This work was supported by grants from CONACyT-SEP (SEP-2008-84582; CB-2011-01-168497) and Promep-SEP for R.A.G.; P.H. received a scholarship from CONACyT (447442).

1. HFF 세포 배양 및 광고 감염 <ol><li> 앞서 설명 된 바와 같이 8 HFF 세포에 형광 형성 유닛 (FFU)로서 HEK-293 세포의 단층에서 역가의 Ad5 WT 바이러스를 전파. </li><li> 가습 인큐베이터에서 DMEM / 10 % 태아 소 37 ºC에서 멸균 문화 100mm 요리 혈청 (FBS) 5 % CO 2 10ml에 인간의 포피 섬유 아세포 (HFF)을 성장. 네 16 평방 세트에서 세포를 계산하여 노이 바 우어 챔버를 이용하여 세포 수를 결정합니다. 용액 당 세포 수는 4-16 개의 정사각형 세트 세포 수의 평균을 산출하고 (10) (4)에 의해이 값을 곱함으로써 얻어진다. 스텝 130에 포함 된 각 시간 후 감염, 1 × 10 7 HFF 셀을 사용한다. </li><li> 모의 감염시킬가 형성 부 (30) 포커스의 방어에 접시 당 DMEM에서의 Ad5 1 ㎖를 사용하여 100mm 조직 배양 접시에서 아데노 바이러스 5 형 (의 Ad5) 야생형 (WT) (H5pg4100 8)로 HFF 세포를 감염, 또는 FFU 또는 셀 당. 아에 2 시간 동안 품어신중 요리마다 15 분간 흔들 umidified 37 ºC에서 세포 배양 인큐베이터 및 5 % CO 2, 셀 위에 바이러스 접종원 균일 분포를 보장한다. 이 시간 후, 배지를 제거하고, 추가 10 % FBS가 보충 된 신선한 DMEM 및 CO 2에서 37 º C 가습 세포 배양 인큐베이터에서 16, 24 또는 36 시간 동안 배양하고, 5 %. 2.1 단계로 진행합니다. </li></ol> 아데노 바이러스 RC이 함유 하위 핵 분수 2. 준비 <ol><li> 수확의 Ad5는 감염 또는 셀 스크래퍼와 모의에 감염된 HFF 세포와 멸균 원심 분리기 튜브에 세포를 수집합니다. 단계 1.2에서와 같이 세포 수를 결정합니다. 단계 1.3에 지정된 각 시간 후 감염 1 × 10 7 세포를 사용합니다. </li><li> 220 XG, 5 분 동안 4 ºC에서 세포를 원심 분리기. </li><li> 빙냉 PBS에서 세포 펠렛을 재현 탁 (137 mM의 염화나트륨, 2.7 mM의 KCl을을, 10 mM의 나트륨 2 HPO 4 및 1.8 mM의 KH 2 PO 4). 세척 세포 펠렛S 세척 당 빙냉 PBS 5 mL를 이용하여 3 회. 이를 위해, 원심 분리기 (220) XG, 5 분, 4 캔트 ºC에서 세포 상등액 (SN)을 폐기하고, 부드럽게 피펫 팅하여 세포 펠렛을 재현 탁. </li><li> 세포막을 파괴하기 위해, 700에서 세포 펠렛을 얼음 - 냉각 된 저장성 완충액 (L) (10 mM의 HEPES pH가 7.9, 10 mM의 KCl을 1.5 밀리미터의 MgCl 2, 0.5 mM의 DTT, 20 μ g / ㎖의 페닐 메틸 설 포닐 플루오 라이드 (PMSF)를 μ 재현 탁 10 μ g / ㎖ 소 췌장 트립신 저해제 10 μ는 g / ㎖ 펩 스타틴, 10 μ g / ml의 N 아세틸 L 로이 실 - L 로이 실 - L 포함한 시스테인, 세린, 트레오닌 및 아스파 틸 프로테아제 억제제의 혼합물 -argininal)과 세포를 3 시간 동안 얼음에 팽윤. </li><li> 를 Lyse 헐렁한 A 형 테플론와 유 봉, 호모 게 나이저를 사용하여 세포. 스트로크와 밝은 필드 현미경으로 매 20 스트로크는 모든 세포가 용해되었는지 확인하는 모니터 샘플 다운스 (80) 수행하지만, 핵 N 가지고손상 또는 파손 된 오티. </li><li> 300 XG, 5 분 동안 4 ºC에서 세포 파쇄 액을 원심 분리기. 원심 분리기 튜브 -20 ºC에서 세포질 분수로 SN을 저장합니다. </li><li> 솔루션 1 (S1)의 750 μ L (에 재현 탁, 핵에서 펠렛을 세포 파편을 제거하려면 0.25 M 자당, 10 밀리미터의 MgCl (10)를 포함하여 2 ~ 20 μ g / ㎖ PMSF, 시스테인, 세린의 혼합물 쓰 레오 닌과 아스파 틸 프로테아제 억제제 μ g / ㎖ 소 췌장 트립신 저해제 10 μ g / ㎖ 펩 스타틴, 10 μ g / ml의 N 아세틸 L 로이 실 - L 로이 실 - L-argininal)과 용액 (2)의 동일 부피를 통해 층 (S2) (0.35 M 수 크로스, 0.5 밀리미터의 MgCl 2, 20 μ g / ㎖의 PMSF, 시스테인, 세린, 10 μ g / ㎖ 소 췌장 트립신 저해제 10 μ g / ㎖ 펩 스타틴, 10 μ 포함 트레오닌 및 아스파 틸 프로테아제 억제제의 혼합물 g / ㎖의 아세틸 N-L-L 로이 실 - 로이 실 - L-argininal). 하기 Centr1400 XG, 5 분 4 ºC에서 ifuge. </li><li> 마이크로 피펫을 사용하여 SN을 폐기하십시오. 펠렛을 방해하지 마십시오. </li><li> S2 750 μ 리터에 고립 핵을 함유하는 펠렛을 재현 탁. </li><li> 아데노 RC (RCF) subnuclear 풍부 분획을 분리하기 위해, 5 분간 두 펄스를 이용하여, 초음파 욕 핵을 재현 탁하고, 초음파 처리, 또는 명 시야 현미경으로 관찰 된 바와 같이 모든 핵을 용해 될 때까지. C에서 4 ° 이하로 샘플을 유지하기 위해 필요에 따라 초음파 욕조에 얼음을 사용합니다. </li><li> 용액 3 (S3)에서 3,000 XG (0.88 M 수 크로스, 0.5 밀리미터의 MgCl 2) 원심 분리기, 10 분 동안 4 ºC 동량 위에 초음파 핵 층을 포함한다. -70 ºC에서 nucleoplasmic 비율 (NPL)과 1.5 ml의 상층 액을 저장합니다. -70 ºC에서 RCF와 S2의 700 μ L의 펠렛 및 저장을 재현 탁. </li></ol> RCF 3. 서양 얼룩의 분석 참고 : NPL과 RCF 분수 (S)의 웨스턴 블롯 분석을위한등은 제외 (640)는 고정 이하 여신에 대한 L 단계 2.11에서 얻은 총 볼륨에서 RCF 300 μ L를 μ. <ol><li> 5 분 95 ºC에서 15 μ 램 믈리 버퍼 2 배의 각 subnuclear 부분의 L (4 % SDS, 20 % 글리세롤, 10 % 2- 머 캅토 에탄올, 블루 0.004 % 브로 모 페놀, 0.125 M 트리스 염산의 pH 6.8)과 종기를 섞는다. 10 % 나트륨 도데 실 설페이트 - 폴리 아크릴 아미드 겔 전기 영동 (SDS-PAGE) 20 밀리 암페어 (mA)에서 1.5 시간 동안 겔 분리 단백질 변성에 샘플을 로딩. </li><li> 폴리 비닐 리덴 디 플루오 라이드 (PVDF) 막에 400mA에서 1.5 시간 동안 electroblotting에 의해 단백질을 전송합니다. </li><li> RT는 PBS에 3 % 탈지 분유를 사용에서 2 시간 동안 막을 차단합니다. </li><li> PBS / 0.3 % 탈지 분유 500 희석 : 1에서 바이러스 E2A의 DNA 결합 단백질 (B6-8 9)에 대한 일차 항체와 4 ºC에서 O / N을 품어. </li><li> 3 회 PBS로 세척 막 / 0.1 %의 10 분 트윈 20. </li><li> 마우스 항 IgG의 차와 멤브레인을 품어실온에서 2 시간 동안 PBS에서 10,000 희석 : tibody은 1에서 말 무 퍼 옥시 다제 (HRP)에 연결된다. </li><li> PBS로 막 3 회 반복 / 0.1 % 트윈 20을 10 분 동안. </li><li> 강화 된 화학 발광 및 X 선 필름을 사용하여 멤브레인을 개발한다. </li></ol> RCF 4. 바이러스 DNA 검출 참고 : 두 NPL과 RCF 분수의 DNA 분리를 들어, 단계 2.11에서 얻은 총 부피의 RCF에 대한 NPL 210 μ L 100 μ L를 사용합니다. <ol><li> 단백질 분해 효소 K의 1 ㎎ / ㎖ 및 0.5 % 트윈 20과 55 ºC에서 1 시간 동안 하위 핵 분수를 품어. </li><li> 95 ° C에서 10 분 동안 샘플을 배양하여 단백질 분해 효소 K 불 활성화. </li><li> 2 분 동안 실온에서 20,000 XG에서 샘플을 원심 분리기. </li><li> (SN)를 수집합니다. 4 ℃에서 3M 아세트산 나트륨 1/10 부피의 이소프로판올을 하나의 볼륨, O / N로 DNA를 침전. </li><li> 실온에서 10 분 동안 20,000 XG에서 원심 분리. </li><li> SN의 U 폐기마이크로 피펫을 노래. 20,000 XG, 5 분 동안 4 ° C에서 70 % 에탄올과 원심 분리기와 펠렛을 씻으십시오. </li><li> 10 mm의 10 μ 리터에서 DNA를 재현 탁 트리스 -HCl pH 7.4의 </li><li> 260 nm에서 광학 밀도 (OD)를 측정하여 분광 광도계를 사용하여 DNA를 정량. </li><li> 바이러스 성 DNA를 증폭 뉴클레오티드 7273에서, 주요 늦은 전사 부 내의 영역의 증폭을 허용 프라이머 반응 부피의 25 μ 리터에서의 Taq DNA 폴리머 라제를 사용하여 표준 PCR 반응에서 각 subnuclear 분획으로부터 DNA 100 ng의를 사용하여 염기 7353 (81 BP) FW (: GAGCGAGGTGTGGGTGAGC;, 계 : GGATGCGACGACACTGACTTCA). 95 ºC에서 3 분의 초기 변성, 20 증폭 (95 ºC 72 ºC에서 30 초 62 ºC에서 1 분간 열처리 및 확장시 1 분)의 사이클에 대한 최종 확장 단계 다음에 다음주기 조건을 사용하여 72 ºC에서 3 분. </li><li> 티듐 90 V. 얼룩에, 2 % 아가 로스 젤에서 PCR 생성물을 실행할0.5 μ g / ml의 최종 농도 브롬화물과 RCF에서 바이러스 DNA 농축을 확증하기 위해 DNA를 시각화. 이 화합물은 강력한 돌연변이이기 때문에, 장갑을 착용해야합니다 항상 세심한주의와 에티 디움 브로마이드를 처리합니다. 제도적 지침에 따라 에티 디움 브로마이드를 폐기 할 것. </li></ol> RCF 5. 늦은 바이러스 mRNA를 검출 참고 : 두 NPL과 RCF 분수에서 RNA 분리를 들어, 단계 2.11에서 얻은 총 볼륨에서 RCF에 대한 고정 이하 여신에 대한 640 μ L 300 μ L를 사용합니다. <ol><li> 제조업체의 지침에 따라 트리 졸 사용 subnuclear 분수에서 RNA를 분리합니다. DEPC (diethilpyrocarbonate) 처리 된 물 50 μ L의 RNA를 재현 탁. </li><li> 260 nm에서 OD를 측정하는 분광 광도계를 사용하여 RNA를 정량화 (약 3 μ g를 얻을 수있다). 50 NG에서 RNA를 저장 / -70 ºC에서 L 씩을 μ. </li><li> 정제 된 RNA를 확인전체 RNA의 5 NG 단계 4.9에 기재된 사이클 조건을 이용하여, 역전사 효소 (RT)의 부재하에 제어 PCR 반응을 수행하여 DNA 오염의 부재에 대한. <ol><li> DNA 오염이 존재하지 않는 경우에는 증폭 물이 생성 될 수 없습니다. DNA 오염이 존재하면, 10 U의 RNase 억제제 10 U의 DNase I, 0.1 M 트리스 -HCl pH를 8.3, 0.5 M KCl을 37 ºC에서 30 분 동안 15 밀리미터의 MgCl 2 샘플을 배양. 단계 5.1에서와 같이 RNA를 다시 분리로 이동합니다. </li></ol></li><li> RCF 연관 바이러스의 mRNA를 분석하기 위해, 다른 유전자 군 (표 1)에서 아데노 바이러스 후기의 mRNA를 검출하기위한 프라이머를 사용하여 RT-PCR에 의해 각각 subnuclear 분획으로부터 100 ng의 RNA를 증폭한다. <ol><li> 역전사 (RT)에 대해, 42 ºC에서 1 시간, 70 ºC에서 10 분 동안 반응 부피의 20 μ 리터에 M-MuLV RT 효소를 이용하여 표준 RT 반응시 각 subnuclear 분획으로부터, RNA 100 NG를 사용한다. </li><li> 증폭, 1을 사용단계 4.9에서와 같이 PCR 반응에서 cDNA를 μ 리터. 증폭의 25주기 다음 95 ºC에서 3 분의 초기 변성 (95 ºC에서 1 분, 어닐링 72 ºC에서 30 초 동안 표 1 및 확장에 지정된 온도에서 1 분)와 다음주기 조건을 사용하여 72 ºC에서 3 분 최종 확장 단계. </li></ol></li><li> μ는 0.5 g / ml의 최종 농도에 티듐 브로마이드 90 V. 얼룩 겔에서 2 % 아가 로스 젤에서 RT-PCR 산물을 실행하고 RCF로 바이러스 늦은 mRNA의 연관을 확증하기 위해 시각화. 단계 4.10에 표시된대로 에티 디움 브로마이드를 처리합니다. </li></ol> RCF 6. 면역 형광 시각화 주 : 반출 절차를 층류 캐비닛 아래의 먼지 입자와 함께 샘플의 오염을 방지하고, 사용 전에 모든 솔루션을 필터링. <ol><li> 스팟 5 단계에서 얻어진 디레 2.10 RCF 분획을 L μctly 실란 코팅 슬라이드. </li><li> 실온에서 약 5 분 동안 자리를 건조 보자. </li><li> 다시 수화물 천천히 간접적으로 RCF 지점 옆에 드롭 PBS의 500 μ 리터를 피펫 팅하고 슬라이드를 기울여 흐름 시켜서. 측면에서 초과 PBS를 배출합니다. </li><li> RT에서 2 시간 동안 PBS / 5 % 소 혈청 알부민의 500 μ 리터 (BSA) 시료를 피복하여 블록. </li><li> 부드럽게 간접적 샘플에 PBS 500 μ L을 피펫 팅하여 슬라이드 3 회 반복한다. 초과 PBS를 배출 슬라이드를 기울. </li><li> 실온에서 2 시간 동안 PBS에 희석 500 : 1에서 바이러스 E2A의 DNA 결합 단백질 (B6-8 9)에 대한 일차 항체와 샘플을 품어. 항체 용액의 20 μ 리터와 발견 샘플을 커버하고 건조를 방지하기 위해 습한 챔버에서 배양한다. </li><li> 부드럽게 간접적 샘플에 PBS 500 μ L을 피펫 팅에 의해 PBS / 0.02 % 트윈 20 샘플을 3 회 반복한다. 전 오프 드레인 슬라이드를 기울운 세척 솔루션입니다. </li><li> 4 ºC에서 1 시간 동안, PBS에서 2,000 희석 : 1에서 488 nm에서 여기되는 형광체에 결합 된 마우스 항 IgG를 이차 항체로 샘플을 품어. 항체 용액의 20 μ 리터와 발견 샘플을 커버하고 건조를 방지하기 위해 습한 챔버에서 배양한다. </li><li> 부드럽게 간접적 샘플에 PBS 500 μ L을 피펫 팅에 의해 PBS / 0.02 % 트윈 20 샘플을 3 회 반복한다. 초과 세척 용액을 배출 슬라이드를 기울. </li><li> 중간 장착 2- μ L PBS / 10 % 글리세롤을 사용하여 커버 슬립으로 슬라이드 발견 샘플을 커버. 명확한 매니큐어 및 저장 등 -20 ºC와 인감. </li><li> 63X 대물 렌즈 및 488 nm의 파장에서 1.4 NA를 (NA)와, 형광 현미경을 이용하여 샘​​플을 분석한다. </li></ol>

<ol>
	<li>Doucas, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+replication+is+coupled+with+the+dynamic+properties+of+the+PML+nuclear+structure.">Adenovirus replication is coupled with the dynamic properties of the PML nuclear structure.</a> Genes &#38; Dev. 10, 196-207 (1996).</li><li>Schmid, M., Speiseder, T., Dobner, T., Gonzalez, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+virus+replication+compartments.">DNA virus replication compartments.</a> J. Virol. 88, 1404-1420 (2014).</li><li>Boon, J. A., Diaz, A., Ahlquist, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytoplasmic+viral+replication+complexes.">Cytoplasmic viral replication complexes.</a> Cell host microbe. 8, 77-85 (2010).</li><li>Paul, D., Hoppe, S., Saher, G., Krijnse-Locker, J., Bartenschlager, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphological+and+biochemical+characterization+of+the+membranous+hepatitis+C+virus+replication+compartment.">Morphological and biochemical characterization of the membranous hepatitis C virus replication compartment.</a> J. Virol. 87, 10612-10627 (2013).</li><li>Busch, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+Nucleoli.">Isolation of Nucleoli.</a> Exp Cell Res. 24, 150-163 (1963).</li><li>Lam, Y. W., Lyon, C. E., Lamond, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-scale+isolation+of+Cajal+bodies+from+HeLa+cells.">Large-scale isolation of Cajal bodies from HeLa cells.</a> Mol. Biol. Cell. 13, 2461-2473 (2002).</li><li>Lam, Y. W., Trinkle-Mulcahy, L., Lamond, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+nucleolus.">The nucleolus.</a> J Cell Sci. 118, 1335-1337 (2005).</li><li>Groitl, P., Dobner, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+adenovirus+type+5+early+region+1+and+4+virus+mutants.">Construction of adenovirus type 5 early region 1 and 4 virus mutants.</a> Methods Mol Med. 130, 29-39 (2007).</li><li>Reich, N. C., Sarnow, P., Duprey, E., Levine, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibodies+which+recognize+native+and+denatured+forms+of+the+adenovirus+DNA-binding+protein.">Monoclonal antibodies which recognize native and denatured forms of the adenovirus DNA-binding protein.</a> Virology. 128, 480-484 (1983).</li><li>Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+effects+on+adenovirus+late+gene+expression+of+deleting+the+E1b+55K+protein.">Selective effects on adenovirus late gene expression of deleting the E1b 55K protein.</a> J Gen Virol. 74 (Pt 4), 575-582 (1993).</li><li>Gonzalez, R., Huang, W., Finnen, R., Bragg, C., Flint, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+E1B+55-kilodalton+protein+is+required+for+both+regulation+of+mRNA+export+and+efficient+entry+into+the+late+phase+of+infection+in+normal+human+fibroblasts.">Adenovirus E1B 55-kilodalton protein is required for both regulation of mRNA export and efficient entry into the late phase of infection in normal human fibroblasts.</a> J. Virol. 80, 964-974 (2006).</li><li>Castillo-Villanueva, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Mre11+Cellular+Protein+Is+Modified+by+Conjugation+of+Both+SUMO-1+and+SUMO-2/3+during+Adenovirus+Infection.">The Mre11 Cellular Protein Is Modified by Conjugation of Both SUMO-1 and SUMO-2/3 during Adenovirus Infection.</a> ISRN Virology. 2014, 14 (2014).</li><li>Morris, S. J., Scott, G. E., Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+late-phase+infection+is+controlled+by+a+novel+L4+promoter.">Adenovirus late-phase infection is controlled by a novel L4 promoter.</a> J. Virol. 84, 7096-7104 (2010).</li><li>Wright, J., Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+human+adenovirus+5+L4+promoter+is+activated+by+cellular+stress+response+protein+p53.">The human adenovirus 5 L4 promoter is activated by cellular stress response protein p53.</a> J. Virol. 87, 11617-11625 (2013).</li></ol>

The authors have nothing to disclose.

In order to elucidate the molecular mechanisms that govern regulation of cellular activities by viral infection understanding the composition and activities associated with RC would be instrumental. Therefore, to make a detailed analysis of RC, we established a cell-free system that takes advantage of the size and biochemical composition of these virus-induced structures, to isolate subnuclear fractions enriched with RC using a simple procedure that relies on velocity gradients with sucrose cushions. Critical steps of th...

아데노 바이러스는 감염된 세포의 핵에서 복제하는 이중 가닥 DNA 게놈을 포함합니다. 바이러스의 DNA는 핵 진입하면 PML 핵 몸체 (1)에 인접하여 국소화. 바이러스 초기 유전자 발현 다음, 핵 구조는 과장 되나, 바이러스 성 미세 환경의 형성을 유도하는, 재구성 바이러스 복제 격실 (RC) 2. 아데노 바이러스 (AD) RC는 바이러스 게놈의 복제 및 바이러스 유전자의 발현 늦은이 일어나는 부위이기 때문에, 이들은 이러한 프로세스에 참여하는 모든 필요한 바이러스 및 세포 인자의 채용을위한 환경을 제공한다. 흥미롭게도, 이러한 DNA 손상 반응으로서 세포의 항 바이러스 반응을 담당 세포 단백질의 다양성은 선천성 면역 반응 및 종양 억제는 공동하기로 이들 바이러스 2 위치한다. 병용을 조절하면서 효율적인 바이러스 복제를 촉진 따라서, 광고 RC가 고려 될 수 규제 허브이러한 구조는 바이러스 숙주 세포 상호 작용의 이해에 중요한 것을 나타내는 응답 세포 바이러스. 그럼에도 불구하고, RC 형성의 분자 메커니즘은 그들의 조성과 연관된 활동을 제대로 이해된다. 핵에서 복제 다른 DNA 바이러스에서 아데노 바이러스 RC뿐만 아니라 RC는 세포질 RC 3 대조적으로, 막에 관련되지 않습니다. 또한, 이러한 바이러스 - 유도 구조 단백질 및 핵산의 전체 구성 될 가능성이 높다. RNA 바이러스에 감염된 세포에서 형성 RC는 상세한 형태 적, 기능적, 생화학 적 특성 (4)를 촉진했다 그들의 세포질 현지화 및 막 - 결합 상태, 활용, 고립 된 (일반적으로 바이러스 성 공장을 지칭). 우리의 지식에, 핵 바이러스 성 RC는 아마도 인해 핵내 M의 핵 구조와 부재의 복잡성, 격리되지 않은자신의 분리를 용이하게 할 embranes. 이들의 연구는 대신에 면역 형광 현미경, 생선, 투과 전자 현미경에 의존하고있다. 그러나 subnuclear 구조를 분리 고유의 합병증에도 불구하고, 이러한 핵소체와 Cajal 기관과 같은 다른 핵 도메인은 5,6 전에 격리되었다. 핵소체 및 RC는 모두 단백질 및 핵산으로 구성하고, 직경이 0.5이되기 때문에 - 5 ㎛, 우리는 RC 역시 의무가 분리되어야한다는 가설을 세웠다. 따라서,보다 정확하게 RC 연관된 분자 조성 및 기능을 특성화하기 위해, 우리는 RC subnuclear 풍부 분획을 분리하는 새로운 방법을 확립. 이를 위해 핵소체 7 또는 다른 핵 영역 (6)을 분리하기 위해 사용 된 절차와 유사한 속도 구배 및 수 크로스 쿠션을 사용하는 하위 핵 분획을 제조하고, 분자 조성물의 연구 및 연관된 활동을 가능하게하는 무 세포계를 설립RC. 이 기술은 따라서 바이러스 숙주 세포 상호 작용의 이해를 발전하고 또한 핵 복제 다른 바이러스로부터 RC의 상세한 분석을 용이하게하고 adenovirus- 형성과 동일한 치수의 복제 구획 형성을 유도한다 강력한 도구를 대표한다 예, 헤르페스 바이러스, 유두종 바이러스 또는 폴리오 마 감염된 세포.

<table border="0">
	<tbody>
		<tr>
			<td>DMEM</td>
			<td>Gibco</td>
			<td>12100-046</td>
			<td>Warm in 37 &#186;C water bath before use</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>Gibco</td>
			<td>12484-028</td>
			<td></td>
		</tr>
		<tr>
			<td>Sucrose, Ultra Pure</td>
			<td>Research Organics</td>
			<td>0928S</td>
			<td>Prepare a 2.55 M stock solution and store at 4 &#186;C</td>
		</tr>
		<tr>
			<td>Dounce homogenizer</td>
			<td>Kontess Glass Company</td>
			<td>884900-0000</td>
			<td></td>
		</tr>
		<tr>
			<td>Branson 1800 Ultrasonic Bath</td>
			<td>Branson</td>
			<td>Z769533&#160;SIGMA</td>
			<td>Turn on 15 min before use.</td>
		</tr>
		<tr>
			<td>Peroxidase AffiniPure F(ab&#39;)&#8322; Fragment Goat Anti-Mouse IgG (H+L)</td>
			<td>Jackson ImmunoResearch</td>
			<td>115-036-003</td>
			<td>Use at a 1:10,000 dilution in PBS/0.03% non-fat milk</td>
		</tr>
		<tr>
			<td>Goat anti-Mouse IgG1 Secondary Antibody, Alexa Fluor 488 conjugate</td>
			<td>Life Technologies</td>
			<td>A-21121</td>
			<td>Use at a 1:2,000 dilution in PBS</td>
		</tr>
		<tr>
			<td>Silane-Prep Slides</td>
			<td>Sigma</td>
			<td>S4651-72EA</td>
			<td>Open in a laminar flow cabinet</td>
		</tr>
		<tr>
			<td>SuperSignal West Pico Chemiluminescent Substrate</td>
			<td>Pierce ThermoScientific</td>
			<td>34080</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolation of viral replication compartment-enriched sub-nuclear fractions from adenovirus-infected normal human cells

During infection of human cells by adenovirus (Ad), the host cell nucleus is dramatically reorganized, leading to formation of nuclear microenvironments through the recruitment of viral and cellular proteins to sites occupied by the viral genome. These sites, called replication compartments (RC), can be considered viral-induced nuclear domains where the viral genome is localized and viral and cellular proteins that participate in replication, transcription and post-transcriptional processing are recruited. Moreover, cellular proteins involved in the antiviral response, such as tumor suppressor proteins, DNA damage response (DDR) components and innate immune response factors are also co-opted to RC. Although RC seem to play a crucial role to promote an efficient and productive replication cycle, a detailed analysis of their composition and associated activities has not been made. To facilitate the study of adenoviral RC and potentially those from other DNA viruses that replicate in the cell nucleus, we adapted a simple procedure based on velocity gradients to isolate Ad RC and established a cell-free system amenable to conduct morphological, functional and compositional studies of these virus-induced subnuclear structures, as well as to study their impact on host-cell interactions.

바이러스 복제 용 구획 (RC)는 단백질과 다른 핵 도메인 유사한 핵산 이루어지는 subnuclear 바이러스 - 유도 된 구조이기 때문에, 그들은 생화학 적 특징에 기초하여 속도 구배에 의해 분리 의무가 것을 알았다. 분별 프로토콜의 중요한 단계는 샘플이 다른 서브 세포 분획의 무결성을 보장하기 위해 명 시야 현미경으로 관찰 할 필요가 각 단계에서,도 1에 도시되어있다. 세포를 팽창 할 때...

Watch this Scientific Journal Video about Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells at JoVE.com

Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells

We provide a novel strategy to isolate viral replication compartments (RC) from adenovirus (Ad)-infected human cells. This approach represents a cell-free system that can help to elucidate the molecular mechanisms regulating viral genome replication and expression as well as regulation of viral-host interactions established at the RC.

아데노 바이러스에 감염된 정상적인 인간의 세포에서 바이러스 복제 구획 풍부한 하위 핵 분수의 분리

During infection of human cells by adenovirus (Ad), the host cell nucleus is dramatically reorganized, leading to formation of nuclear microenvironments ...

isolation-viral-replication-compartment-enriched-sub-nuclear

Research

JoVE Journal

Immunology and Infection

8.7K 조회수.  Universidad Autónoma del Estado de Morelos. We provide a novel strategy to isolate viral replication compartments (RC) from adenovirus (Ad)-infected human cells. This approach represents a cell-free system that can help to elucidate the molecular mechanisms regulating viral genome replication and expression as well as regulation of viral-host interactions established at the RC. 

비디오: Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells

Isolation of Fidelity Variants of RNA Viruses and Characterization of Virus Mutation Frequency

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the generation of extreme population diversity that facilitates virus adaptation and evolution. Increasing evidence shows that the intrinsic error rates, and the resulting mutation frequencies, of RNA viruses can be modulated by subtle amino acid changes to the viral polymerase. Although biochemical assays exist for some viral RNA polymerases that permit quantitative measure of incorporation fidelity, here we describe a simple method of measuring mutation frequencies of RNA viruses that has proven to be as accurate as biochemical approaches in identifying fidelity altering mutations. The approach uses conventional virological and sequencing techniques that can be performed in most biology laboratories. Based on our experience with a number of different viruses, we have identified the key steps that must be optimized to increase the likelihood of isolating fidelity variants and generating data of statistical significance. The isolation and characterization of fidelity altering mutations can provide new insights into polymerase structure and function1-3. Furthermore, these fidelity variants can be useful tools in characterizing mechanisms of virus adaptation and evolution4-7.

The present article describes the steps required to isolate and characterize RNA polymerase fidelity variants of RNA viruses and how to use mutation frequency data to confirm fidelity changes in tissue culture.

바이러스 변이 주파수의 RNA 바이러스 및 특성화의 피델리티 변종의 분리

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the ...

연구

면역학 및 감염병학

Preparation of Viral DNA from Nucleocapsids

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. Several downstream applications require large quantities of pure viral DNA, which is provided by this protocol. These applications include viral genome sequencing, where the removal of host DNA is crucial to optimize data output for viral sequences, and the production of new viral recombinant strains, where co-transfection of purified plasmid and linear viral DNA facilitates recombination.1,2,3 
This procedure utilizes a combination of extractions and density-based centrifugation to isolate purified linear herpesvirus nucleocapsid DNA from infected cells.4,5 The initial purification steps aim to isolate purified viral capsids, which contain and protect the viral DNA during the extractions and centrifugation steps that remove cellular proteins and DNA. Lysis of nucleocapsids then releases viral DNA, and two final phenol-chloroform steps remove remaining proteins. The final DNA captured from solution is highly concentrated and pure, with an average OD260/280 of 1.90. Depending on the quantity of infected cells used, yields of viral DNA range from 150-800 &mu;g or more. The purity of this DNA makes it stable during long-term storage at 4C. This DNA is thus ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections. 
Prior to beginning the protocol, it is important to know the average number of cells per dish (e.g. an average of 8 x 106 PK-15 cells in a confluent 15 cm dish), and the titer of the viral stock to be used (e.g. 1 x 108 plaque-forming units per ml). These are necessary to calculate the appropriate multiplicity of infection (MOI) for the protocol.6 For instance, to infect one 15 cm dish of PK-15 cells with the above viral stock, at an MOI of 5, you would use 400 &mu;l of viral stock and dilute it with 3.6 ml of medium (total inoculation volume of 4 ml for one 15 cm plate).
Multiple viral DNA preparations can be prepared at the same time. The number of simultaneous preparations is limited only by the number of tubes held by the ultracentrifuge rotor (one per virus; see step 3.9 below). Here we describe the procedure as though being done for one virus.

We describe the process of isolating high purity herpesvirus nucleocapsid DNA from infected cells. The final DNA captured from solution is of high concentration and purity, making it ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections to produce new viral recombinants.

Nucleocapsids에서 바이러스성 DNA의 준비

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The apical and basolateral surfaces of airway epithelial cells demonstrate directional responses to pathogen exposure in vivo. Thus, ideal in vitro models for examining cellular responses to respiratory pathogens polarize, forming apical and basolateral surfaces. One such model is differentiated normal human bronchial epithelial cells (NHBE). However, this system requires lung tissue samples, expertise isolating and culturing epithelial cells from tissue, and time to generate an air-liquid interface culture.
Calu-3 cells, derived from a human bronchial adenocarcinoma, are an alternative model for examining the response of proximal airway epithelial cells to respiratory insult1, pharmacological compounds2-6, and bacterial7-9 and viral pathogens, including influenza virus, rhinovirus and severe acute respiratory syndrome - associated coronavirus10-14. Recently, we demonstrated that Calu-3 cells are susceptible to respiratory syncytial virus (RSV) infection in a manner consistent with NHBE15,16 . Here, we detail the establishment of a polarized, liquid-covered culture (LCC) of Calu-3 cells, focusing on the technical details of growing and culturing Calu-3 cells, maintaining cells that have been cultured into LCC, and we present the method for performing respiratory virus infection of polarized Calu-3 cells.
To consistently obtain polarized Calu-3 LCC, Calu-3 cells must be carefully subcultured before culturing in Transwell inserts. Calu-3 monolayer cultures should remain below 90% confluence, should be subcultured fewer than 10 times from frozen stock, and should regularly be supplied with fresh medium. Once cultured in Transwells, Calu-3 LCC must be handled with care. Irregular media changes and mechanical or physical disruption of the cell layers or plates negatively impact polarization for several hours or days. Polarization is monitored by evaluating trans-epithelial electrical resistance (TEER) and is verified by evaluating the passive equilibration of sodium fluorescein between the apical and basolateral compartments17,18 . Once TEER plateaus at or above 1,000 &Omega;&times;cm2, Calu-3 LCC are ready to use to examine cellular responses to respiratory pathogens.

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.

양극화 인간기도 액체 덮인 문화를 구축 호흡기 병원균에 대한 숙주 세포 응답을 공부하는 상피 Calu-3 전지<em&gt; 체외에서</em

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Isolation of Myeloid Dendritic Cells and Epithelial Cells from Human Thymus

In this protocol we provide a method to isolate dendritic cells (DC) and epithelial cells (TEC) from the human thymus. DC and TEC are the major antigen presenting cell (APC) types found in a normal thymus and it is well established that they play distinct roles during thymic selection. These cells are localized in distinct microenvironments in the thymus and each APC type makes up only a minor population of cells. To further understand the biology of these cell types, characterization of these cell populations is highly desirable but due to their low frequency, isolation of any of these cell types requires an efficient and reproducible procedure. This protocol details a method to obtain cells suitable for characterization of diverse cellular properties. Thymic tissue is mechanically disrupted and after different steps of enzymatic digestion, the resulting cell suspension is enriched using a Percoll density centrifugation step. For isolation of myeloid DC (CD11c+), cells from the low-density fraction (LDF) are immunoselected by magnetic cell sorting. Enrichment of TEC populations (mTEC, cTEC) is achieved by depletion of hematopoietic (CD45hi) cells from the low-density Percoll cell fraction allowing their subsequent isolation via fluorescence activated cell sorting (FACS) using specific cell markers. The isolated cells can be used for different downstream applications.

This protocol details a method to isolate antigen presenting cells from human thymus via different steps of enzymatic digestion of the tissue followed by density centrifugation of the single cell suspension and finally magnetic and/or FACS sorting of the cell populations of interest.

인간의 흉선에서 골수 수지상 세포와 상피 세포의 분리

In this protocol we provide a method to isolate dendritic cells (DC) and epithelial cells (TEC) from the human thymus. DC and TEC are the major antigen ...

Averaging of Viral Envelope Glycoprotein Spikes from Electron Cryotomography Reconstructions using Jsubtomo

Enveloped viruses utilize membrane glycoproteins on their surface to mediate entry into host cells. Three-dimensional structural analysis of these glycoprotein &#8216;spikes&#8217; is often technically challenging but important for understanding viral pathogenesis and in drug design. Here, a protocol is presented for viral spike structure determination through computational averaging of electron cryo-tomography data. Electron cryo-tomography is a technique in electron microscopy used to derive three-dimensional tomographic volume reconstructions, or tomograms, of pleomorphic biological specimens such as membrane viruses in a near-native, frozen-hydrated state. These tomograms reveal structures of interest in three dimensions, albeit at low resolution. Computational averaging of sub-volumes, or sub-tomograms, is necessary to obtain higher resolution detail of repeating structural motifs, such as viral glycoprotein spikes. A detailed computational approach for aligning and averaging sub-tomograms using the Jsubtomo software package is outlined. This approach enables visualization of the structure of viral glycoprotein spikes to a resolution in the range of 20-40 &#197; and study of the study of higher order spike-to-spike interactions on the virion membrane. Typical results are presented for Bunyamwera virus, an enveloped virus from the family Bunyaviridae. This family is a structurally diverse group of pathogens posing a threat to human and animal health.

An approach is presented for determining structures of viral membrane glycoprotein complexes using a combination of electron cryo-tomography and sub-tomogram averaging with the computational package Jsubtomo.

Jsubtomo을 사용하여 전자 Cryotomography 재건에서 바이러스 성 봉투 ​​당 단백질 스파이크의 평균화

Enveloped viruses utilize membrane glycoproteins on their surface to mediate entry into host cells. Three-dimensional structural analysis of these ...

Isolation of Leukocytes from the Human Maternal-fetal Interface

Pregnancy is characterized by the infiltration of leukocytes in the reproductive tissues and at the maternal-fetal interface (decidua basalis and decidua parietalis). This interface is the anatomical site of contact between maternal and fetal tissues; therefore, it is an immunological site of action during pregnancy. Infiltrating leukocytes at the maternal-fetal interface play a central role in implantation, pregnancy maintenance, and timing of delivery. Therefore, phenotypic and functional characterizations of these leukocytes will provide insight into the mechanisms that lead to&#160;pregnancy disorders. Several protocols have been described in order to isolate infiltrating leukocytes from the decidua basalis and decidua parietalis; however, the lack of consistency in the reagents, enzymes, and times of incubation makes it difficult to compare these results. Described herein is&#160;a novel approach that combines the use of gentle mechanical and enzymatic dissociation techniques to preserve the viability and integrity of extracellular and intracellular markers in leukocytes isolated from the human tissues at the maternal-fetal interface. Aside from immunophenotyping, cell culture, and cell sorting, the future applications of this protocol are numerous and varied. Following this protocol, the isolated leukocytes can be used to determine DNA methylation, expression of target genes, in vitro leukocyte functionality (i.e., phagocytosis, cytotoxicity, T-cell proliferation, and plasticity, etc.), and the production of reactive oxygen species at the maternal-fetal interface. Additionally, using the described protocol, this laboratory has been able to describe new and rare leukocytes at the maternal-fetal interface.

Described herein is a protocol to isolate and further study the infiltrating leukocytes of the decidua basalis and decidua parietalis - the human maternal-fetal interface. This protocol maintains the integrity of cell surface markers and yields enough viable cells for downstream applications as proven by flow cytometry analysis.

인간의 산모 - 태아 인터페이스에서 백혈구의 분리

Pregnancy is characterized by the infiltration of leukocytes in the reproductive tissues and at the maternal-fetal interface (decidua basalis and decidua ...

Isolation of Sertoli Cells and Peritubular Cells from Rat Testes

The testis, and in particular the male gamete, challenges the immune system in a unique way because differentiated sperm first appear at the time of puberty - more than ten years after the establishment of systemic immune tolerance. Spermatogenic cells express a number of proteins that may be seen as non-self by the immune system. The testis must then be able to establish tolerance to these neo-antigens on the one hand but still be able to protect itself from infections and tumor development on the other hand. Therefore the testis is one of a few immune privileged sites in the body that tolerate foreign antigens without evoking a detrimental inflammatory immune response. Sertoli cells play a key role for the maintenance of this immune privileged environment of the testis and also prolong survival of cotransplanted cells in a foreign environment. Therefore primary Sertoli cells are an important tool for studying the immune privilege of the testis that cannot be easily replaced by established cell lines or other cellular models. Here we present a detailed and comprehensive protocol for the isolation of Sertoli cells - and peritubular cells if desired - from rat testes within a single day.

Primary Sertoli cells are required for studying testis-immune privilege, signal transduction during inflammation or infection, and utilization of their immunoprotective properties. Here we describe an enzyme-based protocol for the isolation of highly purified primary Sertoli cells and peritubular cells from rat testes.

쥐 고환의 세르 톨리 (Sertoli) 세포의 분리 및 세뇨관 세포

The testis, and in particular the male gamete, challenges the immune system in a unique way because differentiated sperm first appear at the time of ...

Swab Sampling Method for the Detection of Human Norovirus on Surfaces

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the person-to-person route or indirectly through environmental surfaces or food, contaminated fomites and inanimate surfaces are important vehicles for the spread of the virus during norovirus outbreaks.
We developed and evaluated a protocol using macrofoam swabs for the detection and typing of human noroviruses from hard surfaces. Compared with fiber-tipped swabs or antistatic wipes, macrofoam swabs allow virus recovery (range 1.2-33.6%) from toilet seat surfaces of up to 700 cm2. The protocol includes steps for the extraction of the virus from the swabs and further concentration of the viral RNA using spin columns. In total, 127 (58.5%) of 217 swab samples that had been collected from surfaces in cruise ships and long-term care facilities where norovirus gastroenteritis had been reported tested positive for GII norovirus by RT-qPCR. Of these 29 (22.8%) could be successfully genotyped. In conclusion, detection of norovirus on environmental surfaces using the protocol we developed may assist in determining the level of environmental contamination during outbreaks as well as detection of virus when clinical samples are not available; it may also facilitate monitoring of effectiveness of remediation strategies.

A macrofoam based sampling methodology was developed and evaluated for the detection and quantification of norovirus on environmental hard surfaces.

표면에 인간의 노로 바이러스의 검출을위한 면봉 표본 추출 방법

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the ...

Isolation of Dendritic Cells from the Human Female Reproductive Tract for Phenotypical and Functional Studies

The characterization of the human dendritic cells (DCs) resident in mucosal tissues is challenging due to the difficulty in obtaining samples, and the low numbers of DCs present per tissue. Yet, as the phenotype and function of DCs is modified by the tissue environment, it is necessary to analyze tissue resident DC populations, since blood derived DCs incompletely reflect the complexities of DCs in tissues. Here we present a protocol to isolate DCs from the human female reproductive tract (FRT) using hysterectomy specimens that allows both phenotypical and functional analyses. The protocol consists of tissue digestion to generate a single cell mixed cell suspension, followed by positive magnetic bead selection. Our tissue digestion protocol does not cleave surface markers, which allows phenotypical and functional analysis of DCs in the steady state, without overnight incubation or cell activation. This protocol can be adapted for the isolation of other immune cell types or isolation of DCs from other tissues.

We describe here a method to isolate and purify dendritic cells from different anatomical compartments in the human female reproductive tract for the evaluation of their phenotypical and functional characteristics. This method can be adapted to isolate other immune cells or dendritic cells from other mucosal tissues.

Phenotypical 및 기능 연구에 대 한 인간의 여성 생식 관에서 수지상 세포의 고립

The characterization of the human dendritic cells (DCs) resident in mucosal tissues is challenging due to the difficulty in obtaining samples, and the low ...

Isolation, Expansion, and Adipogenic Induction of CD34+CD31+ Endothelial Cells from Human Omental and Subcutaneous Adipose Tissue

Obesity is accompanied by an extensive remodeling of adipose tissue primarily via adipocyte hypertrophy. Extreme adipocyte growth results in a poor response to insulin, local hypoxia, and inflammation. By stimulating the differentiation of functional white adipocytes from progenitors, radical hypertrophy of the adipocyte population can be prevented and, consequently, the metabolic health of adipose tissue can be improved along with a reduction of inflammation. Also, by stimulating a differentiation of beige/brown adipocytes, the total body energy expenditure can be increased, resulting in weight loss. This approach could prevent the development of obesity co-morbidities such as type 2 diabetes and cardiovascular disease.
This paper describes the isolation, expansion, and differentiation of white and beige adipocytes from a subset of human adipose tissue endothelial cells that co-express the CD31 and CD34 markers. The method is relatively cheap and is not labor-intensive. It requires access to human adipose tissue and the subcutaneous depot is suitable for sampling. For this protocol, fresh adipose tissue samples from morbidly obese subjects [body mass index (BMI) &#62;35] are collected during bariatric surgery procedures. Using a sequential immunoseparation from the stromal vascular fraction, enough cells are produced from as little as 2&#8211;3 g of fat. These cells can be expanded in culture over 10&#8211;14 days, can be cryopreserved, and retain their adipogenic properties with passaging up to passage 5&#8211;6. The cells are treated for 14 days with an adipogenic cocktail using a combination of human insulin and the PPAR&#947; agonist-rosiglitazone.
This methodology can be used for obtaining proof of concept experiments on molecular mechanisms that drive adipogenic responses in adipose endothelial cells, or for screening new drugs that can enhance the adipogenic response directed either towards white or beige/brown adipocyte differentiation. Using small subcutaneous biopsies, this methodology can be used to screen out non-responder subjects for clinical trials aimed to stimulate beige/brown and white adipocytes for the treatment of obesity and co-morbidities.

The differentiation of white and beige adipocytes from adipose tissue vascular progenitors bears potential for metabolic improvement in obesity. We describe protocols for a CD34+CD31+ endothelial cell isolation from human fat and for a subsequent in vitro expansion and differentiation into white and beige adipocytes. Several downstream applications are discussed.

절연, 확장, 및 Adipogenic CD34 + CD31 + 인간의 Omental 및 피하 지방 조직에서 내 피 세포의 유도

Obesity is accompanied by an extensive remodeling of adipose tissue primarily via adipocyte hypertrophy. Extreme adipocyte growth results in a poor ...