This work was supported by research grants from United Arab Emirates University (UAEU) - grant #12M105, grant #12R167 (Zayed Center for Health Sciences), 21R105 (Zayed Bin Sultan Charitable and Humanitarian Foundation (ZCHF)), and ASPIRE, the technology program management pillar of Abu Dhabi&#39;s Advanced Technology Research Council (ATRC), via the ASPIRE Precision Medicine Research Institute Abu Dhabi (ASPIREPMRIAD) award grant number VRI-20-10.

The details of the gene sequences, reagents, and equipment used in this study are listed in the Table of Materials.
1. Single guide RNA (sgRNA) design, cloning, and lentiviral vector production
NOTE: Two different sgRNA sequences targeting the exon 1 of the L2HGDH gene, both adapted from Qiu et al.6with PAM sites of AGG and TGG for sequences 1 and 2, respectively, are used. Both sgRNAs were 20 bp in length, and ends were modified to add linker sequences for restriction enzyme Bsmb1 to be cloned in the target vector (LentiCRISPRv2) as described in the previous report6. Linker sequences were added during the designing of sgRNAs for cloning purposes.
<ol>
	<li>Anneal chemically synthesized sgRNAs6 and clone into Bsmb1 single cut lentiviral vector, LentiCRISPRv2 using optimized protocol as previously reported7.</li>
	<li>Proceed with lentiviral packaging and concentration using standardized and optimized protocol7.</li>
	<li>For lentivirus production, seed HEK293T cells (1 &#215; 105 cells/cm2) using DMEM, 10% FBS and 1x penicillin/streptomycin (P/S) and incubate overnight in tissue culture incubator at 37 &#176;C in an atmosphere of 5% CO2 under humid conditions.</li>
	<li>When 90% confluent, co-transfect HEK293T cells with entry vector (empty backbone or sgRNA expressing plasmids) and packaging plasmids using low-cost cationic polymer PEI as described previously7.</li>
	<li>Collect the conditioned media containing Lentiviral supernatant (LVS) particles at 48 h and 72 h post-transfection and proceed with ultracentrifugation using sucrose cushion and spin the tubes at 1,25,000 x g for 2 h at 4 &#176;C.</li>
	<li>Proceed with the LVS particle concentration to at least 200 times the original volume in PBS, aliquot, and store at -80&#160;&#176;C until use.</li>
	<li>Determine the titer of lentiviral particles by using the qPCR Lentivirus Titer Kit following the manufacturer&#39;s instructions (see Table of Materials).</li>
</ol>
2. Lentiviral infections and single-cell clonal propagation
<ol>
	<li>For infections with LVS particles, seed hESC (H9) cell suspension having 1 &#215; 105 cells/0.5 mL of hESC culture media (Basal media + P/S + 10 &#181;M of Rock Inhibitor) on complete Matrigel (1:50) coated P24 well plates in 500 &#181;L of media and incubate overnight to allow the cells to attach. Seed extra wells that would not be infected with LVS but treated with puromycin to serve as non-infected control. 
	NOTE: Cell counting can be performed using a manual hemocytometer or automated cell counter.</li>
	<li>The following day, infect the cells at Multiplicity of Infection (MOI) of 10 along with 8 &#181;g/mL of polybrene and incubate at 37&#160;&#176;C for 8 h followed by media replacement with fresh hESC media + P/S without Rock Inhibitor and continue culturing until cells are 90% confluent.</li>
	<li>Start puromycin selection by supplementing the media with 0.8 &#181;g/mL concentration of puromycin when cells reach 90% confluency, which is usually 48-72 h post-infection, and continue the selection until all cells die in the non-infected cells (control group).</li>
	<li>After the selection is complete (usually 4-6 days), split stable cells (1:4) and expand for cryopreservation and further analysis.</li>
	<li>Perform single-cell selection and clonal expansion using cells expressing L2HGDH-sgRNA-16.</li>
	<li>For this purpose, prepare a cell suspension equivalent to 500 cells/10 mL of complete growth media and seed 100 &#181;L of this suspension in each well of a 96-well plate.</li>
	<li>Leave the cells undisturbed for 3 days and then observe.</li>
	<li>Mark the wells that yield single clones and change the media every other day until a sufficient size is achieved for the colonies (usually 2 weeks) to expand further, cryopreserve, and analyze.</li>
</ol>
3. gDNA extraction, MS-BSP PCR, and Sanger sequencing
<ol>
	<li>Isolate gDNA from cells using the genomic DNA isolation Kit following the manufacturer&#39;s instructions (see Table of Materials).</li>
	<li>Proceed with the mapping of mutation sites upstream of the PAM recognition sequences using Mutation Sites Based Specific Primers (MS-BSP) analysis8.</li>
	<li>For this, an unbiased right primer L2H-UMSBSP-R1 is designed to amplify the region outside the Exon1 to amplify any targets.</li>
	<li>Design a biased left primer L2H-BMSBSP-F1 with an identical sequence to sgRNA to amplify the target sequence close to PAM recognition sequences. 
	NOTE: At very high stringent conditions of PCR, the product will be observed on the gel in unmutated clones. No product would be observed in CRISPR-knockout clones exhibiting mutations close to upstream of PAM recognition sequences.</li>
	<li>In order to map single base pair mutations, PCR amplify a 468 bp sequence spanning the whole exon 1 of L2HGDH and subject to Sanger sequencing followed by multiple sequence alignment analysis using clustalw8.</li>
</ol>
4. hESC-differentiation and embryoid body (EB) formation assay
<ol>
	<li>Proceed with the directed differentiation of control and different CRISPR clones of hESCs (H9) towards neuro-ectoderm fate following established protocols as previously described using dual smad inhibition method9,10,11.</li>
	<li>When at 90% confluency, treat the cells with LDN193189 (200 nM) and SB431542 (10 &#181;M) for an initial 24 h in 100% KSR media followed by the addition of XAV939 (2 &#181;M) for additional 2 days.</li>
	<li>After 3 days, reduce the percentage of KSR media (Knockout DMEM supplemented with 15% (v/v) KSR, 1% (v/v) L-glutamine, 1% (v/v) P/S, 1% (v/v) 10 mM MEM, and 0.1% (v/v) 2-mercaptoethanol (75%, 50%, 25%) by combining with N2 media (DMEM/F12 supplemented with 1x N2 supplement, 1x P/S,) to 100% N2 media over a period of 8 days.</li>
	<li>At the beginning of Day 12, fix the cells for immunostaining using PAX6 as a neuro-ectoderm marker.</li>
	<li>For mesoderm and endodermal fate determination studies, employ a small molecule CHIR99021-based approach described in previous publications12,13.</li>
	<li>For this, when the cells reach 70% confluency, treat with 3 &#181;M of CHIR99021 in Definitive Endoderm (DE) media for 24 h followed by fixation for immunostaining using Brachuary as mesoderm-specific marker.</li>
	<li>For the endodermal stage, culture the cells for an additional 24 h in DE media alone without the addition of CHIR99021 before fixing for immunostaining using FOXA2.</li>
	<li>For EB formation assay, seed the cells on low attachment cell surfaces without using Matrigel to culture cells under suspension conditions for 24 h before taking micrographs.</li>
</ol>
5. Western blot analysis
<ol>
	<li>Wash the cells twice using PBS and lyse using 1x RIPA buffer containing 1% SDS and 1x protease and phosphatase inhibitor cocktail.</li>
	<li>Clear the lysates by centrifugation at 16,000 x g for 10 min at 4 &#176;C followed by collection of the supernatants.</li>
	<li>Quantify the total cell protein using the BCA protein assay kit following the manufacturer&#39;s instructions. Adjust the samples to 2 &#181;g/&#181;L using 4&#215; loading dye sample buffer.</li>
	<li>Denature the protein samples at 70 &#176;C for 10 min, load equal amounts of each sample, and resolve using 4%-12% gradient SDS-PAGE gels7 followed by transfer to PVDF membrane at a constant voltage of 100 V for 1 h at 4 &#176;C.</li>
	<li>Block the membranes using 5% non-fat milk and incubate in primary antibody dilutions at 4 &#176;C overnight with rotation.</li>
	<li>Next, wash the membranes 5x using PBST buffer and incubate in HRP-conjugated appropriate secondary antibodies for 1 h at room temperature.</li>
	<li>Wash the membranes again with PBST 5x, incubate with chemiluminescent substrate, and develop using X-ray films.</li>
</ol>
6. Immunostaining
<ol>
	<li>Seed the cells on P4 well plates and incubate for at least 24 h before fixation to allow proper attachment of cells to surfaces.</li>
	<li>Wash the cells 3x with PBS to remove any dead cells as well as media components, followed by fixation using 4% PFA for 15 min at room temperature.</li>
	<li>Permeabilize the cells by using 0.3% triton X-100 followed by blocking for nonspecific binding by using 2% BSA in PBS for 1 h at room temperature.</li>
	<li>Incubate the samples with primary antibodies (OCT4, NANOG, SOX2, KI67, PAX6, Brachuary, FOXA2) diluted in 1% BSA overnight at 4 &#176;C.</li>
	<li>Wash the cells 3x with PBS and incubate with appropriate secondary antibodies (Goat anti-mouse 488, Goat anti-rabbit 488, Goat anti-mouse 546, Goat anti-rabbit 546) diluted in 1% BSA for 1 h at room temperature.</li>
	<li>Finally, wash the samples with PBS 3x and counterstain them with DAPI and image using a fluorescence microscope.</li>
</ol>

<ol>
	<li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Jiang, F., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9+structures+and+mechanisms.">CRISPR-Cas9 structures and mechanisms.</a> Annu Rev Biophys. 46 (1), 505-529 (2017).</li><li>Mali, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-guided+human+genome+engineering+via+Cas9.">RNA-guided human genome engineering via Cas9.</a> Science. 339 (6121), 823-826 (2013).</li><li>Xue, C., Greene, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+repair+pathway+choices+in+CRISPR-Cas9-mediated+genome+editing.">DNA repair pathway choices in CRISPR-Cas9-mediated genome editing.</a> Trends Genet. 37 (7), 639-656 (2021).</li><li>Zhang, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9+genome-editing+system+in+human+stem+cells:+Current+status+and+future+prospects.">CRISPR/Cas9 genome-editing system in human stem cells: Current status and future prospects.</a> Mol Ther Nucleic Acids. 9, 230-241 (2017).</li><li>Qiu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MYC+regulation+of+D2HGDH+and+L2HGDH+influences+the+epigenome+and+epitranscriptome.">MYC regulation of D2HGDH and L2HGDH influences the epigenome and epitranscriptome.</a> Cell Chem Biol. 27 (5), 538-550.e537 (2020).</li><li>Sheikh, M. A., Ansari, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+mediated+delivery+of+shRNAs+to+hESCs+and+NPCs+using+low-cost+cationic+polymer+polyethylenimine+(PEI).">Lentiviral mediated delivery of shRNAs to hESCs and NPCs using low-cost cationic polymer polyethylenimine (PEI).</a> J Vis Exp. (183), e63953 (2022).</li><li>Guo, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple+and+cost-effective+method+for+screening+of+CRISPR/Cas9-induced+homozygous/biallelic+mutants.">A simple and cost-effective method for screening of CRISPR/Cas9-induced homozygous/biallelic mutants.</a> Plant Methods. 14 (1), 40 (2018).</li><li>Ardah, M. T., Parween, S., Varghese, D. S., Emerald, B. S., Ansari, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Saturated+fatty+acid+alters+embryonic+cortical+neurogenesis+through+modulation+of+gene+expression+in+neural+stem+cells.">Saturated fatty acid alters embryonic cortical neurogenesis through modulation of gene expression in neural stem cells.</a> J Nutr Biochem. 62, 230-246 (2018).</li><li>Parween, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Higher+O-GlcNAc+levels+are+associated+with+defects+in+progenitor+proliferation+and+premature+neuronal+differentiation.">Higher O-GlcNAc levels are associated with defects in progenitor proliferation and premature neuronal differentiation.</a> Front Cell Neurosci. 11, 415 (2017).</li><li>Parween, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nutrient-sensitive+protein+O-GlcNAcylation+modulates+the+transcriptome+through+epigenetic+mechanisms+during+embryonic+neurogenesis.">Nutrient-sensitive protein O-GlcNAcylation modulates the transcriptome through epigenetic mechanisms during embryonic neurogenesis.</a> Life Sci Alliance. 5 (8), e202201385 (2022).</li><li>Varghese, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Developmental+modeling+of+hepatogenesis+using+obese+iPSCs-hepatocyte+differentiation+uncovers+pathological+features.">Developmental modeling of hepatogenesis using obese iPSCs-hepatocyte differentiation uncovers pathological features.</a> Cell Death Dis. 13 (7), 670 (2022).</li><li>Varghese, D. S., Alawathugoda, T. T., Ansari, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fine-tuning+of+hepatocyte+differentiation+from+human+embryonic+stem+cells:+Growth+factor.">Fine-tuning of hepatocyte differentiation from human embryonic stem cells: Growth factor.</a> Stem Cells Int. 2019 (5), 5968236 (2019).</li><li>Jacobs, E. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9-mediated+genome+editing+in+na&#239;ve+human+embryonic+stem+cells.">CRISPR/Cas9-mediated genome editing in na&#239;ve human embryonic stem cells.</a> Sci Rep. 7 (1), 16650 (2017).</li><li>Cuevas-Oca&#241;a, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cell-based+optimized+approach+for+rapid+and+efficient+gene+editing+of+human+pluripotent+stem+cells.">A cell-based optimized approach for rapid and efficient gene editing of human pluripotent stem cells.</a> Int J Mol Sci. 24 (3), 12345 (2023).</li><li>Veres, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Low+incidence+of+off-target+mutations+in+individual+CRISPR-Cas9+and+TALEN-targeted+human+stem+cell+clones+detected+by+whole-genome+sequencing.">Low incidence of off-target mutations in individual CRISPR-Cas9 and TALEN-targeted human stem cell clones detected by whole-genome sequencing.</a> Cell Stem Cell. 15 (1), 27-30 (2014).</li><li>Smith, C., Gore, A., Yan, W., Abalde-Atristain, L., Li, Z., He, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole-genome+sequencing+analysis+reveals+high+specificity+of+CRISPR/Cas9+and+TALEN-based+genome+editing+in+human+iPSCs.">Whole-genome sequencing analysis reveals high specificity of CRISPR/Cas9 and TALEN-based genome editing in human iPSCs.</a> Cell Stem Cell. 15 (1), 12-13 (2014).</li><li>Zhang, X. H., Tee, L. Y., Wang, X. G., Huang, Q. S., Yang, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Off-target+effects+in+CRISPR/Cas9-mediated+genome+engineering.">Off-target effects in CRISPR/Cas9-mediated genome engineering.</a> Mol Ther Nucleic Acids. 4 (7), e264 (2015).</li></ol>

The authors declare that there is no conflict of interest.

This study has standardized a method that enables highly efficient and cost-effective gene deletions in hESCs through CRISPR-Cas9 technology. This method successfully achieved homozygous deletion of the L2HGDH gene in hESCs within 3-4 weeks, starting from hESC infection to single-cell clonal selection and propagation (Table 1). Although CRISPR-Cas9-mediated gene manipulations can be achieved by transient transfections in most cells, this becomes challenging in stem cells due to poor transfection efficien...

Human embryonic stem cells (hESCs) and induced pluripotent stem cells (iPSCs) are stem cells with the potential to differentiate into all cell types in the body. These cells serve as valuable tools for studying human development, as well as for understanding the underlying mechanisms of various diseases, thus offering tremendous promise for regenerative medicine, disease modeling, and drug discovery. Such studies involve investigating how specific genes contribute to the development, functioning, and regulation of organisms1,2.
Various techniques and approaches are employed to decipher gene function, including genetic manipulation, such as gene knockout or overexpression, and genome editing. Among these, CRISPR-Cas9 technology has emerged as the most efficient approach for gene knockout and gene editing studies1,2,3. The CRISPR-Cas9 system works by utilizing a single guide RNA (sgRNA) molecule specifically designed to identify and bind to a particular DNA sequence of interest. Acting as a molecular guide, the sgRNA directs the Cas9 enzyme to the precise location in the genome that requires modification. Once bound, Cas9 initiates a double-stranded break in the DNA at the designated site. Following the cleavage of DNA, the cell&#39;s inherent repair mechanisms are activated. These include two main repair pathways: non-homologous end joining (NHEJ) and homology-directed repair (HDR). NHEJ often results in insertions or deletions (indels) at the break site, leading to gene disruption or inactivation. Conversely, HDR enables the insertion of new DNA sequences at the break site, facilitating the introduction of targeted genetic alterations4.
Given the importance of gene deletions in pluripotent stem cells, several protocols have been published on CRISPR-Cas9-mediated gene knockouts in hESCs/iPSCs. However, many of these protocols face significant limitations, such as being extremely time-consuming, labor-intensive, and having low efficiency due to the use of non-viral gene delivery methods5. These challenges are even more pronounced in hESCs/iPSCs, as these cells are known to have lower editing efficiency compared to other cell types5. Some of these limitations can be addressed by increasing the efficiency of plasmid delivery containing Cas9 and sgRNAs. This can be successfully achieved using a lentiviral vector system, which can significantly improve gene editing outcomes. Lentivirus packaging protocols are well-established and straightforward, allowing easy adoption in laboratories, even by researchers with limited experience. Lentiviruses exhibit high infection efficiency across various cell types, including hESCs and iPSCs. Therefore, utilizing a lentiviral system for Cas9-sgRNA expression is ideal for routine gene editing experiments in hESCs/iPSCs for gene function studies.
Here, we provide a simple and straightforward method for highly efficient CRISPR-Cas9-based gene deletions in hESCs in a comparatively shorter time duration than conventional protocols (Figure 1). Although a lentiviral vector with constitutive expression of Cas9 and sgRNA has been used, it could easily be replaced with drug-inducible Cas9 expression for controllable Cas9 expression.

<table><tbody><tr><td>2-MERCAPTOETHANOL&amp;nbsp;</td><td>Invitrogen</td><td>31350010</td><td></td></tr><tr><td>38.5 mL, Sterile + Certified Free Open-Top&lt;br/&gt; Thinwall Ultra-Clear Tubes</td><td>Beckman Coulter</td><td>C14292</td><td></td></tr><tr><td>Accutase</td><td>Stem cell technologies</td><td>7920</td><td></td></tr><tr><td>bFGF Recombinant human</td><td>Invitrogen</td><td>PHG0261</td><td></td></tr><tr><td>Brachyury Rabbit mAb</td><td>Abclonal</td><td>A5078</td><td></td></tr><tr><td>BsmBI-v2</td><td>NEB</td><td>R0739S</td><td></td></tr><tr><td>chir99021</td><td>Tocris</td><td>4423/10</td><td></td></tr><tr><td>Corning Matrigel Basement Membrane Matrix, LDEV-free</td><td>Corning</td><td>354234</td><td></td></tr><tr><td>Cyclopamine</td><td>Stem cell technologies</td><td>72074</td><td></td></tr><tr><td>DMEM media</td><td>Invitrogen</td><td>11995073</td><td></td></tr><tr><td>DMEM NUTRIENT MIX F12&amp;nbsp;</td><td>Invitrogen</td><td>11320033</td><td></td></tr><tr><td>DPBS w/o: Ca and Mg</td><td>PAN Biotech</td><td>P04-36500</td><td></td></tr><tr><td>Fetal bovie serum</td><td>Invitrogen</td><td>10270106</td><td></td></tr><tr><td>FoxA2/HNF3&amp;beta;&amp;nbsp;</td><td>CST</td><td>8186</td><td></td></tr><tr><td>GAPDH (14C10) Rabbit mAb Antibody</td><td>CST</td><td>2118S</td><td></td></tr><tr><td>Gentle Cell Dissociation Reagent</td><td>Stem cell technologies</td><td>7174</td><td></td></tr><tr><td>HyClone Non Essential Amino Acids (NEAA) 100x Solution</td><td>GE healthcare</td><td>SH30238.01</td><td></td></tr><tr><td>Ki-67 (D3B5) Rabbit mAb</td><td>CST</td><td>9129</td><td></td></tr><tr><td>KnockOut Serum Replacement</td><td>Invitrogen</td><td>10828028</td><td></td></tr><tr><td>L GLUTAMINE, 100x</td><td>Invitrogen</td><td>2924190090</td><td></td></tr><tr><td>L2H-BMSBSP-F1</td><td>Macrogen</td><td></td><td>CGTGCGGGTTCGCGTCTGGG</td></tr><tr><td>L2HGDH Polyclonal antibody</td><td>Proteintech</td><td>15707-1-AP</td><td></td></tr><tr><td>L2HGDH-SgRNA1-F</td><td>Macrogen</td><td></td><td>CACCGCGTGCGG&lt;br/&gt; GTTCGCGTCTGGG</td></tr><tr><td>L2HGDH-SgRNA1-R</td><td>Macrogen</td><td></td><td>AAACCCCAGACGC&lt;br/&gt; GAACCCGCACGC</td></tr><tr><td>L2HGDH-SgRNA2-F</td><td>Macrogen</td><td></td><td>CACCGCCCGCGG&lt;br/&gt; GCTTTTCGCCGG</td></tr><tr><td>L2HGDH-SgRNA2-R</td><td>Macrogen</td><td></td><td>AAACCCGGCGAA&lt;br/&gt; AAGCCCGCGGGC</td></tr><tr><td>L2H-SeqF1</td><td>Macrogen</td><td></td><td>GCTAAAGAGCGC&lt;br/&gt; GGGTCCTCGG</td></tr><tr><td>L2H-SeqR1</td><td>Macrogen</td><td></td><td>GTGGACGGGTTG&lt;br/&gt; TTCAAAGCCAGAG</td></tr><tr><td>L2H-UMSBSP-R1</td><td>Macrogen</td><td></td><td>GTGGACGGGTTG&lt;br/&gt; TTCAAAGCCAGAG</td></tr><tr><td>LentiCRISPRv2</td><td>Addgene</td><td>52961</td><td></td></tr><tr><td>mTesR1 complete media</td><td>Stem cell technologies</td><td>85850</td><td></td></tr><tr><td>Nanog Antibody</td><td>CST</td><td>3580</td><td></td></tr><tr><td>NEUROBASAL MEDIUM 1x CTS</td><td>Invitrogen</td><td>A1371201</td><td></td></tr><tr><td>Neuropan 2 Supplement 100x</td><td>PAN Biotech</td><td>P07-11050</td><td></td></tr><tr><td>Neuropan 27 Supplement 50x</td><td>PAN Biotech</td><td>P07-07200</td><td></td></tr><tr><td>Oct-4 Antibody</td><td>CST</td><td>2750</td><td></td></tr><tr><td>Pax6 (D3A9V) XP Rabbit mAb</td><td>CST</td><td>60433</td><td></td></tr><tr><td>PENICILLIN STREPTOMYCIN SOL</td><td>Invitrogen</td><td>15140122</td><td></td></tr><tr><td>pMD2.G</td><td>Addgene</td><td>12259</td><td></td></tr><tr><td>Polybrene infection reagent</td><td>Sigma</td><td>TR1003- G</td><td></td></tr><tr><td>Polyethylenimine, branched</td><td>Sigma</td><td>408727</td><td></td></tr><tr><td>psPAX2.0</td><td>Addgene</td><td>12260</td><td></td></tr><tr><td>Puromycin</td><td>Invitrogen</td><td>A1113802</td><td></td></tr><tr><td>qPCR Lentivirus Titer Kit</td><td>Abm</td><td>LV900</td><td></td></tr><tr><td>Rock inhibitor Y-27632&lt;br/&gt; dihydrochloride&amp;nbsp;</td><td>Tocris</td><td>1254</td><td></td></tr><tr><td>SB 431542</td><td>Tocris</td><td>1614/10</td><td></td></tr><tr><td>Sox2 Antibody</td><td>CST</td><td>2748</td><td></td></tr><tr><td>Sucrose</td><td>Sigma</td><td>57-50-1</td><td></td></tr><tr><td>TRYPSIN .05% EDTA&amp;nbsp;</td><td>Invitrogen</td><td>25300062</td><td></td></tr><tr><td>U6-459F</td><td>Macrogen</td><td></td><td>GAGGGCCTATT&lt;br/&gt; TCCCATGATTC</td></tr><tr><td>Wizard Genomic DNA Purification Kit&amp;nbsp;</td><td>Promega</td><td>A1120</td><td></td></tr><tr><td>XAV 939</td><td>Tocris</td><td>3748/10</td><td></td></tr></tbody></table>

crispr-cas9 mediated gene deletion in human pluripotent stem cells cultured under feeder-free conditions

The CRISPR-Cas9 system for genome editing has revolutionized gene function studies in mammalian cells, including stem cells. However, the practical application of this technique, particularly in pluripotent stem cells, presents certain challenges, such as being time- and labor-intensive and having low editing efficiency. Here, we describe the generation of a CRISPR-mediated gene knockout in a human embryonic stem cell (hESC) line stably expressing sgRNAs for the L2HGDH gene, using a highly efficient and stable lentiviral-mediated gene delivery system. The sgRNAs targeting exon 1 of the L2HGDH gene were chemically synthesized and cloned into the lentiCRISPR v2-puro vector, which combines the constitutive expression of sgRNAs with Cas9 in a highly efficient single-vector system to achieve higher lentiviral titers for hESC infection and stable selection using puromycin. Puromycin-selected cells were further expanded, and single-cell clones were obtained using the limited dilution method. The single clones were expanded, and several homozygous knockout clones for the L2HGDH gene were obtained, as confirmed by a 100% reduction in L2HGDH expression using Western blot analysis. Furthermore, using MSBSP-PCR, the CRISPR mutation site was mapped upstream of the PAM recognition sequence of Cas9 in the selected homozygous clones. Sanger sequencing was performed to analyze the exact insertions/deletions, and functional characterization of the clones was conducted. This method produced a significantly higher percentage of homozygous deletions compared to previously reported non-viral gene delivery methods. Although this report focuses on the L2HGDH gene, this robust and cost-effective approach can be used to create homozygous knockouts for other genes in pluripotent stem cells for gene function studies.

Cloning of L2HGDH sgRNAs in lentiCRISPRv2 puro 
lentiCRISPRv2 puro vector was commercially obtained (see Table of Materials) and digested with BsmB1, which resulted in the release of a 1.8 Kb stuffer fragment. As shown in Figure 2A, a complete digestion of the vector was observed. For each construct, six clones were screened for the presence or absence of insert using reverse sgRNA sequence as a primer and a forward primer (U6-459F) from within the vect...

CRISPR-Cas9 Mediated Gene Deletion in Human Pluripotent Stem Cells Cultured Under Feeder-Free Conditions

The presented method describes the generation of a CRISPR-mediated gene knockout in the human embryonic stem cell (hESC) line H9, which stably expresses sgRNAs targeting the L2HGDH gene using a highly efficient lentiviral-mediated gene delivery system.

The CRISPR-Cas9 system for genome editing has revolutionized gene function studies in mammalian cells, including stem cells. However, the practical ...

crispr-cas9-mediated-gene-deletion-human-pluripotent-stem-cells

Research

JoVE Journal

Biology

591 Views.  United Arab Emirates University. Zaai om te beginnen de menselijke embryonale stamcelsuspensie op een met Matrigel gecoate P24-putplaat met 500 microliter media. Incubeer 's nachts om celhechting mogelijk te maken. Infecteer de volgende dag de aangehechte cellen met een veelvoud van infectie van 10, samen met acht microgram per milliliter polybreen.Incubeer de cellen bij 37 graden Celsius gedurende acht uur. Vervang na incubatie de media door verse media aangevuld met penicilline stre...

Video: CRISPR-Cas9 gemedieerde gendeletie in menselijke pluripotente stamcellen gekweekt onder feedervrije omstandigheden

Genome Editing and Directed Differentiation of hPSCs for Interrogating Lineage Determinants in Human Pancreatic Development

Interrogating gene function in self-renewing or differentiating human pluripotent stem cells (hPSCs) offers a valuable platform towards understanding human development and dissecting disease mechanisms in a dish. To capitalize on this potential application requires efficient genome-editing tools to generate hPSC mutants in disease-associated genes, as well as in vitro hPSC differentiation protocols to produce disease-relevant cell types that closely recapitulate their in vivo counterparts. An efficient genome-editing platform for hPSCs named iCRISPR has been developed through the TALEN-mediated targeting of a Cas9 expression cassette in the AAVS1 locus. Here, the protocols for the generation of inducible Cas9 hPSC lines using cells cultured in a chemically defined medium and a feeder-free condition are described. Detailed procedures for using the iCRISPR system for gene knockout or precise genetic alterations in hPSCs, either through non-homologous end joining (NHEJ) or via precise nucleotide alterations using a homology-directed repair (HDR) template, respectively, are included. These technical procedures include descriptions of the design, production, and transfection of CRISPR guide RNAs (gRNAs); the measurement of the CRISPR mutation rate by T7E1 or RFLP assays; and the establishment and validation of clonal mutant lines. Finally, we chronicle procedures for hPSC differentiation into glucose-responsive pancreatic &#946;-like cells by mimicking in vivo pancreatic embryonic development. Combining iCRISPR technology with directed hPSC differentiation enables the systematic examination of gene function to further our understanding of pancreatic development and diabetes disease mechanisms.

Protocols to generate hPSC mutant lines using the iCRISPR platform and to differentiate hPSCs into glucose-responsive &#946;-like cells are described. Combining genome editing technology with hPSC-directed differentiation provides a powerful platform for the systematic analysis of the role of lineage determinants in human development and disease progression.

Interrogating gene function in self-renewing or differentiating human pluripotent stem cells (hPSCs) offers a valuable platform towards understanding ...

Genetics

Generating CRISPR/Cas9 Mediated Monoallelic Deletions to Study Enhancer Function in Mouse Embryonic Stem Cells

Enhancers control cell identity by regulating tissue-specific gene expression in a position and orientation independent manner. These enhancers are often located distally from the regulated gene in intergenic regions or even within the body of another gene. The position independent nature of enhancer activity makes it difficult to match enhancers with the genes they regulate. Deletion of an enhancer region provides direct evidence for enhancer activity and is the gold standard to reveal an enhancer's role in endogenous gene transcription. Conventional homologous recombination based deletion methods have been surpassed by recent advances in genome editing technology which enable rapid and precisely located changes to the genomes of numerous model organisms. CRISPR/Cas9 mediated genome editing can be used to manipulate the genome in many cell types and organisms rapidly and cost effectively, due to the ease with which Cas9 can be targeted to the genome by a guide RNA from a bespoke expression plasmid. Homozygous deletion of essential gene regulatory elements might lead to lethality or alter cellular phenotype whereas monoallelic deletion of transcriptional enhancers allows for the study of cis-regulation of gene expression without this confounding issue. Presented here is a protocol for CRISPR/Cas9 mediated deletion in F1 mouse embryonic stem (ES) cells (Mus musculus129 x Mus castaneus). Monoallelic deletion, screening and expression analysis is facilitated by single nucleotide polymorphisms (SNP) between the two alleles which occur on average every 125 bp in these cells.

Experimental validation of enhancer activity is best approached by loss-of-function analysis. Presented here is an efficient protocol that uses CRISPR/Cas9 mediated deletion to study allele-specific regulation of gene transcription in F1 ES cells which contain a hybrid genome (Mus musculus129 x Mus castaneus).

Enhancers control cell identity by regulating tissue-specific gene expression in a position and orientation independent manner. These enhancers are often ...

Developmental Biology

Establishment of Genome-edited Human Pluripotent Stem Cell Lines: From Targeting to Isolation

Genome-editing of human pluripotent stem cells (hPSCs) provides a genetically controlled and clinically relevant platform from which to understand human development and investigate the pathophysiology of disease. By employing site-specific nucleases (SSNs) for genome editing, the rapid derivation of new hPSC lines harboring specific genetic alterations in an otherwise isogenic setting becomes possible. Zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 are the most commonly used SSNs. All of these nucleases function by introducing a double stranded DNA break at a specified site, thereby promoting precise gene editing at a genomic locus. SSN-meditated genome editing exploits two of the cell&#39;s endogenous DNA repair mechanisms, non-homologous end joining (NHEJ) and homology directed repair (HDR), to either introduce insertion/deletion mutations or alter the genome using a homologous repair template at the site of the double stranded break. Electroporation of hPSCs is an efficient means of transfecting SSNs and repair templates that incorporate transgenes such as fluorescent reporters and antibiotic resistance cassettes. After electroporation, it is possible to isolate only those hPSCs that incorporated the repair construct by selecting for antibiotic resistance. Mechanically separating hPSC colonies and confirming proper integration at the target site through genotyping allows for the isolation of correctly targeted and genetically homogeneous cell lines. The validity of this protocol is demonstrated here by using all three SSN platforms to incorporate EGFP and a puromycin resistance construct into the AAVS1 safe harbor locus in human pluripotent&#160;stem cells.

Genome editing of human pluripotent stem cells (hPSCs) can be done quickly and efficiently. Presented here is a robust experimental procedure to genetically engineer hPSCs as exemplified by editing the AAVS1 safe harbor locus to express EGFP and introduce antibiotic resistance.

Genome-editing of human pluripotent stem cells (hPSCs) provides a genetically controlled and clinically relevant platform from which to understand human ...

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. Complete gene ablation in HSCs required the generation of knockout mice from which HSCs could be isolated, and gene ablation in primary human HSCs was not possible. Viral transduction could be used for knock-down approaches, but these suffered from variable efficacy. In general, genetic manipulation of human and mouse hematopoietic cells was hampered by low efficiencies and extensive time and cost commitments. Recently, CRISPR/Cas9 has dramatically expanded the ability to engineer the DNA of mammalian cells. However, the application of CRISPR/Cas9 to hematopoietic cells has been challenging, mainly due to their low transfection efficiencies, the toxicity of plasmid-based approaches and the slow turnaround time of virus-based protocols.
A rapid method to perform CRISPR/Cas9-mediated gene editing in murine and human hematopoietic stem and progenitor cells with knockout efficiencies of up to 90% is provided in this article. This approach utilizes a ribonucleoprotein (RNP) delivery strategy with a streamlined three-day workflow. The use of Cas9-sgRNA RNP allows for a hit-and-run approach, introducing no exogenous DNA sequences in the genome of edited cells and reducing off-target effects. The RNP-based method is fast and straightforward: it does not require cloning of sgRNAs, virus preparation or specific sgRNA chemical modification. With this protocol, scientists should be able to successfully generate knockouts of a gene of interest in primary hematopoietic cells within a week, including downtimes for oligonucleotide synthesis. This approach will allow a much broader group of users to adapt this protocol for their needs.

A protocol for fast CRISPR/Cas9-mediated gene disruption in mouse and human primary hematopoietic cells is described in this article. Cas9-sgRNA ribonucleoproteins are introduced via electroporation with sgRNAs generated through in vitro transcription and commercial Cas9. High editing efficiencies are achieved with limited time and financial cost.

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise heterozygous genetic modifications is challenging due to CRISPR-CAS9 mediated indel formation in the second allele. Here, we demonstrate a protocol to help overcome this difficulty by using two repair templates in which only one expresses the desired sequence change, while both templates contain silent mutations to prevent re-cutting and indel formation. This methodology is most advantageous for gene editing coding regions of DNA to generate isogenic control and mutant human stem cell lines for studying human disease and biology. In addition, optimization of transfection and screening methodologies have been performed to reduce labor and cost of a gene editing experiment. Overall, this protocol is widely applicable to many genome editing projects utilizing the human pluripotent stem cell model.

This protocol provides a method to facilitate the generation of defined heterozygous or homozygous nucleotide changes using CRISPR-CAS9 in human pluripotent stem cells.

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise ...

Introducing Point Mutations into Human Pluripotent Stem Cells Using Seamless Genome Editing

Custom designed endonucleases, such as RNA-guided Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9, enable efficient genome editing in mammalian cells. Here we describe detailed procedures to seamlessly genome edit the hepatocyte nuclear factor 4 alpha (HNF4&#945;) locus as an example in human pluripotent stem cells. Combining a piggyBac-based donor plasmid and the CRISPR-Cas9 nickase mutant in a two-step genetic selection, we demonstrate correct and efficient targeting of the HNF4&#945; locus.

Here, we describe a detailed method for seamless gene editing in human pluripotent stem cells using a piggyBac-based donor plasmid and the Cas9 nickase mutant. Two point mutations were introduced into exon 8 of the hepatocyte nuclear factor 4 alpha (HNF4&#945;) locus in human embryonic stem cells (hESCs).

Custom designed endonucleases, such as RNA-guided Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9, enable efficient genome editing ...

CRISPR/Cas9 Technology in Restoring Dystrophin Expression in iPSC-Derived Muscle Progenitors

Duchenne muscular dystrophy (DMD) is a severe progressive muscle disease caused by mutations in the dystrophin gene, which ultimately leads to the exhaustion of muscle progenitor cells. Clustered regularly interspaced short palindromic repeats/CRISPR-associated 9 (CRISPR/Cas9) gene editing has the potential to restore the expression of the dystrophin gene. Autologous induced pluripotent stem cells (iPSCs)-derived muscle progenitor cells (MPC) can replenish the stem/progenitor cell pool, repair damage, and prevent further complications in DMD without causing an immune response. In this study, we introduce a combination of CRISPR/Cas9 and non-integrated iPSC technologies to obtain muscle progenitors with recovered dystrophin protein expression. Briefly, we use a non-integrating Sendai vector to establish an iPSC line from dermal fibroblasts of Dmdmdx mice. We then use the CRISPR/Cas9 deletion strategy to restore dystrophin expression through a non-homologous end joining of the reframed dystrophin gene. After PCR validation of exon23 depletion in three colonies from 94 picked iPSC colonies, we differentiate iPSC into MPC by doxycycline (Dox)-induced expression of MyoD, a key transcription factor playing a significant role in regulating muscle differentiation. Our results show the feasibility of using CRISPR/Cas9 deletion strategy to restore dystrophin expression in iPSC-derived MPC, which has significant potential for developing future therapies for the treatment of DMD.

Here, we present a Cas9-based exon23 deletion protocol to restore dystrophin expression in iPSC from Dmdmdx mouse-derived skin fibroblasts and directly differentiate iPSCs into myogenic progenitor cells (MPC) using the Tet-on MyoD activation system.

Duchenne muscular dystrophy (DMD) is a severe progressive muscle disease caused by mutations in the dystrophin gene, which ultimately leads to the ...

Efficient Generation and Editing of Feeder-free IPSCs from Human Pancreatic Cells Using the CRISPR-Cas9 System

Embryonic and induced pluripotent stem cells can self-renew and differentiate into multiple cell types of the body. The pluripotent cells are thus coveted for research in regenerative medicine and are currently in clinical trials for eye diseases, diabetes, heart diseases, and other disorders. The potential to differentiate into specialized cell types coupled with the recent advances in genome editing technologies including the CRISPR/Cas system have provided additional opportunities for tailoring the genome of iPSC for varied applications including disease modeling, gene therapy, and biasing pathways of differentiation, to name a few. Among the available editing technologies, the CRISPR/Cas9 from Streptococcus pyogenes has emerged as a tool of choice for site-specific editing of the eukaryotic genome. The CRISPRs are easily accessible, inexpensive, and highly efficient in engineering targeted edits. The system requires a Cas9 nuclease and a guide sequence (20-mer) specific to the genomic target abutting a 3-nucleotide &#34;NGG&#34; protospacer-adjacent-motif (PAM) for targeting Cas9 to the desired genomic locus, alongside a universal Cas9 binding tracer RNA (together called single guide RNA or sgRNA). Here we present a step-by-step protocol for efficient generation of feeder-independent and footprint-free iPSC and describe methodologies for genome editing of iPSC using the Cas9 ribonucleoprotein (RNP) complexes. The genome editing protocol is effective and can be easily multiplexed by pre-complexing sgRNAs for more than one target with the Cas9 protein and simultaneously delivering into the cells. Finally, we describe a simplified approach for identification and characterization of iPSCs with desired edits. Taken together, the outlined strategies are expected to streamline generation and editing of iPSC for manifold applications.

This protocol describes in detail the generation of footprint-free induced pluripotent stem cells (iPSCs) from human pancreatic cells in feeder-free conditions, followed by editing using CRISPR/Cas9 ribonucleoproteins and characterization of the modified single-cell clones.

Embryonic and induced pluripotent stem cells can self-renew and differentiate into multiple cell types of the body. The pluripotent cells are thus coveted ...

Bioengineering

Feeder-Free Adaptation, Culture and Passaging of Human IPS Cells using Complete KnockOut Serum Replacement Feeder-Free Medium

The discovery in 2006 that human and mouse fibroblasts could be reprogrammed to generate iPS cells 1-3 with qualities remarkably similar to embryonic stem cells has created a valuable new source of pluripotent cells for drug discovery, cell therapy, and basic research.
GIBCO media and reagents have been at the forefront of pluripotent stem cell research for years. Knockout DMEM supplemented with Knockout Serum Replacement is the media of choice for embryonic stem cell growth and now iPS cell culture 3-9. This gold standard media system can now be used for feeder-free culture with the addition of Knockout SR Growth Factor Cocktail.
Traditional human ES and iPS cell culture methods require the use of mouse or human fibroblast feeder layers, or feeder-conditioned medium. These culture methods are labor-intensive, hard to scale and it is difficult to maintain hiPS cells undifferentiated due to the undefined conditions. Invitrogen has developed Knockout SR Growth Factor Cocktail to allow you to easily transition your hiPS cell cultures to feeder-free while still maintaining your use of Knockout SR.

The following protocol provides instruction for adapting human induced Pluripotent Stem (iPS) Cells to feeder-free culture using complete KnockOut Serum Replacement Feeder-Free medium (KSR-FF). Once adapted, instructions for continual maintenance are also provided.

The discovery in 2006 that human and mouse fibroblasts could be reprogrammed to generate iPS cells 1-3 with qualities remarkably similar to embryonic stem ...

Generation of Genomic Deletions in Mammalian Cell Lines via CRISPR/Cas9

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific eukaryotic genome engineering. CRISPR/Cas9 is an inexpensive, facile, and efficient genome editing tool that allows genetic perturbation of genes and genetic elements. Here we present a simple methodology for CRISPR design, cloning, and delivery for the production of genomic deletions. In addition, we describe techniques for deletion, identification, and characterization. This strategy relies on cellular delivery of a pair of chimeric single guide RNAs (sgRNAs) to create two double strand breaks (DSBs) at a locus in order to delete the intervening DNA segment by non-homologous end joining (NHEJ) repair. Deletions have potential advantages as compared to single-site small indels given the efficiency of biallelic modification, ease of rapid identification by PCR, predictability of loss-of-function, and utility for the study of non-coding elements. This approach can be used for efficient loss-of-function studies of genes and genetic elements in mammalian cell lines.

CRISPR/Cas9 is a robust system to produce disruption of genes and genetic elements. Here we describe a protocol for the efficient creation of genomic deletions in mammalian cell lines using CRISPR/Cas9.

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific ...

CRISPR-Cas9 Mediated Gene Deletion in Human Pluripotent Stem Cells Cultured Under Feeder-Free Conditions

Samenvatting

Meer video's verkennen