This work was supported by grants from CONACyT-SEP (SEP-2008-84582; CB-2011-01-168497) and Promep-SEP for R.A.G.; P.H. received a scholarship from CONACyT (447442).

1. HFF 세포 배양 및 광고 감염 <ol><li> 앞서 설명 된 바와 같이 8 HFF 세포에 형광 형성 유닛 (FFU)로서 HEK-293 세포의 단층에서 역가의 Ad5 WT 바이러스를 전파. </li><li> 가습 인큐베이터에서 DMEM / 10 % 태아 소 37 ºC에서 멸균 문화 100mm 요리 혈청 (FBS) 5 % CO 2 10ml에 인간의 포피 섬유 아세포 (HFF)을 성장. 네 16 평방 세트에서 세포를 계산하여 노이 바 우어 챔버를 이용하여 세포 수를 결정합니다. 용액 당 세포 수는 4-16 개의 정사각형 세트 세포 수의 평균을 산출하고 (10) (4)에 의해이 값을 곱함으로써 얻어진다. 스텝 130에 포함 된 각 시간 후 감염, 1 × 10 7 HFF 셀을 사용한다. </li><li> 모의 감염시킬가 형성 부 (30) 포커스의 방어에 접시 당 DMEM에서의 Ad5 1 ㎖를 사용하여 100mm 조직 배양 접시에서 아데노 바이러스 5 형 (의 Ad5) 야생형 (WT) (H5pg4100 8)로 HFF 세포를 감염, 또는 FFU 또는 셀 당. 아에 2 시간 동안 품어신중 요리마다 15 분간 흔들 umidified 37 ºC에서 세포 배양 인큐베이터 및 5 % CO 2, 셀 위에 바이러스 접종원 균일 분포를 보장한다. 이 시간 후, 배지를 제거하고, 추가 10 % FBS가 보충 된 신선한 DMEM 및 CO 2에서 37 º C 가습 세포 배양 인큐베이터에서 16, 24 또는 36 시간 동안 배양하고, 5 %. 2.1 단계로 진행합니다. </li></ol> 아데노 바이러스 RC이 함유 하위 핵 분수 2. 준비 <ol><li> 수확의 Ad5는 감염 또는 셀 스크래퍼와 모의에 감염된 HFF 세포와 멸균 원심 분리기 튜브에 세포를 수집합니다. 단계 1.2에서와 같이 세포 수를 결정합니다. 단계 1.3에 지정된 각 시간 후 감염 1 × 10 7 세포를 사용합니다. </li><li> 220 XG, 5 분 동안 4 ºC에서 세포를 원심 분리기. </li><li> 빙냉 PBS에서 세포 펠렛을 재현 탁 (137 mM의 염화나트륨, 2.7 mM의 KCl을을, 10 mM의 나트륨 2 HPO 4 및 1.8 mM의 KH 2 PO 4). 세척 세포 펠렛S 세척 당 빙냉 PBS 5 mL를 이용하여 3 회. 이를 위해, 원심 분리기 (220) XG, 5 분, 4 캔트 ºC에서 세포 상등액 (SN)을 폐기하고, 부드럽게 피펫 팅하여 세포 펠렛을 재현 탁. </li><li> 세포막을 파괴하기 위해, 700에서 세포 펠렛을 얼음 - 냉각 된 저장성 완충액 (L) (10 mM의 HEPES pH가 7.9, 10 mM의 KCl을 1.5 밀리미터의 MgCl 2, 0.5 mM의 DTT, 20 μ g / ㎖의 페닐 메틸 설 포닐 플루오 라이드 (PMSF)를 μ 재현 탁 10 μ g / ㎖ 소 췌장 트립신 저해제 10 μ는 g / ㎖ 펩 스타틴, 10 μ g / ml의 N 아세틸 L 로이 실 - L 로이 실 - L 포함한 시스테인, 세린, 트레오닌 및 아스파 틸 프로테아제 억제제의 혼합물 -argininal)과 세포를 3 시간 동안 얼음에 팽윤. </li><li> 를 Lyse 헐렁한 A 형 테플론와 유 봉, 호모 게 나이저를 사용하여 세포. 스트로크와 밝은 필드 현미경으로 매 20 스트로크는 모든 세포가 용해되었는지 확인하는 모니터 샘플 다운스 (80) 수행하지만, 핵 N 가지고손상 또는 파손 된 오티. </li><li> 300 XG, 5 분 동안 4 ºC에서 세포 파쇄 액을 원심 분리기. 원심 분리기 튜브 -20 ºC에서 세포질 분수로 SN을 저장합니다. </li><li> 솔루션 1 (S1)의 750 μ L (에 재현 탁, 핵에서 펠렛을 세포 파편을 제거하려면 0.25 M 자당, 10 밀리미터의 MgCl (10)를 포함하여 2 ~ 20 μ g / ㎖ PMSF, 시스테인, 세린의 혼합물 쓰 레오 닌과 아스파 틸 프로테아제 억제제 μ g / ㎖ 소 췌장 트립신 저해제 10 μ g / ㎖ 펩 스타틴, 10 μ g / ml의 N 아세틸 L 로이 실 - L 로이 실 - L-argininal)과 용액 (2)의 동일 부피를 통해 층 (S2) (0.35 M 수 크로스, 0.5 밀리미터의 MgCl 2, 20 μ g / ㎖의 PMSF, 시스테인, 세린, 10 μ g / ㎖ 소 췌장 트립신 저해제 10 μ g / ㎖ 펩 스타틴, 10 μ 포함 트레오닌 및 아스파 틸 프로테아제 억제제의 혼합물 g / ㎖의 아세틸 N-L-L 로이 실 - 로이 실 - L-argininal). 하기 Centr1400 XG, 5 분 4 ºC에서 ifuge. </li><li> 마이크로 피펫을 사용하여 SN을 폐기하십시오. 펠렛을 방해하지 마십시오. </li><li> S2 750 μ 리터에 고립 핵을 함유하는 펠렛을 재현 탁. </li><li> 아데노 RC (RCF) subnuclear 풍부 분획을 분리하기 위해, 5 분간 두 펄스를 이용하여, 초음파 욕 핵을 재현 탁하고, 초음파 처리, 또는 명 시야 현미경으로 관찰 된 바와 같이 모든 핵을 용해 될 때까지. C에서 4 ° 이하로 샘플을 유지하기 위해 필요에 따라 초음파 욕조에 얼음을 사용합니다. </li><li> 용액 3 (S3)에서 3,000 XG (0.88 M 수 크로스, 0.5 밀리미터의 MgCl 2) 원심 분리기, 10 분 동안 4 ºC 동량 위에 초음파 핵 층을 포함한다. -70 ºC에서 nucleoplasmic 비율 (NPL)과 1.5 ml의 상층 액을 저장합니다. -70 ºC에서 RCF와 S2의 700 μ L의 펠렛 및 저장을 재현 탁. </li></ol> RCF 3. 서양 얼룩의 분석 참고 : NPL과 RCF 분수 (S)의 웨스턴 블롯 분석을위한등은 제외 (640)는 고정 이하 여신에 대한 L 단계 2.11에서 얻은 총 볼륨에서 RCF 300 μ L를 μ. <ol><li> 5 분 95 ºC에서 15 μ 램 믈리 버퍼 2 배의 각 subnuclear 부분의 L (4 % SDS, 20 % 글리세롤, 10 % 2- 머 캅토 에탄올, 블루 0.004 % 브로 모 페놀, 0.125 M 트리스 염산의 pH 6.8)과 종기를 섞는다. 10 % 나트륨 도데 실 설페이트 - 폴리 아크릴 아미드 겔 전기 영동 (SDS-PAGE) 20 밀리 암페어 (mA)에서 1.5 시간 동안 겔 분리 단백질 변성에 샘플을 로딩. </li><li> 폴리 비닐 리덴 디 플루오 라이드 (PVDF) 막에 400mA에서 1.5 시간 동안 electroblotting에 의해 단백질을 전송합니다. </li><li> RT는 PBS에 3 % 탈지 분유를 사용에서 2 시간 동안 막을 차단합니다. </li><li> PBS / 0.3 % 탈지 분유 500 희석 : 1에서 바이러스 E2A의 DNA 결합 단백질 (B6-8 9)에 대한 일차 항체와 4 ºC에서 O / N을 품어. </li><li> 3 회 PBS로 세척 막 / 0.1 %의 10 분 트윈 20. </li><li> 마우스 항 IgG의 차와 멤브레인을 품어실온에서 2 시간 동안 PBS에서 10,000 희석 : tibody은 1에서 말 무 퍼 옥시 다제 (HRP)에 연결된다. </li><li> PBS로 막 3 회 반복 / 0.1 % 트윈 20을 10 분 동안. </li><li> 강화 된 화학 발광 및 X 선 필름을 사용하여 멤브레인을 개발한다. </li></ol> RCF 4. 바이러스 DNA 검출 참고 : 두 NPL과 RCF 분수의 DNA 분리를 들어, 단계 2.11에서 얻은 총 부피의 RCF에 대한 NPL 210 μ L 100 μ L를 사용합니다. <ol><li> 단백질 분해 효소 K의 1 ㎎ / ㎖ 및 0.5 % 트윈 20과 55 ºC에서 1 시간 동안 하위 핵 분수를 품어. </li><li> 95 ° C에서 10 분 동안 샘플을 배양하여 단백질 분해 효소 K 불 활성화. </li><li> 2 분 동안 실온에서 20,000 XG에서 샘플을 원심 분리기. </li><li> (SN)를 수집합니다. 4 ℃에서 3M 아세트산 나트륨 1/10 부피의 이소프로판올을 하나의 볼륨, O / N로 DNA를 침전. </li><li> 실온에서 10 분 동안 20,000 XG에서 원심 분리. </li><li> SN의 U 폐기마이크로 피펫을 노래. 20,000 XG, 5 분 동안 4 ° C에서 70 % 에탄올과 원심 분리기와 펠렛을 씻으십시오. </li><li> 10 mm의 10 μ 리터에서 DNA를 재현 탁 트리스 -HCl pH 7.4의 </li><li> 260 nm에서 광학 밀도 (OD)를 측정하여 분광 광도계를 사용하여 DNA를 정량. </li><li> 바이러스 성 DNA를 증폭 뉴클레오티드 7273에서, 주요 늦은 전사 부 내의 영역의 증폭을 허용 프라이머 반응 부피의 25 μ 리터에서의 Taq DNA 폴리머 라제를 사용하여 표준 PCR 반응에서 각 subnuclear 분획으로부터 DNA 100 ng의를 사용하여 염기 7353 (81 BP) FW (: GAGCGAGGTGTGGGTGAGC;, 계 : GGATGCGACGACACTGACTTCA). 95 ºC에서 3 분의 초기 변성, 20 증폭 (95 ºC 72 ºC에서 30 초 62 ºC에서 1 분간 열처리 및 확장시 1 분)의 사이클에 대한 최종 확장 단계 다음에 다음주기 조건을 사용하여 72 ºC에서 3 분. </li><li> 티듐 90 V. 얼룩에, 2 % 아가 로스 젤에서 PCR 생성물을 실행할0.5 μ g / ml의 최종 농도 브롬화물과 RCF에서 바이러스 DNA 농축을 확증하기 위해 DNA를 시각화. 이 화합물은 강력한 돌연변이이기 때문에, 장갑을 착용해야합니다 항상 세심한주의와 에티 디움 브로마이드를 처리합니다. 제도적 지침에 따라 에티 디움 브로마이드를 폐기 할 것. </li></ol> RCF 5. 늦은 바이러스 mRNA를 검출 참고 : 두 NPL과 RCF 분수에서 RNA 분리를 들어, 단계 2.11에서 얻은 총 볼륨에서 RCF에 대한 고정 이하 여신에 대한 640 μ L 300 μ L를 사용합니다. <ol><li> 제조업체의 지침에 따라 트리 졸 사용 subnuclear 분수에서 RNA를 분리합니다. DEPC (diethilpyrocarbonate) 처리 된 물 50 μ L의 RNA를 재현 탁. </li><li> 260 nm에서 OD를 측정하는 분광 광도계를 사용하여 RNA를 정량화 (약 3 μ g를 얻을 수있다). 50 NG에서 RNA를 저장 / -70 ºC에서 L 씩을 μ. </li><li> 정제 된 RNA를 확인전체 RNA의 5 NG 단계 4.9에 기재된 사이클 조건을 이용하여, 역전사 효소 (RT)의 부재하에 제어 PCR 반응을 수행하여 DNA 오염의 부재에 대한. <ol><li> DNA 오염이 존재하지 않는 경우에는 증폭 물이 생성 될 수 없습니다. DNA 오염이 존재하면, 10 U의 RNase 억제제 10 U의 DNase I, 0.1 M 트리스 -HCl pH를 8.3, 0.5 M KCl을 37 ºC에서 30 분 동안 15 밀리미터의 MgCl 2 샘플을 배양. 단계 5.1에서와 같이 RNA를 다시 분리로 이동합니다. </li></ol></li><li> RCF 연관 바이러스의 mRNA를 분석하기 위해, 다른 유전자 군 (표 1)에서 아데노 바이러스 후기의 mRNA를 검출하기위한 프라이머를 사용하여 RT-PCR에 의해 각각 subnuclear 분획으로부터 100 ng의 RNA를 증폭한다. <ol><li> 역전사 (RT)에 대해, 42 ºC에서 1 시간, 70 ºC에서 10 분 동안 반응 부피의 20 μ 리터에 M-MuLV RT 효소를 이용하여 표준 RT 반응시 각 subnuclear 분획으로부터, RNA 100 NG를 사용한다. </li><li> 증폭, 1을 사용단계 4.9에서와 같이 PCR 반응에서 cDNA를 μ 리터. 증폭의 25주기 다음 95 ºC에서 3 분의 초기 변성 (95 ºC에서 1 분, 어닐링 72 ºC에서 30 초 동안 표 1 및 확장에 지정된 온도에서 1 분)와 다음주기 조건을 사용하여 72 ºC에서 3 분 최종 확장 단계. </li></ol></li><li> μ는 0.5 g / ml의 최종 농도에 티듐 브로마이드 90 V. 얼룩 겔에서 2 % 아가 로스 젤에서 RT-PCR 산물을 실행하고 RCF로 바이러스 늦은 mRNA의 연관을 확증하기 위해 시각화. 단계 4.10에 표시된대로 에티 디움 브로마이드를 처리합니다. </li></ol> RCF 6. 면역 형광 시각화 주 : 반출 절차를 층류 캐비닛 아래의 먼지 입자와 함께 샘플의 오염을 방지하고, 사용 전에 모든 솔루션을 필터링. <ol><li> 스팟 5 단계에서 얻어진 디레 2.10 RCF 분획을 L μctly 실란 코팅 슬라이드. </li><li> 실온에서 약 5 분 동안 자리를 건조 보자. </li><li> 다시 수화물 천천히 간접적으로 RCF 지점 옆에 드롭 PBS의 500 μ 리터를 피펫 팅하고 슬라이드를 기울여 흐름 시켜서. 측면에서 초과 PBS를 배출합니다. </li><li> RT에서 2 시간 동안 PBS / 5 % 소 혈청 알부민의 500 μ 리터 (BSA) 시료를 피복하여 블록. </li><li> 부드럽게 간접적 샘플에 PBS 500 μ L을 피펫 팅하여 슬라이드 3 회 반복한다. 초과 PBS를 배출 슬라이드를 기울. </li><li> 실온에서 2 시간 동안 PBS에 희석 500 : 1에서 바이러스 E2A의 DNA 결합 단백질 (B6-8 9)에 대한 일차 항체와 샘플을 품어. 항체 용액의 20 μ 리터와 발견 샘플을 커버하고 건조를 방지하기 위해 습한 챔버에서 배양한다. </li><li> 부드럽게 간접적 샘플에 PBS 500 μ L을 피펫 팅에 의해 PBS / 0.02 % 트윈 20 샘플을 3 회 반복한다. 전 오프 드레인 슬라이드를 기울운 세척 솔루션입니다. </li><li> 4 ºC에서 1 시간 동안, PBS에서 2,000 희석 : 1에서 488 nm에서 여기되는 형광체에 결합 된 마우스 항 IgG를 이차 항체로 샘플을 품어. 항체 용액의 20 μ 리터와 발견 샘플을 커버하고 건조를 방지하기 위해 습한 챔버에서 배양한다. </li><li> 부드럽게 간접적 샘플에 PBS 500 μ L을 피펫 팅에 의해 PBS / 0.02 % 트윈 20 샘플을 3 회 반복한다. 초과 세척 용액을 배출 슬라이드를 기울. </li><li> 중간 장착 2- μ L PBS / 10 % 글리세롤을 사용하여 커버 슬립으로 슬라이드 발견 샘플을 커버. 명확한 매니큐어 및 저장 등 -20 ºC와 인감. </li><li> 63X 대물 렌즈 및 488 nm의 파장에서 1.4 NA를 (NA)와, 형광 현미경을 이용하여 샘​​플을 분석한다. </li></ol>

<ol>
	<li>Doucas, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+replication+is+coupled+with+the+dynamic+properties+of+the+PML+nuclear+structure.">Adenovirus replication is coupled with the dynamic properties of the PML nuclear structure.</a> Genes &#38; Dev. 10, 196-207 (1996).</li><li>Schmid, M., Speiseder, T., Dobner, T., Gonzalez, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+virus+replication+compartments.">DNA virus replication compartments.</a> J. Virol. 88, 1404-1420 (2014).</li><li>Boon, J. A., Diaz, A., Ahlquist, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytoplasmic+viral+replication+complexes.">Cytoplasmic viral replication complexes.</a> Cell host microbe. 8, 77-85 (2010).</li><li>Paul, D., Hoppe, S., Saher, G., Krijnse-Locker, J., Bartenschlager, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphological+and+biochemical+characterization+of+the+membranous+hepatitis+C+virus+replication+compartment.">Morphological and biochemical characterization of the membranous hepatitis C virus replication compartment.</a> J. Virol. 87, 10612-10627 (2013).</li><li>Busch, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+Nucleoli.">Isolation of Nucleoli.</a> Exp Cell Res. 24, 150-163 (1963).</li><li>Lam, Y. W., Lyon, C. E., Lamond, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-scale+isolation+of+Cajal+bodies+from+HeLa+cells.">Large-scale isolation of Cajal bodies from HeLa cells.</a> Mol. Biol. Cell. 13, 2461-2473 (2002).</li><li>Lam, Y. W., Trinkle-Mulcahy, L., Lamond, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+nucleolus.">The nucleolus.</a> J Cell Sci. 118, 1335-1337 (2005).</li><li>Groitl, P., Dobner, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+adenovirus+type+5+early+region+1+and+4+virus+mutants.">Construction of adenovirus type 5 early region 1 and 4 virus mutants.</a> Methods Mol Med. 130, 29-39 (2007).</li><li>Reich, N. C., Sarnow, P., Duprey, E., Levine, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibodies+which+recognize+native+and+denatured+forms+of+the+adenovirus+DNA-binding+protein.">Monoclonal antibodies which recognize native and denatured forms of the adenovirus DNA-binding protein.</a> Virology. 128, 480-484 (1983).</li><li>Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+effects+on+adenovirus+late+gene+expression+of+deleting+the+E1b+55K+protein.">Selective effects on adenovirus late gene expression of deleting the E1b 55K protein.</a> J Gen Virol. 74 (Pt 4), 575-582 (1993).</li><li>Gonzalez, R., Huang, W., Finnen, R., Bragg, C., Flint, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+E1B+55-kilodalton+protein+is+required+for+both+regulation+of+mRNA+export+and+efficient+entry+into+the+late+phase+of+infection+in+normal+human+fibroblasts.">Adenovirus E1B 55-kilodalton protein is required for both regulation of mRNA export and efficient entry into the late phase of infection in normal human fibroblasts.</a> J. Virol. 80, 964-974 (2006).</li><li>Castillo-Villanueva, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Mre11+Cellular+Protein+Is+Modified+by+Conjugation+of+Both+SUMO-1+and+SUMO-2/3+during+Adenovirus+Infection.">The Mre11 Cellular Protein Is Modified by Conjugation of Both SUMO-1 and SUMO-2/3 during Adenovirus Infection.</a> ISRN Virology. 2014, 14 (2014).</li><li>Morris, S. J., Scott, G. E., Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+late-phase+infection+is+controlled+by+a+novel+L4+promoter.">Adenovirus late-phase infection is controlled by a novel L4 promoter.</a> J. Virol. 84, 7096-7104 (2010).</li><li>Wright, J., Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+human+adenovirus+5+L4+promoter+is+activated+by+cellular+stress+response+protein+p53.">The human adenovirus 5 L4 promoter is activated by cellular stress response protein p53.</a> J. Virol. 87, 11617-11625 (2013).</li></ol>

The authors have nothing to disclose.

In order to elucidate the molecular mechanisms that govern regulation of cellular activities by viral infection understanding the composition and activities associated with RC would be instrumental. Therefore, to make a detailed analysis of RC, we established a cell-free system that takes advantage of the size and biochemical composition of these virus-induced structures, to isolate subnuclear fractions enriched with RC using a simple procedure that relies on velocity gradients with sucrose cushions. Critical steps of th...

아데노 바이러스는 감염된 세포의 핵에서 복제하는 이중 가닥 DNA 게놈을 포함합니다. 바이러스의 DNA는 핵 진입하면 PML 핵 몸체 (1)에 인접하여 국소화. 바이러스 초기 유전자 발현 다음, 핵 구조는 과장 되나, 바이러스 성 미세 환경의 형성을 유도하는, 재구성 바이러스 복제 격실 (RC) 2. 아데노 바이러스 (AD) RC는 바이러스 게놈의 복제 및 바이러스 유전자의 발현 늦은이 일어나는 부위이기 때문에, 이들은 이러한 프로세스에 참여하는 모든 필요한 바이러스 및 세포 인자의 채용을위한 환경을 제공한다. 흥미롭게도, 이러한 DNA 손상 반응으로서 세포의 항 바이러스 반응을 담당 세포 단백질의 다양성은 선천성 면역 반응 및 종양 억제는 공동하기로 이들 바이러스 2 위치한다. 병용을 조절하면서 효율적인 바이러스 복제를 촉진 따라서, 광고 RC가 고려 될 수 규제 허브이러한 구조는 바이러스 숙주 세포 상호 작용의 이해에 중요한 것을 나타내는 응답 세포 바이러스. 그럼에도 불구하고, RC 형성의 분자 메커니즘은 그들의 조성과 연관된 활동을 제대로 이해된다. 핵에서 복제 다른 DNA 바이러스에서 아데노 바이러스 RC뿐만 아니라 RC는 세포질 RC 3 대조적으로, 막에 관련되지 않습니다. 또한, 이러한 바이러스 - 유도 구조 단백질 및 핵산의 전체 구성 될 가능성이 높다. RNA 바이러스에 감염된 세포에서 형성 RC는 상세한 형태 적, 기능적, 생화학 적 특성 (4)를 촉진했다 그들의 세포질 현지화 및 막 - 결합 상태, 활용, 고립 된 (일반적으로 바이러스 성 공장을 지칭). 우리의 지식에, 핵 바이러스 성 RC는 아마도 인해 핵내 M의 핵 구조와 부재의 복잡성, 격리되지 않은자신의 분리를 용이하게 할 embranes. 이들의 연구는 대신에 면역 형광 현미경, 생선, 투과 전자 현미경에 의존하고있다. 그러나 subnuclear 구조를 분리 고유의 합병증에도 불구하고, 이러한 핵소체와 Cajal 기관과 같은 다른 핵 도메인은 5,6 전에 격리되었다. 핵소체 및 RC는 모두 단백질 및 핵산으로 구성하고, 직경이 0.5이되기 때문에 - 5 ㎛, 우리는 RC 역시 의무가 분리되어야한다는 가설을 세웠다. 따라서,보다 정확하게 RC 연관된 분자 조성 및 기능을 특성화하기 위해, 우리는 RC subnuclear 풍부 분획을 분리하는 새로운 방법을 확립. 이를 위해 핵소체 7 또는 다른 핵 영역 (6)을 분리하기 위해 사용 된 절차와 유사한 속도 구배 및 수 크로스 쿠션을 사용하는 하위 핵 분획을 제조하고, 분자 조성물의 연구 및 연관된 활동을 가능하게하는 무 세포계를 설립RC. 이 기술은 따라서 바이러스 숙주 세포 상호 작용의 이해를 발전하고 또한 핵 복제 다른 바이러스로부터 RC의 상세한 분석을 용이하게하고 adenovirus- 형성과 동일한 치수의 복제 구획 형성을 유도한다 강력한 도구를 대표한다 예, 헤르페스 바이러스, 유두종 바이러스 또는 폴리오 마 감염된 세포.

<table><tbody><tr><td>DMEM</td><td>Gibco</td><td>12100-046</td><td>Warm in 37 &amp;ordm;C water bath before use</td></tr><tr><td>Fetal Bovine Serum</td><td>Gibco</td><td>12484-028</td><td></td></tr><tr><td>Sucrose, Ultra Pure</td><td>Research Organics</td><td>0928S</td><td>Prepare a 2.55 M stock solution and store at 4 &amp;ordm;C</td></tr><tr><td>Dounce homogenizer</td><td>Kontess Glass Company</td><td>884900-0000</td><td></td></tr><tr><td>Branson 1800 Ultrasonic Bath</td><td>Branson</td><td>Z769533&amp;nbsp;SIGMA</td><td>Turn on 15 min before use.</td></tr><tr><td>Goat anti-Mouse IgG1 Secondary Antibody, Alexa Fluor 488 conjugate</td><td>Life Technologies</td><td>A-21121</td><td>Use at a 1:2,000 dilution in PBS</td></tr><tr><td>Silane-Prep Slides</td><td>Sigma</td><td>S4651-72EA</td><td>Open in a laminar flow cabinet</td></tr><tr><td>SuperSignal West Pico Chemiluminescent Substrate</td><td>Pierce ThermoScientific</td><td>34080</td><td></td></tr></tbody></table>

isolation of viral replication compartment-enriched sub-nuclear fractions from adenovirus-infected normal human cells

During infection of human cells by adenovirus (Ad), the host cell nucleus is dramatically reorganized, leading to formation of nuclear microenvironments through the recruitment of viral and cellular proteins to sites occupied by the viral genome. These sites, called replication compartments (RC), can be considered viral-induced nuclear domains where the viral genome is localized and viral and cellular proteins that participate in replication, transcription and post-transcriptional processing are recruited. Moreover, cellular proteins involved in the antiviral response, such as tumor suppressor proteins, DNA damage response (DDR) components and innate immune response factors are also co-opted to RC. Although RC seem to play a crucial role to promote an efficient and productive replication cycle, a detailed analysis of their composition and associated activities has not been made. To facilitate the study of adenoviral RC and potentially those from other DNA viruses that replicate in the cell nucleus, we adapted a simple procedure based on velocity gradients to isolate Ad RC and established a cell-free system amenable to conduct morphological, functional and compositional studies of these virus-induced subnuclear structures, as well as to study their impact on host-cell interactions.

바이러스 복제 용 구획 (RC)는 단백질과 다른 핵 도메인 유사한 핵산 이루어지는 subnuclear 바이러스 - 유도 된 구조이기 때문에, 그들은 생화학 적 특징에 기초하여 속도 구배에 의해 분리 의무가 것을 알았다. 분별 프로토콜의 중요한 단계는 샘플이 다른 서브 세포 분획의 무결성을 보장하기 위해 명 시야 현미경으로 관찰 할 필요가 각 단계에서,도 1에 도시되어있다. 세포를 팽창 할 때...

Watch this Scientific Journal Video about Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells at JoVE.com

Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells

We provide a novel strategy to isolate viral replication compartments (RC) from adenovirus (Ad)-infected human cells. This approach represents a cell-free system that can help to elucidate the molecular mechanisms regulating viral genome replication and expression as well as regulation of viral-host interactions established at the RC.

아데노 바이러스에 감염된 정상적인 인간의 세포에서 바이러스 복제 구획 풍부한 하위 핵 분수의 분리

During infection of human cells by adenovirus (Ad), the host cell nucleus is dramatically reorganized, leading to formation of nuclear microenvironments ...

isolation-viral-replication-compartment-enriched-sub-nuclear

Research

JoVE Journal

Immunology and Infection

8.7K 조회수.  Universidad Autónoma del Estado de Morelos. We provide a novel strategy to isolate viral replication compartments (RC) from adenovirus (Ad)-infected human cells. This approach represents a cell-free system that can help to elucidate the molecular mechanisms regulating viral genome replication and expression as well as regulation of viral-host interactions established at the RC. 

비디오: Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells

Preparation of Viral DNA from Nucleocapsids

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. Several downstream applications require large quantities of pure viral DNA, which is provided by this protocol. These applications include viral genome sequencing, where the removal of host DNA is crucial to optimize data output for viral sequences, and the production of new viral recombinant strains, where co-transfection of purified plasmid and linear viral DNA facilitates recombination.1,2,3 
This procedure utilizes a combination of extractions and density-based centrifugation to isolate purified linear herpesvirus nucleocapsid DNA from infected cells.4,5 The initial purification steps aim to isolate purified viral capsids, which contain and protect the viral DNA during the extractions and centrifugation steps that remove cellular proteins and DNA. Lysis of nucleocapsids then releases viral DNA, and two final phenol-chloroform steps remove remaining proteins. The final DNA captured from solution is highly concentrated and pure, with an average OD260/280 of 1.90. Depending on the quantity of infected cells used, yields of viral DNA range from 150-800 &mu;g or more. The purity of this DNA makes it stable during long-term storage at 4C. This DNA is thus ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections. 
Prior to beginning the protocol, it is important to know the average number of cells per dish (e.g. an average of 8 x 106 PK-15 cells in a confluent 15 cm dish), and the titer of the viral stock to be used (e.g. 1 x 108 plaque-forming units per ml). These are necessary to calculate the appropriate multiplicity of infection (MOI) for the protocol.6 For instance, to infect one 15 cm dish of PK-15 cells with the above viral stock, at an MOI of 5, you would use 400 &mu;l of viral stock and dilute it with 3.6 ml of medium (total inoculation volume of 4 ml for one 15 cm plate).
Multiple viral DNA preparations can be prepared at the same time. The number of simultaneous preparations is limited only by the number of tubes held by the ultracentrifuge rotor (one per virus; see step 3.9 below). Here we describe the procedure as though being done for one virus.

We describe the process of isolating high purity herpesvirus nucleocapsid DNA from infected cells. The final DNA captured from solution is of high concentration and purity, making it ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections to produce new viral recombinants.

Nucleocapsids에서 바이러스성 DNA의 준비

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. ...

연구

면역학 및 감염병학

Efficient Recombinant Parvovirus Production with the Help of Adenovirus-derived Systems

Rodent parvoviruses (PV) such as rat H-1PV and MVM, are small icosahedral, single stranded, DNA viruses. Their genome includes two promoters P4 and P38 which regulate the expression of non-structural (NS1 and NS2) and capsid proteins (VP1 and VP2) respectively1. They attract high interest as anticancer agents for their oncolytic and oncosuppressive abilities while being non-pathogenic for humans2. NS1 is the major effector of viral cytotoxicity3. In order to further enhance their natural antineoplastic activities, derivatives from these vectors have been generated by replacing the gene encoding for the capsid proteins with a therapeutic transgene (e.g. a cytotoxic polypeptide, cytokine, chemokine, tumour suppressor gene etc.)4. The recombinant parvoviruses (recPVs) vector retains the NS1/2 coding sequences and the PV genome telomeres which are necessary for viral DNA amplification and packaging. Production of recPVs occurs only in the producer cells (generally HEK293T), by co-transfecting the cells with a second vector (pCMV-VP) expressing the gene encoding for the VP proteins (Fig. 1)4. The recPV vectors generated in this way are replication defective. Although recPVs proved to possess enhanced oncotoxic activities with respect to the parental viruses from which they have been generated, their production remains a major challenge and strongly hampers the use of these agents in anti-cancer clinical applications.
We found that introduction of an Ad-5 derived vector containing the E2a, E4(orf6) and the VA RNA genes (e.g. pXX6 plasmid) into HEK293T improved the production of recPVs by more than 10 fold in comparison to other protocols in use. Based on this finding, we have constructed a novel Ad-VP-helper that contains the genomic adenoviral elements necessary to enhance recPVs production as well as the parvovirus VP gene unit5. The use of Ad-VP-helper, allows production of rec-PVs using a protocol that relies entirely on viral infection steps (as opposed to plasmid transfection), making possible the use of cell lines that are difficult to transfect (e.g. NB324K) (Fig. 2). We present a method that greatly improves the amount of recombinant virus produced, reducing both the production time and costs, without affecting the quality of the final product5. In addition, large scale production of recPV (in suspension cells and bioreactors) is now conceivable.

Here we describe a protocol based only on cell infection, which improves the efficiency of recombinant parvovirus production by more than 100 fold in comparison to other protocols in use. This protocol relies on the use of a novel adenovirus 5-based helper containing the parvovirus VP transcription unit (Ad-VP).

아데노 바이러스 파생 시스템의 도움으로 효율적인 재조합 파르 보 바이러스 생산

Rodent parvoviruses (PV) such as rat H-1PV and MVM, are small icosahedral, single stranded, DNA viruses. Their genome includes two promoters P4 and P38 ...

Affinity Purification of Influenza Virus Ribonucleoprotein Complexes from the Chromatin of Infected Cells

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the single-stranded genome is encapsidated by the nucleoprotein (NP), and associated with the trimeric polymerase complex consisting of the PA, PB1, and PB2 subunits. However, in contrast to most RNA viruses, influenza viruses perform viral RNA synthesis in the nuclei of infected cells. Interestingly, viral mRNA synthesis uses cellular pre-mRNAs as primers, and it has been proposed that this process takes place on chromatin1. Interactions between the viral polymerase and the host RNA polymerase II, as well as between NP and host nucleosomes have also been characterized1,2.
Recently, the generation of recombinant influenza viruses encoding a One-Strep-Tag genetically fused to the C-terminus of the PB2 subunit of the viral polymerase (rWSN-PB2-Strep3) has been described. These recombinant viruses allow the purification of PB2-containing complexes, including vRNPs, from infected cells. To obtain purified vRNPs, cell cultures are infected, and vRNPs are affinity purified from lysates derived from these cells. However, the lysis procedures used to date have been based on one-step detergent lysis, which, despite the presence of a general nuclease, often extract chromatin-bound material only inefficiently. 
Our preliminary work suggested that a large portion of nuclear vRNPs were not extracted during traditional cell lysis, and therefore could not be affinity purified. To increase this extraction efficiency, and to separate chromatin-bound from non-chromatin-bound nuclear vRNPs, we adapted a step-wise subcellular extraction protocol to influenza virus-infected cells. Briefly, this procedure first separates the nuclei from the cell and then extracts soluble nuclear proteins (here termed the "nucleoplasmic" fraction). The remaining insoluble nuclear material is then digested with Benzonase, an unspecific DNA/RNA nuclease, followed by two salt extraction steps: first using 150 mM NaCl (termed "ch150"), then 500 mM NaCl ("ch500") (Fig. 1). These salt extraction steps were chosen based on our observation that 500 mM NaCl was sufficient to solubilize over 85% of nuclear vRNPs yet still allow binding of tagged vRNPs to the affinity matrix.
After subcellular fractionation of infected cells, it is possible to affinity purify PB2-tagged vRNPs from each individual fraction and analyze their protein and RNA components using Western Blot and primer extension, respectively. Recently, we utilized this method to discover that vRNP export complexes form during late points after infection on the chromatin fraction extracted with 500 mM NaCl (ch500)3.

Influenza viruses replicate their RNA genome in association with host-cell chromatin. Here, we present a method to purify intact viral ribonucleoprotein complexes from the chromatin of infected cells. Purified viral complexes can be analyzed by both Western blot and primer extension of protein and RNA content, respectively.

감염된 세포의 염색질에서 인플루엔자 바이러스 Ribonucleoprotein 컴플렉스의 동질 정제

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the ...

Purification and Visualization of Influenza A Viral Ribonucleoprotein Complexes

The influenza A viral genome consists of eight negative-sense, single stranded RNA molecules, individually packed with multiple copies of the influenza A nucleoprotein (NP) into viral ribonulceoprotein particles (vRNPs). The influenza vRNPs are enclosed within the viral envelope. During cell entry, however, these vRNP complexes are released into the cytoplasm, where they gain access to the host nuclear transport machinery. In order to study the nuclear import of influenza vRNPs and the replication of the influenza genome, it is useful to work with isolated vRNPs so that other components of the virus do not interfere with these processes. Here, we describe a procedure to purify these vRNPs from the influenza A virus. The procedure starts with the disruption of the influenza A virion with detergents in order to release the vRNP complexes from the enveloped virion. The vRNPs are then separated from the other components of the influenza A virion on a 33-70% discontinuous glycerol gradient by velocity sedimentation. The fractions obtained from the glycerol gradient are then analyzed on via SDS-PAGE after staining with Coomassie blue. The peak fractions containing NP are then pooled together and concentrated by centrifugation. After concentration, the integrity of the vRNPs is verified by visualization of the vRNPs by transmission electron microscopy after negative staining. The glycerol gradient purification is a modification of that from Kemler et al. (1994)1, and the negative staining has been performed by Wu et al. (2007).2

The genome of the influenza A virus consists of eight separate complexes of RNA and proteins, termed viral ribonucleoprotein complexes (vRNPs). This paper describes the glycerol gradient purification and transmission electron microscopy visualization of influenza A vRNPs.

인플루엔자 바이러스성 Ribonucleoprotein의 단지의 정화 및 시각화

The influenza A viral genome consists of eight negative-sense, single stranded RNA molecules, individually packed with multiple copies of the influenza A ...

생물학

Adenoviral Transduction of Naive CD4 T Cells to Study Treg Differentiation

Regulatory T cells (Tregs) are essential to provide immune tolerance to self as well as to certain foreign antigens. Tregs can be generated from naive CD4 T cells in vitro with TCR- and co-stimulation in the presence of TGF&beta; and IL-2. This bears enormous potential for future therapies, however, the molecules and signaling pathways that control differentiation are largely unknown.
Primary T cells can be manipulated through ectopic gene expression, but common methods fail to target the most important naive state of the T cell prior to primary antigen recognition. Here, we provide a protocol to express ectopic genes in naive CD4 T cells in vitro before inducing Treg differentiation. It applies transduction with the replication-deficient adenovirus and explains its generation and production. The adenovirus can take up large inserts (up to 7 kb) and can be equipped with promoters to achieve high and transient overexpression in T cells. It effectively transduces naive mouse T cells if they express a transgenic Coxsackie adenovirus receptor (CAR). Importantly, after infection the T cells remain naive (CD44low, CD62Lhigh) and resting (CD25-, CD69-) and can be activated and differentiated into Tregs similar to non-infected cells. Thus, this method enables manipulation of CD4 T cell differentiation from its very beginning. It ensures that ectopic gene expression is already in place when early signaling events of the initial TCR stimulation induces cellular changes that eventually lead into Treg differentiation.

Adenoviral gene transfer into naive CD4 T cells with transgenic expression of the Coxsackie adenovirus receptor enables the molecular analysis of regulatory T cell differentiation in vitro.

나이브 CD4의 아데노 바이러스 형질은 Treg의 분화를 연구하는 세포를 T

Regulatory T cells (Tregs) are essential to provide immune tolerance to self as well as to certain foreign antigens. Tregs can be generated from naive CD4 ...

Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging

Cardiac myocytes isolated from adult hearts are widely accepted as a model somewhere half way between embryonic and neonatal muscle cells on one side and a working heart on the other. Thus, cardiomyocytes serve as good models for cardiac cellular physiology and pathophysiology, for pharmaceutical investigations as well as for the exploration of transgenic animal models. Here we describe a method of isolating the cells from the heart. Furthermore we show how a genetic manipulation on cardiac myocytes can be performed without breeding a transgenic animal: This is the combination of long term culture (1 week) and adenoviral gene transfer. The latter one is described from the construction of the virus to the transduction of the cells. It can be used for the expression of genetically encoded biosensors (GEBs), fluorescent fusion proteins, but also for protein over expression and down regulation, e.g. using RNAi. Here we provide an example for the expression of a fusion protein staining a subcellular structure (Golgi). Such protein expression can be visualized by confocal imaging of z-stacks for a 3D-reconstruction of subcellular structures. The protocol comprises state-of-the-art in cell culture, molecular biology and biophysics and thus provides an approach for exploring new horizons in cellular cardiology.

Adult cardiac myocytes are primary cells that can be isolated from animal hearts and cultured for several days. Within this culture period adenoviral gene transfer can be used to express genetically encoded biosensors (GEBs) or fluorescent fusion proteins. Both approaches allow cellular investigations by means of confocal microscopy.

공촛점 이미징에 대한 분리 및 성인 심장 Myocytes의 유전자 조작

Cardiac myocytes isolated from adult hearts are widely accepted as a model somewhere half way between embryonic and neonatal muscle cells on one side and ...

An Efficient Method for Adenovirus Production

Adenoviral transduction has the advantage of a strong and transient induction of the expression of the gene of interest into a broad variety of cell types and organs. However, recombinant adenoviral technology is laborious, time-consuming, and expensive. Here, we present an improved protocol using the pAdEasy system to obtain purified adenoviral particles that can induce a strong green fluorescent protein (GFP) expression in transduced cells. The advantages of this improved method are faster preparation and decreased production cost compared to the original method developed by Bert Vogelstein. The main steps of the adenoviral technology are: (1) the recombination of pAdTrack-GFP with the pAdEasy-1 plasmid in BJ5183 bacteria; (2) the packaging of the adenoviral particles; (3) the amplification of the adenovirus in AD293 cells; (4) the purification of the adenoviral particles from cell lysate and culture medium; and (5) the viral titration and functional testing of the adenovirus. The improvements to the original method consist of (i) the recombination in BJ5183-containing pAdEasy-1 by chemical transformation of bacteria; (ii) the selection of recombinant clones by &#8220;negative&#8221; and &#8220;positive&#8221; PCR; (iii) the transfection of AD293 cells using the K2 transfection system for adenoviral packaging; (iv) the precipitation with ammonium sulfate of the viral particles released by AD293 cells in cell culture medium; and (v) the purification of the virus by one-step cesium chloride discontinuous gradient ultracentrifugation. A strong expression of the gene of interest (in this case, GFP) was obtained in different types of transduced cells (such as hepatocytes, endothelial cells) from various sources (human, bovine, murine). Adenoviral-mediated gene transfer represents one of the main tools for developing modern gene therapies.

Here, we present a protocol for adenovirus production using the pAdEasy system. The technology includes the recombination of the pAdTrack and pAdEasy-1 plasmids, the adenovirus packaging and amplification, the purification of the adenoviral particles from cell lysate and culture medium, the viral titration, and the functional testing of the adenovirus.

아데노바이러스 생산을 위한 효율적인 방법

Adenoviral transduction has the advantage of a strong and transient induction of the expression of the gene of interest into a broad variety of cell types ...

생체공학

Construction of Adenoviral Vectors using DNA Assembly Technology

Adenoviral vectors have been used as a gene transfer tool in gene therapy for more than three decades. Here, we introduce a protocol to construct an adenoviral vector by manipulating the genomic DNA of wild-type HAdV-7 by using a DNA assembly method. First, an infectious clone of HAdV-7, pKan-Ad7, was generated by fusing the viral genomic DNA with a PCR product from plasmid backbone, comprising of the kanamycin-resistant gene and the origin of replication (Kan-Ori), through DNA assembly. This was done by designing a pair of PCR primers, that contained ~25 nucleotides of the terminal sequence of HAdV-7 inverted terminal repeat (ITR) at the 5' end, a non-cutter restriction enzyme site for HAdV-7 genome in the middle, and a template-specific sequence for PCR priming at the 3' end. Second, an intermediate plasmid-based strategy was employed to replace the E3 region with transgene-expressing elements in the infectious clone to generate an adenoviral vector. Briefly, pKan-Ad7 was digested with dual-cutter restriction enzyme Hpa I, and the fragment containing the E3 region was ligated to another PCR product of plasmid backbone by Gibson assembly to construct an intermediate plasmid pKan-Ad7HpaI. For convenience, restriction-assembly was used to designate the plasmid cloning method of combined restriction digestion and assembly. Using restriction-assembly, the E3 genes in pKan-Ad7HpaI was replaced with a green fluorescent protein (GFP) expression cassette, and the modified E3 region was released from the intermediate plasmid and restored to the infectious clone to generate an adenoviral plasmid pKAd7-E3GFP. Finally, pKAd7-E3GFP was linearized by Pme I digestion and used to transfect HEK293 packaging cells to rescue recombinant HAdV-7 virus. To conclude, a DNA assembly-based strategy was introduced here for constructing adenoviral vectors in general laboratories of molecular biology without the need of specialized materials and instruments.

In this study, an infectious clone of human adenovirus type 7 (HAdV-7) was constructed, and an E3-deleted HAdV-7 vector system was established by modifying the infectious clone. This strategy used here can be generalized to make gene transfer vectors from other wild-type adenoviruses.

Adenoviral vectors have been used as a gene transfer tool in gene therapy for more than three decades. Here, we introduce a protocol to construct an ...

Single-Step Heparin Affinity Chromatography를 이용한 AAV 벡터 정제

Isolation of Adeno-Associated Viral Vectors Through a Single-Step and Semi-Automated Heparin Affinity Chromatography Protocol

Adeno-associated virus (AAV) has become an increasingly valuable vector for in vivo gene delivery and is currently undergoing human clinical trials. However, the commonly used methods to purify AAVs make use of cesium chloride or iodixanol density gradient ultracentrifugation. Despite their advantages, these methods are time-consuming, have limited scalability, and often result in vectors with low purity. To overcome these constraints, researchers are turning their attention to chromatography techniques. Here, we present an optimized heparin-based affinity chromatography protocol that serves as a universal capture step for the purification of AAVs.
This method relies on the intrinsic affinity of AAV serotype 2 (AAV2) for heparan sulfate proteoglycans. Specifically, the protocol entails the co-transfection of plasmids encoding the desired AAV capsid proteins with those of AAV2, yielding mosaic AAV vectors that combine the properties of both parental serotypes. Briefly, after the lysis of producer cells, a mixture containing AAV particles is directly purified following an optimized single-step heparin affinity chromatography protocol using a standard fast protein liquid chromatography (FPLC) system. Purified AAV particles are subsequently concentrated and subjected to comprehensive characterization in terms of purity and biological activity. This protocol offers a simplified and scalable approach that can be performed without the need for ultracentrifugation and gradients, yielding clean and high viral titers.

저자 스포트라이트: Adeno-Associated Viral Vectors의 생산 및 정제를 위한 개선된 방법

This manuscript describes a detailed protocol for the generation and purification of adeno-associated viral vectors using an optimized heparin-based affinity chromatography method. It presents a simple, scalable, and cost-effective approach, eliminating the need for ultracentrifugation. The resulting vectors exhibit high purity and biological activity, proving their value in preclinical studies.

단일 단계 및 반자동 Heparin Affinity Chromatography Protocol을 통한 Adeno-associated viral vectors 분리

Adeno-associated virus (AAV) has become an increasingly valuable vector for in vivo gene delivery and is currently undergoing human clinical trials. ...

아데노 바이러스에 감염된 정상적인 인간의 세포에서 바이러스 복제 구획 풍부한 하위 핵 분수의 분리

요약

더 많은 비디오 탐색

이 비디오의 챕터

Nucleocapsids에서 바이러스성 DNA의 준비

아데노 바이러스 파생 시스템의 도움으로 효율적인 재조합 파르 보 바이러스 생산

감염된 세포의 염색질에서 인플루엔자 바이러스 Ribonucleoprotein 컴플렉스의 동질 정제

인플루엔자 바이러스성 Ribonucleoprotein의 단지의 정화 및 시각화

나이브 CD4의 아데노 바이러스 형질은 Treg의 분화를 연구하는 세포를 T

공촛점 이미징에 대한 분리 및 성인 심장 Myocytes의 유전자 조작

아데노바이러스 생산을 위한 효율적인 방법

Construction of Adenoviral Vectors using DNA Assembly Technology

단일 단계 및 반자동 Heparin Affinity Chromatography Protocol을 통한 Adeno-associated viral vectors 분리

단일 단계 및 반자동 Heparin Affinity Chromatography Protocol을 통한 Adeno-associated viral vectors 분리