포름 알데히드 아가 로스 겔 어느) 수 bE는 고립의 RNA의 크기 분포를 평가하기 위해 사용된다. 참고 :이 RNA는 마이크로 어레이, RNA 시퀀싱, 북부 오점과 리보 뉴 클레아 제 보호 분석에 의한 분석에 적합하다. </li></ol> 2 : P.에서 작은 크기의 RNA의 정량 IDC 중 열대열 <ol><li> 260 nm의 자외선 분광 광도계를 사용하여 1 단계에서 고립 된 개인 샘플의 농도를 결정합니다. </li><li> 원하는 RNA 종에 대한 실시간 PCR 프라이머를 생성합니다. 의 mRNA 또는 융합의 miRNA-mRNA를 위해 우리가 SYBR 녹색을 위해 프라이머를 설계하는 동안 miRNA의 혼자, 우리는 미리 만들어진 miRNA의 qPCR에 분석을 사용했다. 반대 mRNA의 서열 (: ATCGAACATGCTGTGAACAT PKA-R)에서 miRNA의 하류 유전자 특이 프라이머 ~ 100 BP는 동안, 상기 융합 RNA를 들어, 정방향 프라이머는 miRNA의 순서 자체 (AAACCGTTACCATTACTGAGTT은 miR-451)이었다. </li><li> 사용하여 RNA 샘플 중 하나의 mRNA 및 / 또는 miRNA의 용의 miRNAs (RNA의 20 ~ 40 ng의 사용) 단독으로 또는 임의의 헥사에 대한 헤어핀 프라이머로부터 cDNA를 확인-mRNA 융합 종 (RNA 1 μg의 사용). 실내 온도로 냉각, 65 ℃에서 5 분 동안 RNA와 프라이머를 섞는다. 그 후, 역전사 효소를 추가 믹스 (0.5 μL 역전사, 0.5 μL의 RNase 억제제, 1 μL의 dNTPs의 (2.5 mM의 각각)을, 4 배 μL 완충액, 2 ㎕의 0.1 M DTT, 1 μL H 2 O). <ol><li> SYBR 녹색 또는의 TaqMan 프로브를 감지 할 수있는 열 순환기에 실행 샘플. 특정 유전자에 대한 PCR (30) 양적 녹색 SYBR은을 사용하여, 40 사이클, 3 단계 PCR, 15 초 동안 95 ° C, 가장 낮은 프라이머 어닐링 온도 영하 30 초 동안 5 ° C로 실행, 30 초 동안 68 ℃, 상업 SYBR 녹색 마스터 믹스. miRNA의 실시간 PCR은 40 사이클, 1 분 동안, 두 단계의 PCR로 15 초 동안 95 ° C에서 60 ° C를 실행 하였다. </li><li> ΔΔCt 방법을 사용하여 분석을 정량화하거나 랩는 GTPase (PF08_0110) 또는 18S rRNA의 (31)에 대해 그들을 정상화. </li></ol></li></ol> 3 : 소개말라리아 기생충에 작은 RNA를의 <ol><li> 형질 당 적혈구의 300 μL 펠렛 브레이크 1에서 5 분 동안 800 XG에서 원심 분리하여 완전한 말라리아 매체 (적혈구의 250 μL, 1.5 × 109 세포를, 궁극적으로 사용된다). </li><li> RPMI 완벽한 cytomix (120 밀리미터의 KCl에 재현 탁 회 적혈구를 씻으 0.15 mM의 CaCl2를 10 mM의 K 2 HPO 4 / KH 2 PO 4, 산도 7.6, 25 mM의 HEPES, pH가 7.6, 2 mM의 EGTA, pH가 7.6; 5 밀리미터의 MgCl 2, 브레이크 1에서 5 분 동안 800 XG에 원심 후 50 % 적혈구 용적률에서) KOH로 pH를 조정. </li><li> 0.2 cm의 전기 큐벳에 세포를 전송합니다. </li><li> 큐벳에 사용자 지정 합성 올리고 뉴클레오티드의 10 μg의 또는 해당하는 금액을 추가하고 문화를 재현 탁. </li><li> 310 V / 950 μF에 electroporator을 조정하고 각각의 큐벳에 펄스를 제공합니다. </li><li> 미리 예열 완전한 말에 큐벳 내 적혈구의 300 μl를 재현 탁아리아 미디어와 24 웰 플레이트에서 그들을 플레이트와 말라리아 혈액 가스 믹스 밀폐 용기에 37 ℃에서 부화 (3 % O 2, 5 % CO 2). </li><li> 4 시간 후, 1 %의 대략적인 최종 기생충에 동기화 후반 trophozoites로 형질 적혈구를 감염. </li><li> 감염 문화마다 4-6일 갓 형질 전환 된 적혈구를 추가하고 섹션 4에 나타낸 바와 같이, 유유-1 염색을 사용하여 FACS에 의해 %의 기생충을 결정합니다. </li></ol> 4 : 기생충 감염률시 적혈구 마이크로 RNA 효과의 결정 <ol><li> 1.7 ml의 microcentrifuge 관에 micropipettor과 장소에 의해 재 부유 문화의 100 μl를 가져 가라. 5 분 동안 800 XG에서 원심 분리하여 탁상의 microcentrifuge 1 1X PBS ㎖의 원심 분리기로 두 번 씻으십시오. </li><li> 0.025 %의 글루 타르 알데히드 1 ㎖에 재현 탁 펠렛. 실온에서 20 분 동안 샘플을 품어. 참고 : 샘플은 4 ℃에서 몇 주 동안 여기에 저장 될 수있다. 그 후, 감염된 R 펠렛5 분 800 XG에서 원심 분리하여 수익 증권. 1X PBS 1 ㎖로 두 번 세척 하였다. </li><li> 0.015 %의 사포닌 1 ㎖에 재현 탁 펠렛. 15 분 동안 4 ° C에서 품어. 펠렛을 5 분 동안 800 XG에서 원심 분리하여 적혈구를 감염. 1X PBS 1 ㎖로 두 번 세척 하였다. Repeat.4.3. 1X PBS 1 μL (1000 배)의 DNA 얼룩을 함유 한 용액에 재현 탁 세포. </li><li> 488 nm의 여기에서, 사이토 흐름에 기생충의 정도를 결정하고 ~ 530 nm의 (FL-1) 방출. </li><li> 첫째, 게이트 FSC와 SSC에 따라 흐름 cytometer는 적혈구에 초점을 맞 춥니 다. 그런 다음, FL-1 채널에서 형광에 의해 문이 적혈구에 기생충의도 (감염된 적혈구)를 측정한다. 참고 : 나중에 기생충은 초기 단계 기생충보다 10 배 더 형광, 그리고 감염되지 않은 적혈구 위 ~ 100 배. 또한, 저속에서 수집하여 잡음을 감소시키는 경향이있다. 마지막으로,이 방법은 3-H 결합 및 하이포크 산틴 김사 염색, 이전에보고 된 양을 13으로하고, 모든 기법 GAV와 비교 한비슷한 결과를 전자. </li></ol> 5 :의 miRNA-mRNA의 퓨전 제품의 비오틴 태그 및 용출 <ol><li> 직접 공유 5 &#39;말단에 연결 desthiobiotin와 사용자 지정 합성 RNA 올리고 뉴클레오티드 (DB-)를 주문한다. </li><li> 3 단계에 표시된대로, Desthiobiotin 접합 (DB-)의 miRNA 및 수정되지 않은 miRNA의 (음성 대조군)와 감염되지 않은 적혈구를 형질. </li><li> 피와 형질 전환 된 적혈구를 감염 원충은 0.5 % (1.1 단계)의 시작 기생충에 기생충. </li><li> 1 단계에서 설명한 바와 같이 기생충 RNA 나중에 사일 (96 시간)을 추출합니다. </li><li> 스트렙 트 아비딘 비드 패킹 50 μL와 기생충의 10 μg의 RNA를 부화, 마이크로 피펫을 통해 첨가하고, 4 ℃에서 1 시간 동안 마이크로 원심 튜브에 회 회전한다. </li><li> 30 초 동안 800 XG에 구슬을 펠렛 20 밀리미터의 KCl과 1 / 1,000의 RNase 억제제로 씻는다. </li><li> 2 MM의 비오틴과 200 μL RNA 캡처 용출 버퍼 (20 mM의 KCl을, 1/1과의 경쟁에 의해 구슬에서 용출 RNA를4에서, 000의 RNase 억제제 및 2 mM의 비오틴) ° C 하룻밤 회전. </li><li> 표시 (P)의 농축의 정도를 결정 2 단계에 표시된대로 SYBR 녹색 QRT-PCR과의 TaqMan qPCR에 의한 마이크로 RNA 농축 (양성 대조군)를 사용하여 원충 성적 증명서. </li></ol> 6 : P.의 리보솜 점유를 파악하기 위해 Polysome 분리 열대열 <ol><li> 5 ml의 15 % 수 크로스 용액 (400 mM의 아세트산 칼륨, 25 mM의 칼륨 HEPES, pH가 7.2, 15 mM의 아세트산 마그네슘, 200 μM 사이클로 헥시 미드, 1 mM의 DTT, 1mM의 PMSF, 40 U / ㎖의 RNase 억제제, 및 15 % 수 크로즈를 배치 ) SW41의 초 원심 분리기 튜브 (14 X 89mm)로. </li><li> 5 ㎖ 주사기를 사용하여 5 ml의 50 % 수 크로스 용액 (400 mM의 아세트산 칼륨, 25 mM의 칼륨 HEPES, pH가 7.2, 15 mM의 아세트산 마그네슘, 200 μM 사이클로 헥시 미드, 1 mM의 DTT, 1mM의 PMSF, 40 U / ㎖의 RNase를 추가 억제제 및 긴 강철 바늘을 사용하여 15 %의 자당 아래 50 % 수크로오스)를 선택한 다음, 바늘을 제거한다. </li><l난&gt;, 파라 필름 구배 튜브의 상단을 밀봉 롤링을 방지하는 안정 위치에서, 그면에 서서히 튜브 기울인 그래서 탁상에 수평으로 누워있다. 적어도 2 시간 동안 옆에 튜브를 유지합니다. 기다리는 동안, 단계 6.5로 시작합니다. </li><li> 2 시간 후, 천천히 수직 튜브를 기울여 전에 샘플 넣기 적어도 15 분 (14 단계)에 대한 냉각 할 수 있도록 얼음에 튜브를 전송합니다. </li><li> 100 ~ 500 총 RNA의 μg의, 또는 ~ 5 %의 기생충 대략 100 ㎖ 비동기 문화를 생성하기에 충분한 변형체 -infected 혈액 단계 문화를 수집합니다. 10 배 (2 mM)을 사이클로 헥시 미드 (CHX)를 포함하는 배양 배지의 볼륨 번째 1/10을 추가하고 10 분 동안 37 ° C에서 품어. <ol><li> 원심 분리하여 펠렛의 문화는 원심 분리기와 7 분 (브레이크 1) 500 XG에, 다음 PBS 200 μM의 CHX을 포함 1X 실내 온도로 두 번 씻는다. 200 μM의 CHX을 포함 1X PBS에서 기생충 문화를 재현 탁하고 얼음에 저장합니다. </li></ol></lI&gt; <li> RBC 펠렛의 양을 추정하고있다. 용해 완충액 (400 mM의 아세트산 칼륨, 25 mM의 칼륨 HEPES, pH가 7.2, 15 mM의 아세트산 마그네슘, 200 μM의 CHX, 1mM의 DTT, 1mM의 PMSF, 40 U / ㎖의 RNase 억제제, 1 % (v / v)의 IGEPAL CA를 추가 -630, 0.5 ml의 4.25 %의 최종 부피 RBC 펠릿에 DOC) (/ V w). 4에서 해물을 품어 회전하면서 10 분 동안 C를 °. </li><li> 마이크로 원심 튜브에 해물을 전송하고 16,000 XG 4에서의 microcentrifuge에서 원심 분리 10 분 동안 C를 °. </li><li> M 0.5 차가운 수크로오스 쿠션 용액 (400 mM의 아세트산 칼륨, 25 mM의 칼륨 HEPES, pH가 7.2, 15 mM의 아세트산 마그네슘, 200 μM 사이클로 헥시 미드, 1 mM의 DTT, 1mM의 PMSF, 40 U / ㎖의 RNase 1.25 mL를 피펫 팅하여 크로스 쿠션을 제조 SW55의 초 원심 분리기 튜브 (13 X 51mm)로 억제하고, 0.5 M 자당). </li><li> 조심스럽게 주사기 및 작은 (1-27) 게이지 바늘을 사용하여 수크로오스 쿠션의 상부에 (단계 7)에서 파쇄 상등액을 3.75 mL의 층을 포함한다. STOR섹션 1에 표시된 전자 -80 ° C에서 나머지 해물 (~ 500 μL)는 총 RNA 수준을 추출한다. </li><li> 4 사전 냉장 초 원심 분리기 로터로 샘플을로드 13.2 ml의 튜브를 저장할 수 ° C. 366,000 XG에서 샘플을 원심 분리기 146 분 동안 4 ° C. </li><li> 피펫을 사용하여, 15ML 원뿔 관에 뜨는을 전송합니다. 무료 (리보솜에 의해 언 바운드)의 RNA의 RN​​A 분리에 대한 -80 ° C에서 뜨는을 저장합니다. </li><li> 리보솜 재현 탁 완충액 (400 mM의 아세트산 칼륨, 25 mM의 칼륨 HEPES, pH가 7.2, 15 mM의 아세트산 마그네슘, 200 μM 사이클로 헥시 미드, 1 mM의 DTT, 1mM의 PMSF 및 40 U / ㎖의 RNase 억제제) 500 μL에 리보솜 펠렛을 재현 탁 5 분간 피펫 팅. </li><li> 16,000 XG 4에서 마이크로 원심에서 샘플을 원심 분리기 &#160; 10 분 동안 C를 °. </li><li> 얼음에 4 단계에서 기울기를 유지하면서 조심스럽게 그라데이션 USI 위에 리보솜 현탁액 층, 파라 필름 제거NG 주사기와 작은 (~ 27) 게이지 바늘. </li><li> 미리 냉장 초 원심 분리기 회 전자에 튜브를 넣고 20 XG 180 분 동안 4 ° C에서로드 구배 원심 분리. 스핀이 완료되면, 저장 4에서 구배 원심 준비가 될 때까지 ° C는 분별에로드합니다. </li><li> 분별 구배 초 원심 분리기에 빈 튜브 (이 이전 실행에서 사용되는 튜브 일 수 있음)을로드 한 후 100 × 103의 속도에서 5 분 동안의 RNA 분해 효소가없는 물을 세척한다. </li><li> 단계 6.16의 세척 동안 UV 흡광도 검출기의 감도를 설정한다. 좋은 시작 민감도는 0.2이지만,이 이후 (기생충 번호 등에 따라 상당히 달라질 수 있음) (254) 신호에 따라 타점 조절 될 필요가있다. </li><li> 검출기 감도가 설정되면 물 검출기를 통해 흐르는 동안, 제로 기준 신호를 설정한다. </li><li> 다음 라인이 비어 있고 REM까지 분획 수집기를 세정 후, 액체의 역류빈 초원 심 분리기 튜브를 비켜. </li><li> 이 바늘 장치를 종료 할 때까지 분별을 통해 60 % 자당 솔루션을 실행합니다. </li><li> - 조 이상 않도록주의하면서 로딩 챔버의 상단에있는 최초의 기울기를 포함하는 튜브를 삽입하고 도장을 조입니다. 그리고, 바늘로 튜브의 바닥을 관통. </li><li> (펌프의 전면 유속 조절기에 의해 제어 됨) 12.5 × 106에 유체 흐름의 속도를 재설정 한 후 18 초간의 분획을 수집하는 자동화 된 분획 수집기를 설정 (~ 330 μL / 분획) 마이크로 원심 튜브. </li><li> 앞으로 60 % 자당 용액의 흐름을 시작합니다. </li><li> 구배 용액의 첫번째 드롭 마이크로 원심 튜브로 떨어지면, 즉시 분획 수집 및 신호 (254)의 실시간 기록 모두를 시작한다. </li><li> 급락이 50 % 및 60 % 자당 용액의 계면에 해당하는 신호 (254)에서 관찰하면, 유체 흐름 (254)을 모두 정지 </sUB&gt; 녹화. </li><li> 그라데이션 분수에 보관 -80 &#160; 나중에 사용하기 위해 C를 °. </li><li> 60 % 수크로오스 용액을 초 원심 분리기 튜브에서 비운다까지 100 × 106의 유체 속도로 역류. </li><li> 분별 추가적인 구배가있는 경우, 로딩 챔버로부터 빈 초 원심 튜브를 제거하고 6.21 단계에서 다시 시작. 모든 샘플이 완료된 경우 단계 6.16 및 6.19에서 수행되었을 때, 장치를 세척한다. </li></ol>

<ol>
	<li>World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> World Malaria Report. , (2014).</li><li>Livincstone, F. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malaria+and+human+polymorphisms.">Malaria and human polymorphisms.</a> Annu Rev Genet. 5, 33-64 (1971).</li><li>Nagel, R. L., Roth, E. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malaria+and+red+cell+genetic+defects.">Malaria and red cell genetic defects.</a> Blood. 74, 1213-1221 (1989).</li><li>Aidoo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+effects+of+the+sickle+cell+gene+against+malaria+morbidity+and+mortality.">Protective effects of the sickle cell gene against malaria morbidity and mortality.</a> Lancet. 359, 1311-1312 (2002).</li><li>Tiffert, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+hydration+state+of+human+red+blood+cells+and+their+susceptibility+to+invasion+by+Plasmodium+falciparum.">The hydration state of human red blood cells and their susceptibility to invasion by Plasmodium falciparum.</a> Blood. 105, 4853-4860 (2005).</li><li>Fairhurst, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Abnormal+display+of+PfEMP-1+on+erythrocytes+carrying+haemoglobin+C+may+protect+against+malaria.">Abnormal display of PfEMP-1 on erythrocytes carrying haemoglobin C may protect against malaria.</a> Nature. 435, 1117-1121 (2005).</li><li>Cyrklaff, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemoglobins+S+and+C+interfere+with+actin+remodeling+in+Plasmodium+falciparum-infected+erythrocytes.">Hemoglobins S and C interfere with actin remodeling in Plasmodium falciparum-infected erythrocytes.</a> Science. 334, 1283-1286 (2011).</li><li>Friedman, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Erythrocytic+mechanism+of+sickle+cell+resistance+to+malaria.">Erythrocytic mechanism of sickle cell resistance to malaria.</a> Proceedings of the National Academy of Sciences of the United States of America. 75, 1994-1997 (1978).</li><li>Pasvol, G., Weatherall, D. J., Wilson, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+mechanism+for+the+protective+effect+of+haemoglobin+S+against+P.+falciparum+malaria.">Cellular mechanism for the protective effect of haemoglobin S against P. falciparum malaria.</a> Nature. 274, 701-703 (1978).</li><li>Lecellier, C. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cellular+microRNA+mediates+antiviral+defense+in+human+cells.">A cellular microRNA mediates antiviral defense in human cells.</a> Science. 308, 557-560 (2005).</li><li>Niu, Q. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+artificial+miroRNAs+in+transgenic+Arabidopsis+thaliana+confers+virus+resistance.">Expression of artificial miroRNAs in transgenic Arabidopsis thaliana confers virus resistance.</a> Nature biotechnology. 24, 1420-1428 (2006).</li><li>Zhao, G., Yu, D., Weiss, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNAs+in+erythropoiesis.">MicroRNAs in erythropoiesis.</a> Curr Opin Hematol. 17, 155-162 (2010).</li><li>Lee, Y. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LIN28B-mediated+expression+of+fetal+hemoglobin+and+production+of+fetal-like+erythrocytes+from+adult+human+erythroblasts+ex+vivo.">LIN28B-mediated expression of fetal hemoglobin and production of fetal-like erythrocytes from adult human erythroblasts ex vivo.</a> Blood. 122, 1034-1041 (2013).</li><li>Sangokoya, C., Doss, J. F., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iron-responsive+miR-485-3p+regulates+cellular+iron+homeostasis+by+targeting+ferroportin.">Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin.</a> PLoS genetics. 9, e1003408 (2013).</li><li>Chen, S. Y., Wang, Y., Telen, M. J., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genomic+analysis+of+erythrocyte+microRNA+expression+in+sickle+cell+diseases.">The genomic analysis of erythrocyte microRNA expression in sickle cell diseases.</a> PLoS ONE. 3, e2360 (2008).</li><li>Sangokoya, C., Telen, M. J., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=microRNA+miR-144+modulates+oxidative+stress+tolerance+and+associates+with+anemia+severity+in+sickle+cell+disease.">microRNA miR-144 modulates oxidative stress tolerance and associates with anemia severity in sickle cell disease.</a> Blood. 116, 4338-4348 (2010).</li><li>Deitsch, K., Driskill, C., Wellems, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+malaria+parasites+by+the+spontaneous+uptake+and+expression+of+DNA+from+human+erythrocytes.">Transformation of malaria parasites by the spontaneous uptake and expression of DNA from human erythrocytes.</a> Nucleic acids research. 29, 850-853 (2001).</li><li>Liang, X. H., Haritan, A., Uliel, S., Michaeli, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=trans+and+cis+splicing+in+trypanosomatids:+mechanism,+factors,+and+regulation.">trans and cis splicing in trypanosomatids: mechanism, factors, and regulation.</a> Eukaryotic cell. 2, 830-840 (2003).</li><li>Baum, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+genetics+and+comparative+genomics+reveal+RNAi+is+not+functional+in+malaria+parasites.">Molecular genetics and comparative genomics reveal RNAi is not functional in malaria parasites.</a> Nucleic acids research. 37, 3788-3798 (2009).</li><li>Hall, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+survey+of+the+Plasmodium+life+cycle+by+genomic,+transcriptomic,+and+proteomic+analyses.">A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses.</a> Science. 307, 82-86 (2005).</li><li>Caro, F., Ahyong, V., Betegon, M., DeRisi, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+regulatory+dynamics+of+translation+in+the+asexual+blood+stages.">Genome-wide regulatory dynamics of translation in the asexual blood stages.</a> eLife. 3, (2014).</li><li>Oehring, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organellar+proteomics+reveals+hundreds+of+novel+nuclear+proteins+in+the+malaria+parasite+Plasmodium+falciparum.">Organellar proteomics reveals hundreds of novel nuclear proteins in the malaria parasite Plasmodium falciparum.</a> Genome biology. 13, R108 (2012).</li><li>Lasonder, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+Plasmodium+falciparum+proteome+by+high-accuracy+mass+spectrometry.">Analysis of the Plasmodium falciparum proteome by high-accuracy mass spectrometry.</a> Nature. 419, 537-542 (2002).</li><li>Bozdech, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcriptome+of+the+intraerythrocytic+developmental+cycle+of+Plasmodium+falciparum.">The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum.</a> PLoS biology. 1, E5 (2003).</li><li>Gardner, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+the+human+malaria+parasite+Plasmodium+falciparum.">Genome sequence of the human malaria parasite Plasmodium falciparum.</a> Nature. 419, 498-511 (2002).</li><li>Zhang, M., Joyce, B. R., Sullivan, W. J., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+control+in+Plasmodium+and+toxoplasma+parasites.">Translational control in Plasmodium and toxoplasma parasites.</a> Eukaryotic cell. 12, 161-167 (2013).</li><li>Lacsina, J. R., LaMonte, G., Nicchitta, C. V., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+profiling+of+the+malaria+parasite+Plasmodium+falciparum.">Polysome profiling of the malaria parasite Plasmodium falciparum.</a> Molecular and biochemical parasitology. 179, 42-62 (2011).</li><li>Bunnik, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+profiling+reveals+translational+control+of+gene+expression+in+the+human+malaria+parasite+Plasmodium+falciparum.">Polysome profiling reveals translational control of gene expression in the human malaria parasite Plasmodium falciparum.</a> Genome biology. 14, R128 (2013).</li><li>LaMonte, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translocation+of+sickle+cell+erythrocyte+microRNAs+into+Plasmodium+falciparum+inhibits+parasite+translation+and+contributes+to+malaria+resistance.">Translocation of sickle cell erythrocyte microRNAs into Plasmodium falciparum inhibits parasite translation and contributes to malaria resistance.</a> Cell host &amp; microbe. 12, 187-199 (2012).</li><li>Lambros, C., Vanderberg, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synchronization+of+Plasmodium+falciparum+erythrocytic+stages+in+culture.">Synchronization of Plasmodium falciparum erythrocytic stages in culture.</a> The Journal of parasitology. 65, 418-420 (1979).</li><li>Bourgeois, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+three+real-time+PCR+methods+with+blood+smears+and+rapid+diagnostic+test+in+Plasmodium+sp.+infection.">Comparison of three real-time PCR methods with blood smears and rapid diagnostic test in Plasmodium sp. infection.</a> Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases. 16, 1305-1311 (2010).</li><li>Abruzzo, L. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Validation+of+oligonucleotide+microarray+data+using+microfluidic+low-density+arrays:+a+new+statistical+method+to+normalize+real-time+RT-PCR+data.">Validation of oligonucleotide microarray data using microfluidic low-density arrays: a new statistical method to normalize real-time RT-PCR data.</a> Biotechniques. 38, 785-792 (2005).</li><li>Sangokoya, C., LaMonte, G., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+microRNAs+of+human+mature+erythrocytes.">Isolation and characterization of microRNAs of human mature erythrocytes.</a> Methods in molecular biology. 667, 193-203 (2010).</li><li>Rathjen, T., Nicol, C., McConkey, G., Dalmay, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+short+RNAs+in+the+malaria+parasite+and+its+red+blood+cell+host.">Analysis of short RNAs in the malaria parasite and its red blood cell host.</a> FEBS Lett. 580, 5185-5188 (2006).</li><li>Xue, X., Zhang, Q., Huang, Y., Feng, L., Pan, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=No+miRNA+were+found+in+Plasmodium+and+the+ones+identified+in+erythrocytes+could+not+be+correlated+with+infection.">No miRNA were found in Plasmodium and the ones identified in erythrocytes could not be correlated with infection.</a> Malar J. 7, 47 (2008).</li></ol>

The authors have no competing financial interests to declare.

HBS는 P. 의한 심각한 말라리아에 대한 보호를 제공하기 때문에 주로, 말라리아 풍토병 지역에서 가장 일반적인 헤모글로빈 변형 중 하나이다 열대열. 기술 P.의 유전자 조절에 인간 마이크로 RNA의 역할을 특성화하는 데 필요한 원충이 원고에 걸쳐 자세히 설명되어 있습니다. 모든 작은 RNA를 포함하는 방식으로 전체 RNA를 추출하고, 비교적 간단 기생충 용해 절차를 수행?...

속 변형체의 apicomplexan 기생충에 의한 말라리아는 전 세계적으로 매년 약 200 만 명이 감염과 주변 60 만 명이 사망 한 원인이 가장 일반적인 인간의 기생 질환이다. 인간을 감염 다섯 변형체 종의 인간의 질병에 가장 관련성이 피입니다 열대열 및 P. 심한 말라리아 합병증에 대한 그들의 널리 분포하고 잠재적으로 인해 삼일 열,. 말라리아 기생충의 라이프 사이클은 모기와 인간 모두의 감염을 필요로한다. 감염된 모기에 물린 인간 때 기생충 복제의 초기 라운드가 발생 간 혈류를 통해 이동한다. 호스트로부터 간세포 merozoites 파열 후에, 그들은 무성 성적 어느 복제를 개시 근처 적혈구 세포를 감염. P. 48 시간 지속 복제의 무성 단계, 그것은 대부분의 말의 소스를 모두이기 때문에 원충이 연구의 초점이다아리아 증상과 쉽게 체외에서 효과적으로 요약된다. 개선 말라리아 치료 포함한 공중 보건 사업의 수가 다소 세계적 말라리아의 부담을 감소되었지만, 약제 내성 기생충 계속 출현 말라리아 제어 노력에 문제가있다. 새로운 치료 방법을 제안 할 수 있습니다 하나의 영역은 유전 적 변이가 말라리아에 대한 저항성을 부여하는 방법을 여러 가지의 연구이다. 말라리아 발병 지역에서는 적혈구 다형성의 다양한 2,3 아주 일반적이다. 겸상 적혈구 아마도 가장 눈에 띄는되는 이러한 돌연변이는 종종 증상이 말라리아 감염 4의 발병에 상당한 저항과 연결되어 있습니다. 그들은 말라리아 감염에 저항하는 적혈구의 원인이되는 기본 메커니즘은 불완전하게 이해된다. 헤모글로빈 돌연변이와 기생 적혈구 향상 세포 강성과 탈수를 통해 향상된 식균 작용의 대상이되는P.에 의해 감소 침략과 연관되어 5 원충. HBC 대립 유전자는 적혈구 표면과 세포 골격의 리모델링, 추가 기생충 개발 6,7 억제와 단백질 발현에 영향을 미친다. 마지막으로, P. 원충은 동형 접합 낫 내에서 제대로 성장 (HBSS)는 말라리아 저항의 고유 적혈구 요인을 제안, 체외에서 8,9 적혈구. 이러한 메커니즘은 모두 역할을하는 것으로 나타나는 반면 그러나, 이들은 완전히 말라리아 겸상 적혈구 성 뒤에 메커니즘을 설명하지 않는다. 제대로 이해 남아 적혈구 요인 중 하나 잠재적 인 세트는 성숙한 적혈구 내에서 miRNA의 존재의 큰 풀입니다. 마이크로 RNA는 3 &#39;UTR 내 염기쌍에 의해 번역 및 / 또는 대상의 mRNA의 안정성을 중재 19-25 NT 크기가 작은 비 코딩 RNA를,이다. 이들은 억제 O 포함한 포유 동물 면역 반응의 조절에 연루되어왔다F 바이러스 복제 10 및 식물에서 바이러스에 대한 내성을 부여하는 것으로 나타났다는 그들은 또한 적혈구 11,12 철 대사 (13)를 포함한 여러 적혈구 프로세스를 조절하는 것으로 나타났다. 이전의 연구는 식 극적으로 HBSS에 변경된 14, 15를 적혈구 적혈구의 miRNAs의 풍부하고 다양한 인구를 확인했다. 성숙한 적혈구가 활성화 전사 및 번역이 부족하기 때문에,이 적혈구의 miRNA의 기능 역할은 확실하지 않다. 중요한 물질 교환이 숙주 세포 및 P.간에 발생로서 intraerythrocytic 발달주기 (IDC) 16시 원충, 그것은 HBS의 적혈구 내에서 변경 miRNA의 프로파일이 직접 세포 고유 말라리아 저항에 기여할 수 있음을 추측했다. 이러한 연구는 궁극적으로, 기능적으로 분리 식별 m 이내에 인간의 miRNA의 역할을 연구하기 위해 파이프 라인의 개발을 주도alaria 기생충, P. 그 호스트 / 인간의 miRNAs는 궁극적으로 공유 퓨즈 다음 병진 기생충 mRNA의 성적 증명서 (17)를 억제 것으로 나타났다 원충. 이는 트랜스 - 스 플라이 싱에 의해 형성된 제 1 단면 종 키메라 사체의 예를 제공하고 본의 miRNA-mRNA의 융합 다른 기생충을 포함하는 다른 종에서 발생 될 수 있음을 연루. 모든 trypanosome의 mRNA는 트랜스 - 스 플라이 싱 스플 라이스 리더 (SL)과 폴리 시스 트론 성적 증명서 (18)의 분리를 조절한다. P. 이후 원충이 다이 서 (Dicer) / 전 (19, 20)에 대한 orthologs 부족, 그것은 적혈구의 miRNAs는 P. 유사한 SL 기계를 공중 납치 가능성이있다 원충은 표적 유전자에 통합합니다. (P)의 최근 연구 원충은 사실 5 &#39;스플 라이스 리더 시퀀스 (21)의 존재를 표시합니다. 이 연구는 transcriptomic 및 transla 모두를 포함하여, 인간 기생충의 miRNA-mRNA의 융합 성적 증명서의 발견에지도 방법의 자세한 사항조절적인 기법. 이러한 방법의 전체 목표는 P.의 유전자 조절, 표현형 및 번역 가능한 소형의 RNA의 효과를 조사한다 원충의 성적 증명서. 인간 기생충 키메라 사체의 초기 식별은 오히려 단지 작은 RNA를 격리 기술을 이용하여보다 총과 작은 양의 RNA를 포함 실시간 PCR, 전 사체의 서열 및 EST 라이브러리 캡처 같은 RNA 분석 기법의 사용에 의존. 하나의 큰 풀에 함께 모든 RNA를 분리, 별도로보다 오히려, 기생충 모두 전좌 작은 RNA를 인간의 식별뿐만 아니라 더 큰 서열의 일부로서 이러한 작은 RNA 서열의 존재를 허용했다. 이것은 이들 융합체의 작용 결과를 결정하기 위해 이러한 융합 된 mRNA의 번역 상태의 분석을 요구했다. 기생충의 게놈의 특성에 대한 광범위한 노력하는 동안D의 사체는 기생충의 생물학 22-25의 이해에 추가 한, 훨씬 덜은 경찰의 수명주기에 걸쳐 mRNA의 사체의 번역 규제에 대해 알려진 원충 (26). 기생충의 프로테옴이 제한된 이해는 기생충의 생물학의 이해와 항 말라리아 치료제의 다음 세대를위한 새로운 목표를 식별 할 수있는 능력을 모두 방해했다. 기생충의 세포 생물학의 이해에이 격차는 경찰에서 번역 규제를 조사하기 위해 적절한 기술의 부족으로 주로 인해 지속하고있다 열대열. 최근의 논문은 P.의 리보솜 배출량 측정의 사용을 설명 원충은 글로벌 번역 상태 (21)를 결정합니다. 성적 증명서의 번역 가능성 중 하나가 튼튼한 측정 polysom​​e 프로파일에 의해 결정 관련 리보솜의 수입니다. 그러나,이 기술은 적용된다 P. 원충 &lt;/ EM&gt;, 대부분의 polysom​​es를 복구 할 수 없으며 주로 monosomes을 캡처합니다. 최근 여러 그룹 27, 28은 피 최적화 된 polysomes을 보존하고 호스트 적혈구 (28)에서의 무성 개발 과정이 말라리아 기생충의 리보솜 점유 및 번역 가능성의 특성을 동시에 적혈구 및 기생충을 용균하여 원충 polysome 기술. 종합적으로,이 방법은 인간의 miRNA와 기생충의 mRNA의 관찰 융합은 이전에보고 된 방법 (27)를 사용하여 증명되었다 그 융합의 mRNA의 기생충 단백질 번역을 조절하고, HBA가 말라리아 저항의 주요 결정 요인이며, HBSS 17 적혈구 것을 보여줍니다. 이러한 방법은 그 융합의 RNA가 (P) 내에 있는지, RNA 접합 이벤트를 식별하고 기능적으로 탐구하고자하는 모든 시스템에 유용 할 것이다 원충 또는 다른 진핵 시스템.

<table border="0" cellpadding="0" cellspacing="0" width="651">
	<tbody>
		<tr height="28">
			<td height="28" style="height:28px;width:651px;">REAGENTS-All reagents must be RNAse-free.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Diethyl pyrocarbonate (DEPC; Sigma, cat. no. D5758)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DEPC-treated water (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Yoyo-1 DNA fluorescent dye (Thermo Fisher)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Gene Pulser II (or comparible) electroporator (Bio-Rad)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.2 cm Electroporation cuvettes</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">4 M potassium acetate (Mallinckrodt, cat. no. 6700)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2 M potassium HEPES (pH 7.2; Sigma, cat. no. H0527)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 M magnesium acetate (Sigma, cat. no. M-2545)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 M dithiothreitol (DTT; Research Products International, cat. no. D11000)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">100 mM phenylmethylsulfonate fluoride (PMSF; dissolved in isopropanol; Sigma, cat. no. P7626)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10% (v/v) Igepal CA-630 (Sigma-Aldrich, cat. no. I3021)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10% (w/v) sodium deoxycholate (DOC; Sigma, cat. no. D-6750)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Cycloheximide (CHX; Sigma, cat. no. C-7698)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sucrose (Mallinckrodt, cat. no. 8360-04)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNAseOUT (Invitrogen, cat. no. 100000840)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RPMI-1640 w/ L-glutamine (Cellgro, cat. no. 10-040-CV)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10% AlbuMAX I (w/v in sterile water) (Invitrogen, cat. no. 11020-039)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Gentamicin (Gibco, cat. no. 15750-060))</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HT supplement (100x) (Invitrogen, cat. no. 11067030)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">45% (w/v) sucrose (Sigma, cat no. G8769)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 M HEPES buffer (Gibco, cat. no. 15630-080)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1x phosphate buffered saline (PBS; Cellgro, cat. no. 2109310CV)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Corning 500 ml vacuum filter flask (VWR, cat. no. 430769)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Glass slides (VWR, cat. no. 48311-702)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Giemsa stain (50X) (VWR, cat no. m708-01)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">mirVana miRNA isolation kit (Ambion, ThermoFisher Scientific).</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5&#39; Biotin conjugated mature miRNA (sequence varies by miRNA of interest) (Dharmacon)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Biotin powder (Sigma-Aldrich)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1M Potassium Chloride</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Streptavidin Sepharose High Performance Beads (GE Healthcare)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ribosome resuspension buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Lysis buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">15% (w/v) sucrose gradient solution (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">50% (w/v) sucrose gradient solution (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5 M sucrose cushion (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">60% (w/v) sucrose chase solution (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Plasmodium cell culture media (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA capture Wash Buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA Elution Buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="28">
			<td height="28" style="height:28px;">REAGENT SETUP</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Solutions</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Plasmodium cell culture media</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">500 ml RPMI-1640 w/ L-glutamine</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5 ml gentamicin</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5 ml HT supplement</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2.5 ml 45% glucose</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">25 ml 10% AlbuMAX I</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">12.5 ml 1 M HEPES</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sterile filter with 0.2 mm vacuum filter flask.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Plasmodium cell culture media containing 10x CHX</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as Plasmodium cell culture media above, with the addition of:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2 mM cycloheximide</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Media is prepared as normal, then add CHX to a final concentration of 2 mM and filter.&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1x PBS containing cycloheximide</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;">Cycloheximide is added fresh to 1x PBS to a final concentration of 200 mM, and kept at 4 OC until use.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ribosome resuspension buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">400 mM potassium acetate</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">25 mM potassium HEPES, pH 7.2</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">15 mM magnesium acetate</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">200 mM cycloheximide (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 mM DTT (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 mM PMSF (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">40 U/ml RNaseOUT (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Lysis buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as ribosome resuspension buffer above, with the addition of:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1% (v/v) Igepal CA-630</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5% (w/v) DOC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sucrose solutions</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as ribosome resuspension buffer above, with the addition of varying amounts of sucrose:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">15% (w/v) sucrose to make 15% sucrose gradient solution</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">50% (w/v) sucrose to make 50% sucrose gradient solution</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5 M sucrose to make 0.5 M sucrose cushion</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">As above, cycloheximide, DTT, PMSF, and RNaseOUT must be added fresh.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">The 60% sucrose chase solution requires only sucrose and water, no other components</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">60% (w/v) sucrose in DEPC-treated water to make 60% sucrose chase solution</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA Capture Wash Buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">20mM&#160; KCl</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5unit/ml Rnase Out (Invitrogen)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA Capture Elution Buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as RNA Capture Wash Buffer, with the addition of:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2mM Biotin</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="28">
			<td height="28" style="height:28px;">EQUIPMENT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SW55 Ti ultracentrifuge rotor (Beckman, cat. no. 342194)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SW41 Ti ultracentrifuge rotor (Beckman, cat. no. 331362)</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;">Ultra-ClearTM &#189; x 2 in (13 x 51 mm) ultracentrifuge tubes for the SW55 (Beckman, cat. no. 344057)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Polyallomer 9/16 x 3 &#189; in (14 x 89 mm) ultracentrifuge tubes for the SW41 (Beckman, cat. no. 331372)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">L8-80M ultracentrifuge (Beckman)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Steel blunt syringe needle, 4 inch, 16G (Aldrich, cat. no. Z261378)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 ml syringe with 27G&#189; needle (Becton Dickinson, cat no. 309623)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5 ml syringe (Becton Dickinson, cat. no. 309646)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Parafilm</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Tube rotator, end-over-end</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Microcentrifuge, refrigerated</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Density gradient fractionation system (Teledyne Isco, cat. no. 69-3873-179)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">TracerDAQ (Measurement Computing)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Eppendorf 5810R centrifuge</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Eppendorf A-4-81 rotor (Eppendorf, cat. no. 022638807)</td>
		</tr>
	</tbody>
</table>

methods to investigate the regulatory role of small rnas and ribosomal occupancy of plasmodium falciparum

겸상 적혈구 대립 유전자에 대한 책임 유전 적 변이 (HBS)은 말라리아 기생충, 경찰에 의한 감염에 저항하는 적혈구 수 열대열. 다 요인으로 알려져있다이 저항의 분자 기초는 완전히 이해되지 못하고있다 유지. 최근의 연구는 한 번 말라리아 기생충에 전좌 적혈구 마이크로 RNA의 발현 차이는 유전자 조절 및 기생충 성장 모두에 영향을 미치는 것으로 나타났다. 이러한 miRNA가 나중에 기생충의 mRNA의 은밀한 부분 집합 5 &#39;RNA 융합을 통해 키메라 RNA 전 사체를 형성하여 mRNA의 번역을 억제하는 것으로 나타났다. 여기에서 사용 된 기술은 유전자 조절 및 P.의 병진 ​​전위에 기능적 역할 및 추정 메커니즘 기본 적혈구 마이크로 RNA 공부 원충, 호스트 적혈구에 수정 합성 마이크로 RNA의 형질을 포함하여 상세하게 설명한다. 마지막 polysom​​e 그라데이션 방법 TRA의 범위를 결정하는 데 사용되는이러한 성적 증명서의 nslation. 함께, 이러한 기술은 우리가 적혈구 마이크로 RNA의 조절 이상 수준이 겸상 적혈구 세포 고유 말라리아 저항에 기여 함을 입증 할 수 있었다.

P. 인간 마이크로 RNA의 글로벌 프로파일 열대열 여기에 제시된 기술은 다양한 조건에서 기생충에서 마이크로 RNA를 추출하는 데 사용되었다. 한가지 유의할 사항들은이 문서 및 원래 공부 (29) 모두에 제시된 마이크로 RNA 데이터 기준점 역임 32에 나타낸 바와 같이, 감염되지 않은 적혈구 용 RNA의 추출을 수행 하였다는 것이다. 그 이전의 연구는 HBS...

Watch this Scientific Journal Video about Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum at JoVE.com

Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

Human microRNAs translocate from host erythrocytes to Plasmodium falciparum parasites. Here, the techniques used to transfect synthetic microRNAs into host erythrocytes and isolate all RNAs from P. falciparum are described. In addition, this paper will detail a method of polysome isolation in P. falciparum to determine the ribosomal occupancy and translational potential of parasite transcripts.

방법은 작은 RNA를과의 리보솜 점유 규제 역할을 조사하기 위해<em&gt; 말라리아 원충</em

The genetic variation responsible for the sickle cell allele (HbS) enables erythrocytes to resist infection by the malaria parasite, P. falciparum. The ...

methods-to-investigate-regulatory-role-small-rnas-ribosomal-occupancy

Research

JoVE Journal

Immunology and Infection

Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

8.8K 조회수.  Duke University School of Medicine. Human microRNAs translocate from host erythrocytes to Plasmodium falciparum parasites. Here, the techniques used to transfect synthetic microRNAs into host erythrocytes and isolate all RNAs from P. falciparum are described. In addition, this paper will detail a method of polysome isolation in P. falciparum to determine the ribosomal occupancy and translational potential of parasite transcripts. 

비디오: Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

Selection of Plasmodium falciparum Parasites for Cytoadhesion to Human Brain Endothelial Cells

Most human malaria deaths are caused by blood-stage Plasmodium falciparum parasites. Cerebral malaria, the most life-threatening complication of the disease, is characterised by an accumulation of Plasmodium falciparum infected red blood cells (iRBC) at pigmented trophozoite stage in the microvasculature of the brain2-4. This microvessel obstruction (sequestration) leads to acidosis, hypoxia and harmful inflammatory cytokines (reviewed in 5). Sequestration is also found in most microvascular tissues of the human body2, 3. The mechanism by which iRBC attach to the blood vessel walls is still poorly understood.
The immortalized Human Brain microvascular Endothelial Cell line (HBEC-5i) has been used as an in vitro model of the blood-brain barrier6. However, Plasmodium falciparum iRBC attach only poorly to HBEC-5i in vitro, unlike the dense sequestration that occurs in cerebral malaria cases. We therefore developed a panning assay to select (enrich) various P. falciparum strains for adhesion to HBEC-5i in order to obtain populations of high-binding parasites, more representative of what occurs in vivo.
A sample of a parasite culture (mixture of iRBC and uninfected RBC) at the pigmented trophozoite stage is washed and incubated on a layer of HBEC-5i grown on a Petri dish. After incubation, the dish is gently washed free from uRBC and unbound iRBC. Fresh uRBC are added to the few iRBC attached to HBEC-5i and incubated overnight. As schizont stage parasites burst, merozoites reinvade RBC and these ring stage parasites are harvested the following day. Parasites are cultured until enough material is obtained (typically 2 to 4 weeks) and a new round of selection can be performed. Depending on the P. falciparum strain, 4 to 7 rounds of selection are needed in order to get a population where most parasites bind to HBEC-5i. The binding phenotype is progressively lost after a few weeks, indicating a switch in variant surface antigen gene expression, thus regular selection on HBEC-5i is required to maintain the phenotype.
In summary, we developed a selection assay rendering P. falciparum parasites a more "cerebral malaria adhesive" phenotype. We were able to select 3 out of 4 P. falciparum strains on HBEC-5i. This assay has also successfully been used to select parasites for binding to human dermal and pulmonary endothelial cells. Importantly, this method can be used to select tissue-specific parasite populations in order to identify candidate parasite ligands for binding to brain endothelium. Moreover, this assay can be used to screen for putative anti-sequestration drugs7.

Selection of Plasmodium falciparum Parasites for Cytoadhesion to Human Brain Endothelial Cells

An in vitro model for cerebral malaria sequestration is described1. Plasmodium falciparum infected red blood cells are selected for binding to immortalized human brain microvascular endothelial cells. The selected parasites show a distinct phenotype. The selection process can be applied using various P. falciparum strains and endothelial cell lines.

선정 Plasmodium falciparum</em인간 두뇌 내피 세포 Cytoadhesion위한> 기생충

Most human malaria deaths are caused by blood-stage Plasmodium falciparum parasites. Cerebral malaria, the most life-threatening complication of the ...

연구

면역학 및 감염병학

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. 1A-C), females of the genus Leptopilina (Fig. 1D, 1F, 1G) and Ganaspis (Fig. 1E) attack the larval stages. We use these parasites to study the molecular basis of a biological arms race. Parasitic wasps have tremendous value as biocontrol agents. Most of them carry virulence and other factors that modify host physiology and immunity. Analysis of Drosophila wasps is providing insights into how species-specific interactions shape the genetic structures of natural communities. These studies also serve as a model for understanding the hosts' immune physiology and how coordinated immune reactions are thwarted by this class of parasites.
The larval/pupal cuticle serves as the first line of defense. The wasp ovipositor is a sharp needle-like structure that efficiently delivers eggs into the host hemocoel. Oviposition is followed by a wound healing reaction at the cuticle (Fig. 1C, arrowheads). Some wasps can insert two or more eggs into the same host, although the development of only one egg succeeds. Supernumerary eggs or developing larvae are eliminated by a process that is not yet understood. These wasps are therefore referred to as solitary parasitoids.
Depending on the fly strain and the wasp species, the wasp egg has one of two fates. It is either encapsulated, so that its development is blocked (host emerges; Fig. 2 left); or the wasp egg hatches, develops, molts, and grows into an adult (wasp emerges; Fig. 2 right). L. heterotoma is one of the best-studied species of Drosophila parasitic wasps. It is a "generalist," which means that it can utilize most Drosophila species as hosts1. L. heterotoma and L. victoriae are sister species and they produce virus-like particles that actively interfere with the encapsulation response2. Unlike L. heterotoma, L. boulardi is a specialist parasite and the range of Drosophila species it utilizes is relatively limited1. Strains of L. boulardi also produce virus-like particles3 although they differ significantly in their ability to succeed on D. melanogaster1. Some of these L. boulardi strains are difficult to grow on D. melanogaster1 as the fly host frequently succeeds in encapsulating their eggs. Thus, it is important to have the knowledge of both partners in specific experimental protocols.
In addition to barrier tissues (cuticle, gut and trachea), Drosophila larvae have systemic cellular and humoral immune responses that arise from functions of blood cells and the fat body, respectively. Oviposition by L. boulardi activates both immune arms1,4. Blood cells are found in circulation, in sessile populations under the segmented cuticle, and in the lymph gland. The lymph gland is a small hematopoietic organ on the dorsal side of the larva. Clusters of hematopoietic cells, called lobes, are arranged segmentally in pairs along the dorsal vessel that runs along the anterior-posterior axis of the animal (Fig. 3A). The fat body is a large multifunctional organ (Fig. 3B). It secretes antimicrobial peptides in response to microbial and metazoan infections.
Wasp infection activates immune signaling (Fig. 4)4. At the cellular level, it triggers division and differentiation of blood cells. In self defense, aggregates and capsules develop in the hemocoel of infected animals (Fig. 5)5,6. Activated blood cells migrate toward the wasp egg (or wasp larva) and begin to form a capsule around it (Fig. 5A-F). Some blood cells aggregate to form nodules (Fig. 5G-H). Careful analysis reveals that wasp infection induces the anterior-most lymph gland lobes to disperse at their peripheries (Fig. 6C, D).
We present representative data with Toll signal transduction pathway components Dorsal and Sp&auml;tzle (Figs. 4,5,7), and its target Drosomycin (Fig. 6), to illustrate how specific changes in the lymph gland and hemocoel can be studied after wasp infection. The dissection protocols described here also yield the wasp eggs (or developing stages of wasps) from the host hemolymph (Fig. 8).

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Parasitoid (parasitic) wasps constitute a major class of natural enemies of many insects including Drosophila melanogaster. We will introduce the techniques to propagate these parasites in Drosophila spp. and demonstrate how to analyze their effects on immune tissues of Drosophila larvae.

의 기생충 말벌에 대한 소개<em&gt; Drosophila</em&gt; 그리고 Antiparasite 면역 반응

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. ...

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

Plasmodium falciparum, the causative agent of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important health problems worldwide, being responsible for a total of 4 million deaths annually1. Due to their extensive overlap in developing regions, especially Sub-Saharan Africa, co-infections with malaria and HIV-1 are common, but the interplay between the two diseases is poorly understood. Epidemiological reports have suggested that malarial infection transiently enhances HIV-1 replication and increases HIV-1 viral load in co-infected individuals2,3. Because this viremia stays high for several weeks after treatment with antimalarials, this phenomenon could have an impact on disease progression and transmission.
The cellular immunological mechanisms behind these observations have been studied only scarcely. The few in vitro studies investigating the impact of malaria on HIV-1 have demonstrated that exposure to soluble malarial antigens can increase HIV-1 infection and reactivation in immune cells. However, these studies used whole cell extracts of P. falciparum schizont stage parasites and peripheral blood mononuclear cells (PBMC), making it hard to decipher which malarial component(s) was responsible for the observed effects and what the target host cells were4,5. Recent work has demonstrated that exposure of immature monocyte-derived dendritic cells to the malarial pigment hemozoin increased their ability to transfer HIV-1 to CD4+ T cells6,7, but that it decreased HIV-1 infection of macrophages8. To shed light on this complex process, a systematic analysis of the interactions between the malaria parasite and HIV-1 in different relevant human primary cell populations is critically needed.
Several techniques for investigating the impact of HIV-1 on the phagocytosis of micro-organisms and the effect of such pathogens on HIV-1 replication have been described. We here present a method to investigate the effects of P. falciparum-infected erythrocytes on the replication of HIV-1 in human primary monocyte-derived macrophages. The impact of parasite exposure on HIV-1 transcriptional/translational events is monitored by using single cycle pseudotyped viruses in which a luciferase reporter gene has replaced the Env gene while the effect on the quantity of virus released by the infected macrophages is determined by measuring the HIV-1 capsid protein p24 by ELISA in cell supernatants.

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

We have developed an in vitro malaria-HIV-1 co-infection model to study the impact of Plasmodium falciparum on the HIV-1 replicative cycle in human primary monocyte-derived macrophages. This versatile system can easily be adapted to other primary cell types susceptible to HIV-1 infection.

<em&gt; 체외에서</em공부하기&gt; 공동 감염 모델<em&gt; Plasmodium falciparum</em인간의 기본 단핵구 파생 면역 세포에서&gt; - HIV-1 상호 작용

Plasmodium falciparum, the causative agent  of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important ...

A Simple Protocol for Platelet-mediated Clumping of Plasmodium falciparum-infected Erythrocytes in a Resource Poor Setting

P. falciparum causes the majority of severe malarial infections. The pathophysiological mechanisms underlying cerebral malaria (CM) are not fully understood and several hypotheses have been put forward, including mechanical obstruction of microvessels by P. falciparum-parasitized red blood cells (pRBC). Indeed, during the intra-erythrocytic stage of its life cycle, P. falciparum has the unique ability to modify the surface of the infected erythrocyte by exporting surface antigens with varying adhesive properties onto the RBC membrane. This allows the sequestration of pRBC in multiple tissues and organs by adhesion to endothelial cells lining the microvasculature of post-capillary venules 1. By doing so, the mature forms of the parasite avoid splenic clearance of the deformed infected erythrocytes 2 and restrict their environment to a more favorable low oxygen pressure 3. As a consequence of this sequestration, it is only immature asexual parasites and gametocytes that can be detected in peripheral blood.
Cytoadherence and sequestration of mature pRBC to the numerous host receptors expressed on microvascular beds occurs in severe and uncomplicated disease. However, several lines of evidence suggest that only specific adhesive phenotypes are likely to be associated with severe pathological outcomes of malaria. One example of such specific host-parasite interactions has been demonstrated in vitro, where the ability of intercellular adhesion molecule-1 to support binding of pRBC with particular adhesive properties has been linked to development of cerebral malaria 4,5. The placenta has also been recognized as a site of preferential pRBC accumulation in malaria-infected pregnant women, with chondrotin sulphate A expressed on syncytiotrophoblasts that line the placental intervillous space as the main receptor 6. Rosetting of pRBC to uninfected erythrocytes via the complement receptor 1 (CD35)7,8 has also been associated with severe disease 9.
One of the most recently described P. falciparum cytoadherence phenotypes is the ability of the pRBC to form platelet-mediated clumps in vitro. The formation of such pRBC clumps requires CD36, a glycoprotein expressed on the surface of platelets. Another human receptor, gC1qR/HABP1/p32, expressed on diverse cell types including endothelial cells and platelets, has also been shown to facilitate pRBC adhesion on platelets to form clumps 10. Whether clumping occurs in vivo remains unclear, but it may account for the significant accumulation of platelets described in brain microvasculature of Malawian children who died from CM 11. In addition, the ability of clinical isolate cultures to clump in vitro was directly linked to the severity of disease in Malawian 12 and Mozambican patients 13, (although not in Malian 14).
With several aspects of the pRBC clumping phenotype poorly characterized, current studies on this subject have not followed a standardized procedure. This is an important issue because of the known high variability inherent in the assay 15. Here, we present a method for in vitro platelet-mediated clumping of P. falciparum with hopes that it will provide a platform for a consistent method for other groups and raise awareness of the limitations in investigating this phenotype in future studies. Being based in Malawi, we provide a protocol specifically designed for a limited resource setting, with the advantage that freshly collected clinical isolates can be examined for phenotype without need for cryopreservation.

A Simple Protocol for Platelet-mediated Clumping of Plasmodium falciparum-infected Erythrocytes in a Resource Poor Setting

This method investigates the platelet-mediated clumping phenotype of Plasmodium falciparum-infected erythrocytes (pRBC) in clinical isolates. This is performed by isolating and co-incubating platelet-rich plasma and a suspension of pRBC.

의 혈소판 응집 중재를위한 간단한 프로토콜<em&gt; 변형체 falciparum의</em자원별로 설정에서&gt; - 감염된 적혈구

P. falciparum causes the majority of severe malarial infections. The pathophysiological mechanisms underlying cerebral malaria (CM) are not fully ...

Isolation and Analysis of Brain-sequestered Leukocytes from Plasmodium berghei ANKA-infected Mice

We describe a method for isolation and characterization of adherent inflammatory cells from brain blood vessels of P. berghei ANKA-infected mice. Infection of susceptible mouse-strains with this parasite strain results in the induction of experimental cerebral malaria, a neurologic syndrome that recapitulates certain important aspects of Plasmodium falciparum-mediated severe malaria in humans 1,2 . Mature forms of blood-stage malaria express parasitic proteins on the surface of the infected erythrocyte, which allows them to bind to vascular endothelial cells. This process induces obstructions in blood flow, resulting in hypoxia and haemorrhages 3 and also stimulates the recruitment of inflammatory leukocytes to the site of parasite sequestration.
Unlike other infections, i.e neutrotopic viruses4-6, both malaria-parasitized red blood cells (pRBC) as well as associated inflammatory leukocytes remain sequestered within blood vessels rather than infiltrating the brain parenchyma. Thus to avoid contamination of sequestered leukocytes with non-inflammatory circulating cells, extensive intracardial perfusion of infected-mice prior to organ extraction and tissue processing is required in this procedure to remove the blood compartment. After perfusion, brains are harvested and dissected in small pieces. The tissue structure is further disrupted by enzymatic treatment with Collagenase D and DNAse I. The resulting brain homogenate is then centrifuged on a Percoll gradient that allows separation of brain-sequestered leukocytes (BSL) from myelin and other tissue debris. Isolated cells are then washed, counted using a hemocytometer and stained with fluorescent antibodies for subsequent analysis by flow cytometry.
This procedure allows comprehensive phenotypic characterization of inflammatory leukocytes migrating to the brain in response to various stimuli, including stroke as well as viral or parasitic infections. The method also provides a useful tool for assessment of novel anti-inflammatory treatments in pre-clinical animal models.

Isolation and Analysis of Brain-sequestered Leukocytes from Plasmodium berghei ANKA-infected Mice

A method for isolation of adherent inflammatory leukocytes from brain blood vessels of Plasmodium berghei ANKA-infected mice is described. The method allows quantification as well as phenotypic characterization of isolated leukocytes after staining with fluorescent antibodies and subsequent analysis by flow cytometry.

에서 뇌 - 분리 된 백혈구의 분리 및 분석<em&gt; Plasmodium berghei</em&gt; ANKA에 감염된 마우스

We describe a method for isolation and  characterization of adherent inflammatory cells from brain blood vessels of P. berghei ANKA-infected mice. ...

Separation of Plasmodium falciparum Late Stage-infected Erythrocytes by Magnetic Means

Unlike other Plasmodium species, P. falciparum can be cultured in the lab, which facilitates its study 1. While the parasitemia achieved can reach the &asymp;40% limit, the investigator usually keeps the percentage at around 10%. In many cases it is necessary to isolate the parasite-containing red blood cells (RBCs) from the uninfected ones, to enrich the culture and proceed with a given experiment. 
When P. falciparum infects the erythrocyte, the parasite degrades and feeds from haemoglobin 2, 3. However, the parasite must deal with a very toxic iron-containing haem moiety 4, 5. The parasite eludes its toxicity by transforming the haem into an inert crystal polymer called haemozoin 6, 7. This iron-containing molecule is stored in its food vacuole and the metal in it has an oxidative state which differs from the one in haem 8. The ferric state of iron in the haemozoin confers on it a paramagnetic property absent in uninfected erythrocytes. As the invading parasite reaches maturity, the content of haemozoin also increases 9, which bestows even more paramagnetism on the latest stages of P. falciparum inside the erythrocyte.
Based on this paramagnetic property, the latest stages of P. falciparum infected-red blood cells can be separated by passing the culture through a column containing magnetic beads. These beads become magnetic when the columns containing them are placed on a magnet holder. Infected RBCs, due to their paramagnetism, will then be trapped inside the column, while the flow-through will contain, for the most part, uninfected erythrocytes and those containing early stages of the parasite.
Here, we describe the methodology to enrich the population of late stage parasites with magnetic columns, which maintains good parasite viability 10. After performing this procedure, the unattached culture can be returned to an incubator to allow the remaining parasites to continue growing.

Separation of Plasmodium falciparum Late Stage-infected Erythrocytes by Magnetic Means

The paramagnetic properties of hemozoin are used to isolate late stages of Plasmodium falciparum-infected red blood cells growing in culture. The method is simple and fast and does not affect the subsequent invasive capabilities of the parasites.

의 분리<em&gt; Plasmodium falciparum</em자기 수단으로&gt; 늦은 단계에 감염된 적혈구

Unlike other Plasmodium species, P. falciparum can be cultured in the lab, which facilitates its study 1. While the parasitemia achieved can reach the ...

High Yield Purification of Plasmodium falciparum Merozoites For Use in Opsonizing Antibody Assays

Plasmodium falciparum merozoite antigens are under development as potential malaria vaccines. One aspect of immunity against malaria is the removal of free merozoites from the blood by phagocytic cells. However assessing the functional efficacy of merozoite specific opsonizing antibodies is challenging due to the short half-life of merozoites and the variability of primary phagocytic cells. Described in detail herein is a method for generating viable merozoites using the E64 protease inhibitor, and an assay of merozoite opsonin-dependent phagocytosis using the pro-monocytic cell line THP-1. E64 prevents schizont rupture while allowing the development of merozoites which are released by filtration of treated schizonts. &#160;Ethidium bromide labelled merozoites are opsonized with human plasma samples and added to THP-1 cells. Phagocytosis is assessed by a standardized high throughput protocol. Viable merozoites are a valuable resource for assessing numerous aspects of P. falciparum biology, including assessment of immune function. Antibody levels measured by this assay are associated with clinical immunity to malaria in naturally exposed individuals. The assay may also be of use for assessing vaccine induced antibodies. &#160;

High Yield Purification of Plasmodium falciparum Merozoites For Use in Opsonizing Antibody Assays

Measuring antibody function is key to understanding immunity to Plasmodium falciparum malaria. This method describes the purification of viable merozoites, and measurement of opsonization-dependent phagocytosis by flow cytometry.

높은 수익률 정화<em&gt; 변형체 falciparum의</emOpsonizing 항체 분석 실험에 사용하기 위해&gt; Merozoites

Plasmodium falciparum merozoite antigens are under development as potential malaria vaccines. One aspect of immunity against malaria is the removal of ...

Genotyping of Staphylococcus aureus by Ribosomal Spacer PCR (RS-PCR)

The ribosomal spacer PCR (RS-PCR) is a highly resolving and robust genotyping method for S. aureus that allows a high throughput at moderate costs and is, therefore, suitable to be used for routine purposes. For best resolution, data evaluation and data management, a miniaturized electrophoresis system is required. Together with such an electrophoresis system and the in-house developed software (freely available here) assignment of the pattern of bands to a genotype is standardized and straight forward. DNA extraction is simple (boiling prep), setting-up of the reactions is easy and they can be run on any standard PCR machine. PCR cycling is common except prolonged ramping and elongation times. Compared to spa typing and Multi Locus Sequence Typing (MLST), RS-PCR does not require DNA sequencing what simplifies the analysis considerably and allows a high throughput. Furthermore, the resolution for bovine strains of S. aureus is at least as good as spa typing and better than MLST or pulsed-field gel electrophoresis (PFGE). The RS-PCR data base includes presently a total of 141 genotypes and variants. The method is highly associated with the virulence gene pattern, contagiosity and pathogenicity of S. aureus strains involved in bovine mastitis. S. aureus genotype B (GTB) is contagious and causes herds problems causing large costs in the Switzerland and other European countries. All the other genotypes observed in Switzerland infect individual cows and quarters. Genotyping by RS-PCR allows the reliable prediction of the epidemiological and the pathogenic potential of S. aureus involved in bovine intramammary infection (IMI), two key factors for clinical veterinary medicine. Because of these beneficial properties together with moderate costs and a high sample throughput the goal of this publication is to give a detailed, step-by-step protocol for easily establishing and running RS-PCR for genotyping S. aureus in other laboratories.

Genotyping of Staphylococcus aureus by Ribosomal Spacer PCR RS-PCR

Here, ribosomal spacer PCR (RS-PCR) is used together with a miniaturized electrophoresis system as a fast and high resolution method for genotyping S. aureus at moderate costs allowing a high throughput.

의 유전자형<em&gt; 황색 포도상 구균</em&gt;에 의해 리보솜 스페이서 PCR (RS-PCR)

The ribosomal spacer PCR (RS-PCR) is a highly resolving and robust genotyping method for S. aureus that allows a high throughput at moderate costs and is, ...

Using Phylogenetic Analysis to Investigate Eukaryotic Gene Origin

Phylogenetic analysis uses nucleotide or amino acid sequences or other parameters, such as domain sequences and three-dimensional structure, to construct a tree to show the evolutionary relationship among different taxa (classification units) at the molecular level. Phylogenetic analysis can also be used to investigate domain relationships within an individual taxon, particularly for organisms that have undergone substantial change in morphology and physiology, but for which researchers lack fossil evidence due to the organisms&#39; long evolutionary history or scarcity of fossilization.
In this text, a detailed protocol is described for using the phylogenetic method, including amino acid sequence alignment using Clustal Omega, and subsequent phylogenetic tree construction using both Maximum Likelihood (ML) of Molecular Evolutionary Genetics Analysis (MEGA) and Bayesian Inference via MrBayes. To investigate the origin of eukaryotic Sugars Will Eventually be Exported Transporters (SWEET) genes, 228 SWEETs including 35 SWEET proteins from unicellular eukaryotes and 57 SemiSWEET proteins from prokaryotes were analyzed. Interestingly, SemiSWEETs were found in prokaryotes, but SWEETs were found in eukaryotes. Two phylogenetic trees constructed using theoretically distinct methods have consistently&#160;suggested that the first eukaryotic SWEET gene might stem from the fusion of a bacterial SemiSWEET gene and an archaeal SemiSWEET gene.&#160;It is worth noting that one should be cautious to draw a conclusion based only on phylogenetic analysis, although it is useful to explain the underlying relationship between different taxa, which is difficult or even impossible to discern through experimental means.

A method of constructing a phylogenetic tree based on sequence homology of SWEETs from eukaryotes and SemiSWEETs from prokaryotes is described. Phylogenetic analysis is a useful tool for explaining the evolutionary relatedness between homologous proteins or genes from different organism groups.

사용 하 여 계통 발생 분석은 진 핵 유전자 원산지 조사

Phylogenetic analysis uses nucleotide or amino acid sequences or other parameters, such as domain sequences and three-dimensional structure, to construct ...

Bone Marrow Transplantation Platform to Investigate the Role of Dendritic Cells in Graft-versus-Host Disease

Allogeneic bone marrow transplantation (BMT) is an effective therapy for hematological malignancies due to the graft-versus-leukemia (GVL) effect to eradicate tumors. However, its application is limited by the development of graft-versus-host disease (GVHD), a major complication of BMT. GVHD is evoked when T-cells in the donor grafts recognizealloantigen expressed by recipient cells and mount unwanted immunological attacks against recipient healthy tissues. Thus, traditional therapies are designed to suppress donor T-cell alloreactivity. However, these approaches substantially impair the GVL effect so that the recipient&#39;s survival is not improved. Understanding the effects of therapeutic approaches on BMT, GVL, and GVHD, is thus essential. Due to the antigen-presenting and cytokine-secreting capacities to stimulate donor T-cells, recipient dendritic cells (DCs) play a significant role in the induction of GVHD. Therefore, targeting recipient DCs becomes a potential approach for controlling GVHD. This work provides a description of a novel BMT platform to investigate how host DCs regulate GVH and GVL responses after transplantation. Also presented is an effective BMT model to study the biology of GVHD and GVL after transplantation.

Graft-versus-host disease is a major complication after allogeneic bone marrow transplantation. Dendritic cells play a critical role in the pathogenesis of graft-versus-host disease. The current article describes a novel bone marrow transplantation platform to investigate the role of dendritic cells in the development of graft-versus-host disease and the graft-versus-leukemia effect.

이식대 숙주 질환에서 수지상 세포의 역할을 조사하는 골수 이식 플랫폼

Allogeneic bone marrow transplantation (BMT) is an effective therapy for hematological malignancies due to the graft-versus-leukemia (GVL) effect to ...