이 작품은 국립 정신 건강 연구소 (R00MH103531 및 R01MH1116901 에서 J.A.), 국립 일반 의학 연구소 (T32GM0007635에서 S.R.R.)의 박사 전 교육 보조금, 고급 연구를위한 리다 힐리엄 펠로우십 (GT1101.R.1)의 보조금에 의해 지원되었습니다. 우리는 현미경에 도움을 케빈 울프리 박사, 그의 전형 현미경의 사용에 대한 박사 K 울리히 바이엘, 그리고 토마스 수호프 (스탠포드 대학) LRRTM2 플라스미드에 대한 도움을 감사드립니다.

1. 세포 배양 및 형질
<ol><li>DMEM, 1x (덜벡코의 독수리 매체 수정)로 HEK 세포 미디어를 4.5 g/L 포도당, L 글루타민 및 나트륨 피루바테 및 10% FBS로 보충합니다. 멸균 필터.</li>
	<li>집계 분석에 적합한 리간드 및 수용체를 미리 결정합니다. 참고: Neurexin3α SS4+/-와 알려진 리간드 중 하나인 LRRTM2가 이 연구에서 사용되었습니다. 리간드 및 관심 수용체는 pcDNA3.1에서 cDNA로부터 발현되었다. 깁슨 어셈블리는 neurexin3α를 pcDNA3.112에삽입하는 데 사용되었다. 노이렉신3α F/R: TTTAAACTTAAGTAGTACCTACCGAGCTCGGATCCCACCATGAGCTCTACCCTCCACTCACTC/ GAGCGGCCGCCACTGTGTGTTGATATCTGCAATTCTTACAATAATAATAATAATACTCCTTGTTTCCTTTT.</li>
	<li>HEK293T 셀을 준비합니다.<ol>
<li>HEK293T 세포를 하나의 T-75 플라스크에 합류하게 성장시다.</li>
		<li>일단 컨서블, 트립신의 2 mL을 사용하고 2 분 동안 37 ° C 인큐베이터에 배치합니다. 6mL의 HEK 미디어를 플라스크에 추가하여 세포를 재일시 중단하고 8mL를 모두 15mL 원추형 튜브로 옮기습니다.</li>
		<li>500 x g에서 펠릿5 분 및 총 8 mLHEK 세포 매체에서 재중단.</li>
		<li>세포를 계산하고 6 웰 플레이트의 각 우물에 735,000 세포를 추가합니다. HEK 셀 미디어를 사용하여 각 웰에 대해 최종 볼륨을 2mL로 조정합니다.</li>
		<li>37°C 인큐베이터에 배치하고 세포가 하룻밤 사이에 또는 50-60 % 합류에 도달 할 때까지 성장 할 수 있습니다.</li>
	</ol></li>
	<li>칼슘인산법(13)을이용한 트랜스펙트 HEK293T 세포.<ol>
<li>형광 단백질 1 μg (pcDNA3.1-Neurexin3αWT SS4- 및 mCherry 1 μg의 3 μg)를 가진 관심 및 공동 트랜스펙트의 단백질 3 μg를 가진 Transfect well-1.</li>
		<li>1.4.1 단계에서와 같이 Transfect 잘 -2. 그러나 관심의 돌연변이 단백질 (pcDNA3.1-Neurexin3αA687T SS4-).</li>
		<li>다른 형광 단백질의 1 μg (pcDNA3.1 LRRTM2 및 GFP의 1 μg)의 1 μg와 관심 및 공동 트랜스 펙트의 3 μg와 트랜스펙트 웰 -3.</li>
		<li>트랜스펙트 웰-4와 잘-5 부정적인 컨트롤 역할을: 잘-4 GFP의 1 μg와 잘-5 mCherry의 1 μg.</li>
		<li>추가 조건 이나 컨트롤을 필요로 하는 경우 다른 플레이트를 준비 (단계 1.4.1-1.4.4) 추가 조건 또는 컨트롤을 필요로하는 경우 (Neurexin3αWT / A687T SS4+). 참고: 형광 효율은 상형광 현미경으로 형광 현미경으로 24시간 경과한 후 분석되고, 형광 단백질을 발현하는 세포의 수로 정량화된다. 보다 유선형적인 접근법은 형광 단백질과 관심의 리간드에 대한 비거스트로닉 벡터 코딩을 가진 HEK 세포의 전환을 포함하고 공동 형질 보다 높게 권장됩니다. 이 연구의 경우, 알파 뉴렉신은 ~4.3 kb이며 형광 강도가 낮으며, 동회용을 필요로 하는 이두근시스템을 사용하여 관찰되었다.</li>
	</ol></li>
	<li>이식 후 48시간, 집합을 위해 세포를 수확합니다.<ol>
<li>PBS로 두 번 잘 씻으시면 됩니다.</li>
		<li>PBS에 1mM EDTA1mL을 각 웰에 추가하여 세포 간 상호 작용을 부드럽게 분리하고 37°C에서 5분 동안 배양판을 배양합니다. 참고: 트립신은 연구에서 접착 분자의 잠재적인 단백질 분석 분열로 인해 1.5.2 단계에 권장되지 않습니다. 또한 EDTA 추가 후 세포가 주변 조건에 노출되기 때문에 완료될 때까지 프로토콜이 중지되지 않을 수 있습니다.</li>
		<li>부드럽게 세포를 분리하기 위해 접시를 누르고, 별도의 15 mL 원추형 튜브로 각각을 잘 수확.</li>
		<li>원심분리기 원심분리관은 500 x g, 실온은 5분 동안 드실 수 있습니다.</li>
	</ol></li>
	<li>세포가 펠릿화하는 동안 각 상태의 각 미세 원심 분리기 튜브의 상단을 표시하여 6 개의 배양 튜브를 준비하십시오. 참고: GFP 및 mCherry 조건의 각 순열은 모든 실험 조건과 적절한 제어를 포괄하는 데 사용되어야합니다. 예: 1. GFP/mCherry, 2. mCherry/LRRTM2-GFP 3. GFP/노이렉신3αWT SS4--mCherry, 4. GFP/뉴렉신3αA687T SS4- -mCherry, 5. 뉴렉신3αWT SS4--mCherry/LRRTM2-GFP, 6. 뉴렉신3αA687T SS4- -mCherry/LRRTM2-GFP. 추가 조건 및 제어를 수용할 수 있도록 튜브를 추가로 만듭니다.</li>
	<li>10mM CaCl2 및 10mM MgCl2로 37°C로 따뜻해진 HEK 매체의 500 μL에서 상체 및 재중단 세포를 제거합니다. 참고: CaCl2 및 MgCl2를 추가하면 접착 분자가 결합을 재확립할 수 있으며 문제의 세포간 상호 작용 파트너가 접착을 위해 이원양이온을 필요로 하는 경우에만 필요합니다.</li>
	<li>각 15mL 원문관의 세포를 혈류계와 알리쿼트 200,000개의 세포를 1.6.1 단계부터 적절한 튜브로 사용하여 500 μL의 총 부피에서 1:1 혼합을 계산한다. 참고: 조건당 5분만 계산하고 알리쿼트 금액이 소요됩니다.</li>
	<li>느린 튜브 회전기에서 실온에서 튜브를 배양합니다.</li>
</ol>2. 이미지 수집
<ol><li>특정 샘플에 대한 현미경 획득 매개 변수를 최적화합니다. 이 예에서는, 심상은 넓은 필드 현미경에서 촬영되었습니다. 5배 공기 목표 사용(NA: 0.15; WD: 20000 μm) 분석을 위한 충분한 필드를 얻을 수 있습니다.</li>
	<li>1.8 단계에서 HEK 세포의 두 조건을 혼합한 직후 기준집계를 평가한다. 이제 '시간 제로' 이미지입니다.<ol>
<li>488 및 561 채널 모두에서 형광 하에서 충전 된 현미경 슬라이드 및 이미지에 각 샘플 혼합물의 Pipette 40 μL.</li>
		<li>샘플 드롭당 하나의 포커스 평면에서 세 가지 보기 필드를 획득합니다.</li>
	</ol>
</li>
	<li>'시간 60' 이미지로 60분 만에 최종 이미지를 획득합니다.<ol>
<li>60분 배양 후 혼합물의 '시간 60' 이미지를 얻으려면 각 샘플을 회전 튜브및 파이펫에서 각 피펫에서 각 조건의 40 μL 샘플을 충전된 슬라이드로 가져 가십시오. 2.2.2 단계와 같은 이미지. 참고: 포화가 발생할 때까지 세포 집계는 15분마다 검사해야 합니다. 집계의 타이밍은 테스트되는 단백질에 따라 달라집니다.</li>
	</ol>
</li>
</ol>3. 이미지 J/피지 분석
<ol><li>피지/ImageJ를 사용하여 집계 범위를 정량화하려면 분석 파일을 저장합니다.<ol>
<li>제공된 보충 코딩 파일을 컴퓨터의 imageJ 매크로 폴더에 저장합니다.</li>
		<li>제공된 집계 매크로를 설치합니다(플러그인, 매크로, 설치 및 "집계분석.txt" 파일을 선택합니다.</li>
	</ol>
</li>
	<li>임계값을 결정합니다.<ol>
<li>'시간 제로' .tif 파일을 이미지J로 로드하고 채널을분할(이미지 | 색상 | 분할 채널). 참고: '시간 제로' 이미지는 전체 실험에 대한 임계값과 가장 작은 말장난 크기를 결정하는 데 사용됩니다.</li>
		<li>각채널(플러그인 | 매크로 | AggregationAssay_MakeMask). 이미지 창에서 마스크를 만들면 표시됩니다. 이미지에 대한 임계값 결정 옆에 있는 확인란을 확인하고 히스토그램에서 클러스터 Params를 결정하고 확인을 클릭합니다.</li>
		<li>슬라이드 막대를 사용하여 이미지의 임계값을 결정하고 슬라이드 막대오른쪽에 숫자를 기록하고 확인을 클릭합니다.</li>
		<li>클러스터 크기의 히스토그램이 나타납니다. 실험에 맞는 히스토그램에서 클러스터 크기를 선택하고, 이 숫자를 최소 클러스터 크기: 상자에 입력하고 확인을 클릭합니다. 이 크기 이하의 클러스터는 분석되지 않습니다.</li>
	</ol>
</li>
	<li>분석을 실행합니다.<ol>
<li>이미지J에서 조건 1의 '시간 60' 이미지를 열고 3.2.1 단계와 같이 채널을 분할합니다.</li>
		<li>각 채널(플러그인, 매크로, AggregationAssay_MakeMask)을 마스크합니다. 3.2.3 단계 및 3.2.4 단계에서 결정된 동일한 임계값 및 크기를 사용합니다. 이미지에 대한 임계값 결정 옆에 있는 상자를 선택 취소하고 히스토그램에서 클러스터 Params를 결정하고 크기와 임계값을 해당 필드에 수동으로 입력한 다음 확인을 클릭합니다.</li>
		<li>집계 지수(플러그인 | 계산 매크로 | AggregationAssay_CalculateOverlap). 비교할 마스크채널과 결과 파일이 저장되는 디렉토리를 선택합니다.</li>
		<li>모든 조건에서 '시간 60' 이미지당 3.3.1-3.3단계를 반복합니다. 참고: 집계 인덱스는 100을 곱한 중첩 영역을 뺀 두 채널 영역의 합으로 나눈 총 중첩 영역으로 정의됩니다(집계 인덱스 = 중첩 영역/[채널 1 + 채널 2의 영역 ] 중첩 영역] x 100). 이 정규화는 두 마스크 채널 간의 'OR' 동작으로 두 마스크의 총 픽셀을 나타냅니다.</li>
	</ol>
</li>
</ol>

<ol>
	<li>S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuroligins+and+neurexins+link+synaptic+function+to+cognitive+disease.">Neuroligins and neurexins link synaptic function to cognitive disease.</a> Nature. 455 (7215), 903-911 (2008).</li><li>Lakey, J. H., Raggett, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+protein-protein+interactions.">Measuring protein-protein interactions.</a> Current Opinion in Structural Biology. 8 (1), 119-123 (1998).</li><li>Aoto, J., Martinelli, D. C., Malenka, R. C., Tabuchi, K., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Presynaptic+neurexin-3+alternative+splicing+trans-synaptically+controls+postsynaptic+AMPA+receptor+trafficking.">Presynaptic neurexin-3 alternative splicing trans-synaptically controls postsynaptic AMPA receptor trafficking.</a> Cell. 154 (1), 75-88 (2013).</li><li>Aoto, J., F&#246;ldy, C., Ilcus, S. M. C., Tabuchi, K., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+circuit-dependent+functions+of+presynaptic+neurexin-3+at+GABAergic+and+glutamatergic+synapses.">Distinct circuit-dependent functions of presynaptic neurexin-3 at GABAergic and glutamatergic synapses.</a> Nature Neuroscience. 18 (7), 997-1007 (2015).</li><li>S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synaptic+Neurexin+Complexes:+A+Molecular+Code+for+the+Logic+of+Neural+Circuits.">Synaptic Neurexin Complexes: A Molecular Code for the Logic of Neural Circuits.</a> Cell. 171 (4), 745-769 (2017).</li><li>Dai, J., Aoto, J., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+Splicing+of+Presynaptic+Neurexins+Differentially+Controls+Postsynaptic+NMDA+and+AMPA+Receptor+Responses.">Alternative Splicing of Presynaptic Neurexins Differentially Controls Postsynaptic NMDA and AMPA Receptor Responses.</a> Neuron. 102 (5), 993-1008 (2019).</li><li>Restrepo, S., Langer, N. J., Nelson, K. A., Aoto, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+a+Neurexin-3&#945;+Human+Mutation+in+Mouse+Neurons+Identifies+a+Novel+Role+in+the+Regulation+of+Transsynaptic+Signaling+and+Neurotransmitter+Release+at+Excitatory+Synapses.">Modeling a Neurexin-3&#945; Human Mutation in Mouse Neurons Identifies a Novel Role in the Regulation of Transsynaptic Signaling and Neurotransmitter Release at Excitatory Synapses.</a> The Journal of Neuroscience. 39 (46), 9065-9082 (2019).</li><li>Ko, J., Fuccillo, M. V., Malenka, R. C., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTM2+Functions+as+a+Neurexin+Ligand+in+Promoting+Excitatory+Synapse+Formation.">LRRTM2 Functions as a Neurexin Ligand in Promoting Excitatory Synapse Formation.</a> Neuron. 64 (6), 791-798 (2009).</li><li>de Wit, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTM2+Interacts+with+Neurexin1+and+Regulates+Excitatory+Synapse+Formation.">LRRTM2 Interacts with Neurexin1 and Regulates Excitatory Synapse Formation.</a> Neuron. 64 (6), 799-806 (2009).</li><li>Linhoff, M. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Unbiased+Expression+Screen+for+Synaptogenic+Proteins+Identifies+the+LRRTM+Protein+Family+as+Synaptic+Organizers.">An Unbiased Expression Screen for Synaptogenic Proteins Identifies the LRRTM Protein Family as Synaptic Organizers.</a> Neuron. 61 (5), 734-749 (2009).</li><li>Siddiqui, T. J., Pancaroglu, R., Kang, Y., Rooyakkers, A., Craig, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTMs+and+Neuroligins+Bind+Neurexins+with+a+Differential+Code+to+Cooperate+in+Glutamate+Synapse+Development.">LRRTMs and Neuroligins Bind Neurexins with a Differential Code to Cooperate in Glutamate Synapse Development.</a> Journal of Neuroscience. 30 (22), 7495-7506 (2010).</li><li>Gibson, D. G., Young, L., Chuang, R. -. Y., Venter, J. C., Hutchison, C. A., Smith, H. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases.">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nature Methods. 6 (5), 343-345 (2009).</li><li>Bacchetti, S., Graham, F. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transfer+of+the+gene+for+thymidine+kinase+to+thymidine+kinase-deficient+human+cells+by+purified+herpes+simplex+viral+DNA.">Transfer of the gene for thymidine kinase to thymidine kinase-deficient human cells by purified herpes simplex viral DNA.</a> Proceedings of the National Academy of Sciences of the United States of America. 74 (4), 1590-1594 (1977).</li><li>Cerchiari, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+strategy+for+tissue+self-organization+that+is+robust+to+cellular+heterogeneity+and+plasticity.">A strategy for tissue self-organization that is robust to cellular heterogeneity and plasticity.</a> Proceedings of the National Academy of Sciences of the United States of America. 112 (7), 2287-2292 (2015).</li><li>Burdick, M. M., McCarty, O. J. T., Jadhav, S., Konstantopoulos, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-cell+interactions+in+inflammation+and+cancer+metastasis.">Cell-cell interactions in inflammation and cancer metastasis.</a> IEEE Engineering in Medicine and Biology Magazine. 20 (3), 86-91 (2001).</li><li>Fox, D. A., Gizinski, A., Morgan, R., Lundy, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-cell+interactions+in+rheumatoid+arthritis+synovium.">Cell-cell interactions in rheumatoid arthritis synovium.</a> Rheumatic Diseases Clinics of North America. 36 (2), 311-323 (2010).</li><li>Yamagata, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+insights+into+modulation+and+selectivity+of+transsynaptic+neurexin-LRRTM+interaction.">Structural insights into modulation and selectivity of transsynaptic neurexin-LRRTM interaction.</a> Nature Communications. 9 (1), 3964 (2018).</li><li>Nguyen, T., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Binding+properties+of+neuroligin+1+and+neurexin+1beta+reveal+function+as+heterophilic+cell+adhesion+molecules.">Binding properties of neuroligin 1 and neurexin 1beta reveal function as heterophilic cell adhesion molecules.</a> The Journal of Biological Chemistry. 272 (41), 26032-26039 (1997).</li><li>Boucard, A. A., Ko, J., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+Affinity+Neurexin+Binding+to+Cell+Adhesion+G-protein-coupled+Receptor+CIRL1/Latrophilin-1+Produces+an+Intercellular+Adhesion+Complex.">High Affinity Neurexin Binding to Cell Adhesion G-protein-coupled Receptor CIRL1/Latrophilin-1 Produces an Intercellular Adhesion Complex.</a> Journal of Biological Chemistry. 287 (12), 9399-9413 (2012).</li></ol>

저자는 공개 할 것이 없습니다.

세포 접착 중에 트랜스에서 발생하는 단백질 단백질 상호 작용을 해부하면 성숙 및 리모델링 중에 시냅스의 형성, 기능 및 유지 관리를 포함한 기본 세포 과정의 근본적인 분자 메커니즘을 더 잘 이해할 수 있습니다. 세포 대 세포 상호 작용의 의미는 신경 생물학을 넘어 확장하고 신호 전달, 세포 이동 및 조직 발달에 있는 더 넓은 역할을14. 세포 유착의 수차는 적절한 세포 기능...

시냅스 접착 분자에 의해 촉진되는 시냅스 상호 작용은 시냅스의 개발, 조직, 사양, 유지 보수 및 기능 및 신경망 의 생성을 위한 기초입니다. 이러한 신혈 세포 접착 분자의 식별은 급속히 증가하고 있습니다. 따라서, 결합 파트너를 식별하고 이러한 새로운 접착 분자가 서로 상호 작용하는 방법을 이해하는 것이 근본적으로 중요합니다. 추가적으로, 게놈 순서는 일반적으로 신경 발달, 신경 정신병및 중독무질서1의 다수에 연결되는 이 접착 분자의 많은에서 돌연변이를 확인했습니다. 시냅스 세포 접착 분자에 대 한 코드 유전자에 돌연변이 는 해로운 트랜스 상호 작용을 변경 하 고 시 냅 스 형성 및 유지 보수에 병 리 학적 변경에 기여할 수 있습니다.
여러 분석법은 이소성 열량, 원형 이윤술, 표면 플라스몬 공명2와 같은 단백질 단백질 상호 작용을 정량적으로 평가하기 위해 존재하며 자연에서 정량적이지만 몇 가지 한계가 있습니다. 첫째, 그들은 재조합 단백질을 필요로, 때로는 길고 지루한 정제 단계를 요구. 둘째, 정교한 특수 장비와 기술 전문 지식이 필요합니다. 셋째, 생체 내 막에 자연적으로 테더드되는 단백질 간의 시스 및 트랜스 상호 작용을 모두 허용하므로 결합의 정도를 과대 평가할 수 있습니다. 여기에서 우리는 트랜스 상호 작용을 독점적으로 테스트하는 간단하고 비교적 빠른 분석서를 제안합니다.
정제된 단백질 분석과 관련된 많은 합병증을 우회하기 위해, 우리는 감소된 이종 세포 시스템에서 트랜스 상호 작용을 재구성하는 세포 기지를 둔 단백질 상호 작용 분석서를 최적화했습니다. 이 분석은 이전에 세포 간 상호 작용을 연구하기 위해 다양한 형태로 사용되었습니다. 이 접근법에서, 후보 세포 접착 분자는 HEK293T 세포로 전형된다. 생리학적 조건에서 HEK293T 세포는 자가 응집을 나타내지 않아 이 분석에 대한 모범적인 모델을 만듭니다. 그러나, 수용체와 리간드를 발현하는 HEK 세포의 개별 집단이 결합될 때, 수용체의 결합과 HEK 세포의 리간드 힘 응집이 발생한다. 이 집계는 트랜스 상호 작용에 의해 독점적으로 중재되며 일반적으로 수십 분 안에 관찰 할 수 있습니다. 이 방법에서는 단백질 정화 단계가 필요하지 않으며, 이 방법의 효율은 cognate 접착 분자를 발현하는 HEK 세포의 인구가 결합되고 수십 분 후에 만 이미지되는 패러다임에 의존한다. 또한, 이 방법은 항체나 비용이 많이 드는 장비가 필요하지 않습니다. 데이터 수집에 필요한 유일한 장비는 표준 형광 현미경입니다. 이 세포 기지를 둔 분석기의 추가 이점은 트랜스 상호 작용에 질병 관련 점 돌연변이의 효력을 빨리 검열하는 기능입니다. 이는 관심 있는 단백질의 돌연변이 변이체의 cDNA를 가진 HEK 세포를 배분하여 수행될 수 있다.
이 프로토콜에서, 우리는 우리가 심각한 지적 장애 및 간질로 진단된 환자에서 확인된 Neurexin3α (Neurexin3αA687T)에있는 잘못된 감각 돌연변이가, 류신이 풍부한 반복 막 단백질 2 (LRRTM2)와 트랜스에서 상호 작용을 변경하는지 여부를 조사하는 예를 제시합니다. Neurexin3α는 사전 시냅스 세포 접착 분자의 진화적으로 보존된 가족의 일원이며, 최근 연구는 시냅스3,4,5,6,7,이 분자및 뉴렉신 가족의 모든 구성원에 대한 당사의 시냅스 이해에서 여러 역할을 확인했지만 불완전하다. LRRTM2는 시냅스 형성 및 유지 보수8,9,10에참여하는 흥분포스트 냅틱 세포 접착 단백질이다. 중요 한 것은, LRRTM2 독점적으로 스플라이스 사이트 4 대체 엑슨 (SS4-) 부족 하지만 스플라이스 사이트 4 대체 엑슨을 포함 하는 뉴렉신 등소와 상호 작용 4 대체 엑슨 (SS4+). Neurexin3α에서 확인된 인간 잘못된 감각 돌연변이(A687T)는 진화적으로 보존되고 모든 알파 뉴렉신7사이에 보존되는 연구되지 않은 세포외 지역에 위치한다. 이 두 분자 간의 상호 작용이 확립됨에 따라8,9,11,우리는 질문을 제기 : Neurexin3α SS4- LRRTM2의 결합 능력은 A687T 포인트 돌연변이에 의해 변경? 이 분석서에 따르면 A687T 점 돌연변이는 예기치 않게 Neurexin3α에서 LRRTM2로의 응집을 강화하여 점 돌연변이가 있는 세포외 영역이 신내 상호 작용을 중재하는 역할을 한다는 것을 시사합니다.

<table border="0" cellpadding="0" cellspacing="0" style="width:788px;" width="787">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="60">
			<td height="60" style="height:60px;width:339px;">1.5 mL disposable microtubes with snap caps</td>
			<td style="width:121px;">VWR</td>
			<td style="width:161px;">89000-028</td>
			<td style="width:167px;">Incubation of mixed population of HEK cells</td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:339px;">1000 mL Rapid&#8212;Flow Filter Unit, 0.2 um aPES membrane</td>
			<td style="width:121px;">Thermo Fisher</td>
			<td style="width:161px;">567-0020</td>
			<td style="width:167px;">Sterilization of HEK media</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:339px;">15 mL SpectraTube centrifuge tubes</td>
			<td style="width:121px;">Ward&#8217;s Science</td>
			<td style="width:161px;">470224-998</td>
			<td style="width:167px;">Harvesting HEK cells</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:339px;">6 well sterile tissue culture plates</td>
			<td style="width:121px;">VWR</td>
			<td style="width:161px;">100062-892</td>
			<td style="width:167px;">culturing HEK cells</td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:339px;">Calcium Chloride</td>
			<td style="width:121px;">Sigma</td>
			<td style="width:161px;">223506-500G</td>
			<td style="width:167px;">Calcium phosphate transfection, HEK cell resuspension</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:45px;width:339px;">Centrifuge- Sorvall Legend RT</td>
			<td style="width:121px;">Kendro Laboratory Products</td>
			<td align="right" style="width:161px;">75004377</td>
			<td style="width:167px;">Harvesting HEK cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:22px;width:339px;">CO2 cell incubator</td>
			<td style="width:121px;">Thermo Scientific</td>
			<td style="width:161px;">HERACELL 150i</td>
			<td style="width:167px;">Incubation of HEK cells during growth</td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:339px;">DMEM, 1x (Dulbecco&#39;s Modification of Eagle&#39;s Medium) with 4.5 g/L glucose, L-glutamine &#38; sodium pyruvate</td>
			<td style="width:121px;">Corning</td>
			<td style="width:161px;">10-013-CV</td>
			<td style="width:167px;">HEK cell maintenance</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:43px;width:339px;">Dulbecco&#8217;s Phosphate Buffered Saline PBS (1X)</td>
			<td style="width:121px;">Gibco</td>
			<td style="width:161px;">14190-144</td>
			<td style="width:167px;">Passaging/harvesting HEK cell</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:339px;">Ethylenediaminetetraacetic acid</td>
			<td style="width:121px;">Sigma</td>
			<td style="width:161px;">ED-500G</td>
			<td style="width:167px;">Harvesting HEK cells</td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:339px;">Falcon Vented culture flasks, 75cm2 growth area</td>
			<td style="width:121px;">Corning</td>
			<td style="width:161px;">9381M26</td>
			<td style="width:167px;">Culturing HEK cells</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:43px;width:339px;">Fetal Bovine Serum</td>
			<td style="width:121px;">Sigma</td>
			<td style="width:161px;">17L184</td>
			<td style="width:167px;">HEK cell maintenance</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:43px;width:339px;">HEK293T cells</td>
			<td style="width:121px;">ATCC</td>
			<td style="width:161px;"></td>
			<td style="width:167px;">Model system</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:339px;">ImageJ</td>
			<td style="width:121px;">NIH</td>
			<td style="width:161px;">V: 2.0.0-rc-69/1.52p</td>
			<td style="width:167px;">Image analysis</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:43px;width:339px;">Magnesium Chloride hexahydrate</td>
			<td style="width:121px;">Sigma</td>
			<td style="width:161px;">M9272-500G</td>
			<td style="width:167px;">HEK cell resuspension</td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:339px;">Sodium phosphate dibasic anhydrous</td>
			<td style="width:121px;">Fisher BioReagents</td>
			<td style="width:161px;">BP332-500</td>
			<td style="width:167px;">Calcium phosphate transfection</td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:339px;">Trypsin 0.25% (1X) Solution</td>
			<td style="width:121px;">GE Healthcare Life Sciences</td>
			<td style="width:161px;">SH30042.01</td>
			<td style="width:167px;">Passaging HEK cells</td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:339px;">Tube rotator</td>
			<td style="width:121px;"></td>
			<td style="width:161px;"></td>
			<td style="width:167px;">Incubation of mixed population of HEK cells</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:339px;">UltraClear Microscope slides. White Frosted, Positive Charged</td>
			<td style="width:121px;">Denville Scientific Inc.</td>
			<td style="width:161px;">M1021</td>
			<td style="width:167px;">Image acquisition</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:339px;">Wide-field microscope</td>
			<td style="width:121px;">Zeiss</td>
			<td style="width:161px;">Axio Vert 200M</td>
			<td style="width:167px;">Image acquisition</td>
		</tr>
	</tbody>
</table>

measuring transcellular interactions through protein aggregation in a heterologous cell system

세포 인터페이스에서 단백질 상호 작용은 조직 발달과 암 진행에서 시냅스 형성 및 유지 보수에 이르기까지 다양한 생물학적 결과를 지시합니다. 이러한 근본적인 상호 작용의 대부분은 트랜스에서 발생하고 일반적으로 막 고정 결합 쌍을 표현하는 세포 사이의 이기성 또는 동종 작용에 의해 유도된다. 질병 관련 돌연변이가 어떻게 이러한 근본적인 단백질 상호 작용을 방해하는지 설명하면 무수한 세포 생물학 분야에 대한 통찰력을 제공할 수 있습니다. 많은 단백질 단백질 상호 작용 소법은 전형적으로 시스와 트랜스 상호 작용 사이에 비약적이지 않으며, 이는 잠재적으로 생체 내에서 발생하는 결합의 정도의 과대 평가로 이어지고 단백질 및 /또는 전문 모니터링 장비의 노동 집약적 정제를 포함합니다. 여기서, 우리는 긴 단백질 정제 또는 특수 장비없이 트랜스 상호 작용의 관찰 및 정량화를 허용하는 최적화 된 간단한 프로토콜을 제시한다. HEK 세포 집계 분석법은 HEK 세포의 2개의 독립적인 인구의 혼합을 관련시킵니다, 각각 막 결합 된 cognate 리간드를 표현합니다. 짧은 잠복기 후에 는 샘플이 이미지화되고 결과 골재가 정량화됩니다.

A687T 돌연변이는 LRRTM2 7에 결합하는 Neurexin3α SS4-결합을 증가시킵니다. 두 개의 알려진 시냅스 단백질의 세포 간 상호 작용이 지적 장애 및 간질을 가진 환자에서 발견되는 포인트 돌연변이의 도입에 의해 어떻게 영향을 받는지 조사하기 위해 위의 HEK 세포 집계분석(도 1)을사용했습니다. 세포는 섹션 1에 따라 전과되었고 프로토콜의 섹션 1 과 2에 따라 ...

Watch this Scientific Journal Video about Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System at JoVE.com

Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System

여기서, 우리는 형광 현미경을 사용하여 이종 세포 시스템에서 트랜스에서 리간드 수용체 상호 작용을 신속하고 반정적으로 측정하는 최적화된 프로토콜을 제시한다.

이종 세포 시스템에서 단백질 응집을 통한 세포 간 상호 작용 측정

Protein interactions at cellular interfaces dictate a multitude of biological outcomes ranging from tissue development and cancer progression to synapse ...

measuring-transcellular-interactions-through-protein-aggregation

Research

JoVE Journal

Neuroscience

3.4K 조회수.  University of Colorado Denver School of Medicine. 여기서, 우리는 형광 현미경을 사용하여 이종 세포 시스템에서 트랜스에서 리간드 수용체 상호 작용을 신속하고 반정적으로 측정하는 최적화된 프로토콜을 제시한다.

비디오: Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System

Assaying Surface Expression of Chemosensory Receptors in Heterologous Cells

The vivid world of odors is recognized by the sense of olfaction. Olfaction in mice is mediated by a repertoire of about 1200 G Protein Coupled Receptors (GPCRs) 1 that are postulated to bind volatile odorant molecules and converting the extracellular signal into an intracellular signal by coupling with G protein G&alpha;olf. Binding of the odorants to the receptors is thought to follow a combinatorial rule, that is, one odorant may bind several receptors and one receptor may bind several odorants to varying degrees 2. Biochemical, signaling and ligand binding studies have been conveniently carried out for most GPCRs using heterologous cells. However use of heterologous cells for study of odorant receptors, was precluded for a long time since on transfection they failed to export to the surface. Saito et al have demonstrated single membrane pass Receptor Transporting Protein (RTP) family chaperones show enhanced expression in the olfactory sensory neurons and act as chaperones to traffic odorant receptors to the surface in heterologous cells, when co transfected together 3. To carry out biochemical assays for receptors using heterologous cells, one must first determine if the receptor shows robust surface expression in the cell line. This can be assayed by overexpressing the receptors with the chaperone RTP1S followed by live cell staining to fluorescently label the extracellular domain or a tag in the extracellular domain exclusively. Here we demonstrate a protocol to carry out live cell staining that can be used to detect odorant receptors on the surface of HEK293T cells conveniently. In addition, it may also be used to assay for surface expression of other chemosensory receptors or GPCRs.

Here we demonstrate a protocol to carry out live cell staining that can be used to detect odorant receptors on the surface of HEK293T cells conveniently. In addition, it may also be used to assay for surface expression of other chemosensory receptors or GPCRs.

Heterologous 셀에 Chemosensory 수용체의 표면 표현을 시금

The vivid world of odors is recognized by the sense of olfaction. Olfaction in mice is mediated by a repertoire of about 1200 G Protein Coupled Receptors ...

연구

신경과학

Localizing Protein in 3D Neural Stem Cell Culture: a Hybrid Visualization Methodology

The importance of 3-dimensional (3D) topography in influencing neural stem and progenitor cell (NPC) phenotype is widely acknowledged yet challenging to study. When dissociated from embryonic or post-natal brain, single NPCs will proliferate in suspension to form neurospheres. Daughter cells within these cultures spontaneously adopt distinct developmental lineages (neurons, oligodendrocytes, and astrocytes) over the course of expansion despite being exposed to the same extracellular milieu. This progression recapitulates many of the stages observed over the course of neurogenesis and gliogenesis in post-natal brain and is often used to study basic NPC biology within a controlled environment. Assessing the full impact of 3D topography and cellular positioning within these cultures on NPC fate is, however, difficult. To localize target proteins and identify NPC lineages by immunocytochemistry, free-floating neurospheres must be plated on a substrate or serially sectioned. This processing is required to ensure equivalent cell permeabilization and antibody access throughout the sphere. As a result, 2D epifluorescent images of cryosections or confocal reconstructions of 3D Z-stacks can only provide spatial information about cell position within discrete physical or digital 3D slices and do not visualize cellular position in the intact sphere. Here, to reiterate the topography of the neurosphere culture and permit spatial analysis of protein expression throughout the entire culture, we present a protocol for isolation, expansion, and serial sectioning of post-natal hippocampal neurospheres suitable for epifluorescent or confocal immunodetection of target proteins. Connexin29 (Cx29) is analyzed as an example. Next, using a hybrid of graphic editing and 3D modelling softwares rigorously applied to maintain biological detail, we describe how to re-assemble the 3D structural positioning of these images and digitally map labelled cells within the complete neurosphere. This methodology enables visualization and analysis of the cellular position of target proteins and cells throughout the entire 3D culture topography and will facilitate a more detailed analysis of the spatial relationships between cells over the course of neurogenesis and gliogenesis in vitro.
Both Imbeault and Valenzuela contributed equally and should be considered joint first authors.

Here, we describe how to produce, expand, and immunolabel postnatal hippocampal neural progenitor cells (NPCs) in three-dimensional (3D) culture. Next, using hybrid visualization technologies, we demonstrate how digital images of immunolabelled cryosections can be used to reconstruct and map the spatial position of immunopositive cells throughout the entire 3D neurosphere.

3D 신경 줄기 세포 문화 번역하는 단백질 : 하이브리드 시각화 방법론

The importance of 3-dimensional (3D) topography in influencing neural stem and progenitor cell (NPC) phenotype is widely acknowledged yet challenging to ...

Efficient Derivation of Human Neuronal Progenitors and Neurons from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

There is a large unfulfilled need for a clinically-suitable human neuronal cell source for repair or regeneration of the damaged central nervous system (CNS) structure and circuitry in today's healthcare industry. Cell-based therapies hold great promise to restore the lost nerve tissue and function for CNS disorders. However, cell therapies based on CNS-derived neural stem cells have encountered supply restriction and difficulty to use in the clinical setting due to their limited expansion ability in culture and failing plasticity after extensive passaging1-3. Despite some beneficial outcomes, the CNS-derived human neural stem cells (hNSCs) appear to exert their therapeutic effects primarily by their non-neuronal progenies through producing trophic and neuroprotective molecules to rescue the endogenous cells1-3. Alternatively, pluripotent human embryonic stem cells (hESCs) proffer cures for a wide range of neurological disorders by supplying the diversity of human neuronal cell types in the developing CNS for regeneration1,4-7. However, how to channel the wide differentiation potential of pluripotent hESCs efficiently and predictably to a desired phenotype has been a major challenge for both developmental study and clinical translation. Conventional approaches rely on multi-lineage inclination of pluripotent cells through spontaneous germ layer differentiation, resulting in inefficient and uncontrollable lineage-commitment that is often followed by phenotypic heterogeneity and instability, hence, a high risk of tumorigenicity7-10. In addition, undefined foreign/animal biological supplements and/or feeders that have typically been used for the isolation, expansion, and differentiation of hESCs may make direct use of such cell-specialized grafts in patients problematic11-13. To overcome these obstacles, we have resolved the elements of a defined culture system necessary and sufficient for sustaining the epiblast pluripotence of hESCs, serving as a platform for de novo derivation of clinically-suitable hESCs and effectively directing such hESCs uniformly towards clinically-relevant lineages by small molecules14 (please see a schematic in Fig. 1). Retinoic acid (RA) does not induce neuronal differentiation of undifferentiated hESCs maintained on feeders1, 14. And unlike mouse ESCs, treating hESC-differentiated embryoid bodies (EBs) only slightly increases the low yield of neurons1, 14, 15. However, after screening a variety of small molecules and growth factors, we found that such defined conditions rendered retinoic acid (RA) sufficient to induce the specification of neuroectoderm direct from pluripotent hESCs that further progressed to neuroblasts that generated human neuronal progenitors and neurons in the developing CNS with high efficiency (Fig. 2). We defined conditions for induction of neuroblasts direct from pluripotent hESCs without an intervening multi-lineage embryoid body stage, enabling well-controlled efficient derivation of a large supply of human neuronal cells across the spectrum of developmental stages for cell-based therapeutics.

We have established a protocol for induction of neuroblasts direct from pluripotent human embryonic stem cells maintained under defined conditions with small molecules, which enables derivation of a large supply of human neuronal progenitors and neuronal cell types in the developing CNS for neural repair.

작은 분자와 유도 Pluripotent 인간 배아 줄기 세포에서 인간의 연결을 Progenitors과 뉴런의 효율 유도

There is a large unfulfilled need for a clinically-suitable human neuronal cell source for repair or regeneration of the damaged central nervous system ...

Peering into the Dynamics of Social Interactions: Measuring Play Fighting in Rats

Play fighting in the rat involves attack and defense of the nape of the neck, which if contacted, is gently nuzzled with the snout. Because the movements of one animal are countered by the actions of its partner, play fighting is a complex, dynamic interaction. This dynamic complexity raises methodological problems about what to score for experimental studies. We present a scoring schema that is sensitive to the correlated nature of the actions performed. The frequency of play fighting can be measured by counting the number of playful nape attacks occurring per unit time. However, playful defense, as it can only occur in response to attack, is necessarily a contingent measure that is best measured as a percentage (#attacks defended/total # attacks X 100%). How a particular attack is defended against can involve one of several tactics, and these are contingent on defense having taken place; consequently, the type of defense is also best expressed contingently as a percentage. Two experiments illustrate how these measurements can be used to detect the effect of brain damage on play fighting even when there is no effect on overall playfulness. That is, the schema presented here is designed to detect and evaluate changes in the content of play following an experimental treatment.

Play fighting in the rat involves attack and defense of the nape of the neck, which if contacted, is gently nuzzled with the snout. Because the movements of one animal are countered by the actions of its partner, play fighting is a complex, dynamic interaction. This dynamic complexity raises methodological problems about what to score for experimental studies. We present a scoring schema that is sensitive to the correlated nature of the actions performed. Two experiments illustrate how these measurements can be used to detect the effect of brain damage on play fighting even when there is no effect on overall playfulness. That is, the schema presented here is designed to detect and evaluate changes in the content of play following an experimental treatment.

사회적 상호 작용의 역학을 탐구 : 측정 플레이가 쥐 파이팅

Play fighting in the rat involves attack and defense of the nape of the neck, which if contacted, is gently nuzzled with the snout. Because the movements ...

Dual Electrophysiological Recordings of Synaptically-evoked Astroglial and Neuronal Responses in Acute Hippocampal Slices

Astrocytes form together with neurons tripartite synapses, where they integrate and modulate neuronal activity. Indeed, astrocytes sense neuronal inputs through activation of their ion channels and neurotransmitter receptors, and process information in part through activity-dependent release of gliotransmitters. Furthermore, astrocytes constitute the main uptake system for glutamate, contribute to potassium spatial buffering, as well as to GABA clearance. These cells therefore constantly monitor synaptic activity, and are thereby sensitive indicators for alterations in synaptically-released glutamate, GABA and extracellular potassium levels. Additionally, alterations in astroglial uptake activity or buffering capacity can have severe effects on neuronal functions, and might be overlooked when characterizing physiopathological situations or knockout mice. Dual recording of neuronal and astroglial activities is therefore an important method to study alterations in synaptic strength associated to concomitant changes in astroglial uptake and buffering capacities. Here we describe how to prepare hippocampal slices, how to identify stratum radiatum astrocytes, and how to record simultaneously neuronal and astroglial electrophysiological responses. Furthermore, we describe how to isolate pharmacologically the synaptically-evoked astroglial currents.

The preparation of acute brain slices from isolated hippocampi, as well as the simultaneous electrophysiological recordings of astrocytes and neurons in stratum radiatum during stimulation of schaffer collaterals is described. The pharmacological isolation of astroglial potassium and glutamate transporter currents is demonstrated.

급성 Hippocampal 슬라이스에 Synaptically-evoked Astroglial와 Neuronal 응답의 듀얼 Electrophysiological 레코딩

Astrocytes form together with neurons tripartite synapses, where they integrate and modulate neuronal activity. Indeed, astrocytes sense neuronal inputs ...

A Lightweight, Headphones-based System for Manipulating Auditory Feedback in Songbirds

Experimental manipulations of sensory feedback during complex behavior have provided valuable insights into the computations underlying motor control and sensorimotor plasticity1. Consistent sensory perturbations result in compensatory changes in motor output, reflecting changes in feedforward motor control that reduce the experienced feedback error. By quantifying how different sensory feedback errors affect human behavior, prior studies have explored how visual signals are used to recalibrate arm movements2,3 and auditory feedback is used to modify speech production4-7. The strength of this approach rests on the ability to mimic naturalistic errors in behavior, allowing the experimenter to observe how experienced errors in production are used to recalibrate motor output.
Songbirds provide an excellent animal model for investigating the neural basis of sensorimotor control and plasticity8,9. The songbird brain provides a well-defined circuit in which the areas necessary for song learning are spatially separated from those required for song production, and neural recording and lesion studies have made significant advances in understanding how different brain areas contribute to vocal behavior9-12. However, the lack of a naturalistic error-correction paradigm - in which a known acoustic parameter is perturbed by the experimenter and then corrected by the songbird - has made it difficult to understand the computations underlying vocal learning or how different elements of the neural circuit contribute to the correction of vocal errors13.
The technique described here gives the experimenter precise control over auditory feedback errors in singing birds, allowing the introduction of arbitrary sensory errors that can be used to drive vocal learning. Online sound-processing equipment is used to introduce a known perturbation to the acoustics of song, and a miniaturized headphones apparatus is used to replace a songbird's natural auditory feedback with the perturbed signal in real time. We have used this paradigm to perturb the fundamental frequency (pitch) of auditory feedback in adult songbirds, providing the first demonstration that adult birds maintain vocal performance using error correction14. The present protocol can be used to implement a wide range of sensory feedback perturbations (including but not limited to pitch shifts) to investigate the computational and neurophysiological basis of vocal learning.

We describe the design and assembly of miniaturized headphones suitable for replacing a songbird&#x2019;s natural auditory feedback with a manipulated acoustic signal. Online sound processing hardware is used to manipulate song output, introduce real-time errors in auditory feedback via the headphones, and drive vocal motor learning.

노래하는 새는에 청각 피드백을 조작하기위한 경량, 헤드폰 기반의 시스템

Experimental manipulations of sensory feedback during complex behavior have provided valuable insights into the computations underlying motor control and ...

Genetic Manipulation of the Mouse Developing Hypothalamus through In utero Electroporation

Genetic modification of specific regions of the developing mammalian brain is a very powerful experimental approach. However, generating novel mouse mutants is often frustratingly slow. It has been shown that access to the mouse brain developing in utero with reasonable post-operatory survival is possible. Still, results with this procedure have been reported almost exclusively for the most superficial and easily accessible part of the developing brain, i.e. the cortex. The thalamus, a narrower and more medial region, has proven more difficult to target. Transfection into deeper nuclei, especially those of the hypothalamus, is perhaps the most challenging and therefore very few results have been reported. Here we demonstrate a procedure to target the entire hypothalamic neuroepithelium or part of it (hypothalamic regions) for transfection through electroporation. The keys to our approach are longer narcosis times, injection in the third ventricle, and appropriate kind and positioning of the electrodes. Additionally, we show results of targeting and subsequent histological analysis of the most recessed hypothalamic nucleus, the mammillary body.

Genetic Manipulation of the Mouse Developing Hypothalamus through In utero Electroporation

Despite the functional and medical importance of the hypothalamus, in utero genetic manipulation of its development has rarely been attempted. We show a detailed procedure for in utero electroporation into the mouse hypothalamus and show representative results of total and partial (regional) hypothalamic transfection.

마우스의 유전자 조작을 통해 시상 하부 개발<em&gt; 자궁 내</em&gt; 일렉트로

Genetic  modification of specific regions of the developing mammalian brain is a very  powerful experimental approach. However, generating novel mouse ...

A Caenorhabditis elegans Model System for Amylopathy Study

Amylopathy is a term that describes abnormal synthesis and accumulation of amyloid beta (A&beta;) in tissues with time. A&beta; is a hallmark of Alzheimer's disease (AD) and is found in Lewy body dementia, inclusion body myositis and cerebral amyloid angiopathy 1-4. Amylopathies progressively develop with time. For this reason simple organisms with short lifespans may help to elucidate molecular aspects of these conditions. Here, we describe experimental protocols to study A&beta;-mediated neurodegeneration using the worm Caenorhabditis elegans. Thus, we construct transgenic worms by injecting DNA encoding human A&beta;42 into the syncytial gonads of adult hermaphrodites. Transformant lines are stabilized by a mutagenesis-induced integration. Nematodes are age synchronized by collecting and seeding their eggs. The function of neurons expressing A&beta;42 is tested in opportune behavioral assays (chemotaxis assays). Primary neuronal cultures obtained from embryos are used to complement behavioral data and to test the neuroprotective effects of anti-apoptotic compounds.

A Caenorhabditis elegans Model System for Amylopathy Study

We describe methods to study aspects of amylopathies in the worm C. elegans. We show how to construct worms expressing human A&beta;42 in neurons and how to test their function in behavioral assays. We further show how to obtain primary neuronal cultures that can be used for pharmacological testing.

<em&gt; Caenorhabditis의 엘레</emAmylopathy 연구에 대한&gt; 모델 시스템

Amylopathy is a term that describes abnormal synthesis and accumulation of amyloid beta (A&beta;) in tissues with time. A&beta; is a hallmark of ...

Use of a Caspase Multiplexing Assay to Determine Apoptosis in a Hypothalamic Cell Model

The ability to multiplex assays in studies of complex cellular mechanisms eliminates the need for repetitive experiments, provides internal controls, and decreases waste in costs and reagents. Here we describe optimization of a multiplex assay to assess apoptosis following a palmitic acid (PA) challenge in an in vitro hypothalamic model, using both fluorescent and luminescent based assays to measure viable cell counts and caspase-3/7 activity in a 96-well microtiter plate format. Following PA challenge, viable cells were determined by a resazurin-based fluorescent assay. Caspase-3/7 activity was then determined using a luminogenic substrate, DEVD, and normalized to cell number. This multiplexing assay is a useful technique for determining change in caspase activity following an apoptotic stimulus, such as saturated fatty acid challenge. The saturated fatty acid PA can increase hypothalamic oxidative stress and apoptosis, indicating the potential importance of assays such as that described here in studying the relationship between saturated fatty acids and neuronal function.

Multiplex assays can provide beneficial information for basic cellular mechanisms&#160;and eliminate waste of reagents and unnecessary repetitive experiments. We describe here a multiplex caspase-3/7 activity assay, using fluorescent- and luminescent-based methods, to determine cell viability in an in vitro hypothalamic model following oxidative challenge with palmitic acid.

시상 하부 세포 모델에서 세포 사멸을 결정하는 카스파 다중 분석의 사용

The ability to multiplex assays in studies of complex cellular mechanisms eliminates the need for repetitive experiments, provides internal controls, and ...

Inducing Plasticity of Astrocytic Receptors by Manipulation of Neuronal Firing Rates

Close to two decades of research has established that astrocytes in situ and in vivo express numerous G protein-coupled receptors (GPCRs) that can be stimulated by neuronally-released transmitter. However, the ability of astrocytic receptors to exhibit plasticity in response to changes in neuronal activity has received little attention. Here we describe a model system that can be used to globally scale up or down astrocytic group I metabotropic glutamate receptors (mGluRs) in acute brain slices. Included are methods on how to prepare parasagittal hippocampal slices, construct chambers suitable for long-term slice incubation, bidirectionally manipulate neuronal action potential frequency, load astrocytes and astrocyte processes with fluorescent Ca2+ indicator, and measure changes in astrocytic Gq GPCR activity by recording spontaneous and evoked astrocyte Ca2+ events using confocal microscopy. In essence, a &#8220;calcium roadmap&#8221; is provided for how to measure plasticity of astrocytic Gq GPCRs. Applications of the technique for study of astrocytes are discussed. Having an understanding of how astrocytic receptor signaling is affected by changes in neuronal activity has important implications for both normal synaptic function as well as processes underlying neurological disorders and neurodegenerative disease.

Here we describe an adaptation of protocols used to induce homeostatic plasticity in neurons for the study of plasticity of astrocytic G protein-coupled receptors. Recently used to examine changes in astrocytic group I mGluRs in juvenile mice, the method can be applied to measure scaling of various astrocytic GPCRs, in tissue from adult mice in situ and in vivo, and to gain a better appreciation of the sensitivity of astrocytic receptors to changes in neuronal activity.

신경 발사 환율의 조작에 의해 성상 세포 수용체의 가소성을 유도

Close to two decades of research has established that astrocytes in situ and in vivo express numerous G protein-coupled receptors (GPCRs) that can be ...