This work was supported by research grants from United Arab Emirates University (UAEU) - grant #12M105, grant #12R167 (Zayed Center for Health Sciences), 21R105 (Zayed Bin Sultan Charitable and Humanitarian Foundation (ZCHF)), and ASPIRE, the technology program management pillar of Abu Dhabi&#39;s Advanced Technology Research Council (ATRC), via the ASPIRE Precision Medicine Research Institute Abu Dhabi (ASPIREPMRIAD) award grant number VRI-20-10.

The details of the gene sequences, reagents, and equipment used in this study are listed in the Table of Materials.
1. Single guide RNA (sgRNA) design, cloning, and lentiviral vector production
NOTE: Two different sgRNA sequences targeting the exon 1 of the L2HGDH gene, both adapted from Qiu et al.6with PAM sites of AGG and TGG for sequences 1 and 2, respectively, are used. Both sgRNAs were 20 bp in length, and ends were modified to add linker sequences for restriction enzyme Bsmb1 to be cloned in the target vector (LentiCRISPRv2) as described in the previous report6. Linker sequences were added during the designing of sgRNAs for cloning purposes.
<ol>
	<li>Anneal chemically synthesized sgRNAs6 and clone into Bsmb1 single cut lentiviral vector, LentiCRISPRv2 using optimized protocol as previously reported7.</li>
	<li>Proceed with lentiviral packaging and concentration using standardized and optimized protocol7.</li>
	<li>For lentivirus production, seed HEK293T cells (1 &#215; 105 cells/cm2) using DMEM, 10% FBS and 1x penicillin/streptomycin (P/S) and incubate overnight in tissue culture incubator at 37 &#176;C in an atmosphere of 5% CO2 under humid conditions.</li>
	<li>When 90% confluent, co-transfect HEK293T cells with entry vector (empty backbone or sgRNA expressing plasmids) and packaging plasmids using low-cost cationic polymer PEI as described previously7.</li>
	<li>Collect the conditioned media containing Lentiviral supernatant (LVS) particles at 48 h and 72 h post-transfection and proceed with ultracentrifugation using sucrose cushion and spin the tubes at 1,25,000 x g for 2 h at 4 &#176;C.</li>
	<li>Proceed with the LVS particle concentration to at least 200 times the original volume in PBS, aliquot, and store at -80&#160;&#176;C until use.</li>
	<li>Determine the titer of lentiviral particles by using the qPCR Lentivirus Titer Kit following the manufacturer&#39;s instructions (see Table of Materials).</li>
</ol>
2. Lentiviral infections and single-cell clonal propagation
<ol>
	<li>For infections with LVS particles, seed hESC (H9) cell suspension having 1 &#215; 105 cells/0.5 mL of hESC culture media (Basal media + P/S + 10 &#181;M of Rock Inhibitor) on complete Matrigel (1:50) coated P24 well plates in 500 &#181;L of media and incubate overnight to allow the cells to attach. Seed extra wells that would not be infected with LVS but treated with puromycin to serve as non-infected control. 
	NOTE: Cell counting can be performed using a manual hemocytometer or automated cell counter.</li>
	<li>The following day, infect the cells at Multiplicity of Infection (MOI) of 10 along with 8 &#181;g/mL of polybrene and incubate at 37&#160;&#176;C for 8 h followed by media replacement with fresh hESC media + P/S without Rock Inhibitor and continue culturing until cells are 90% confluent.</li>
	<li>Start puromycin selection by supplementing the media with 0.8 &#181;g/mL concentration of puromycin when cells reach 90% confluency, which is usually 48-72 h post-infection, and continue the selection until all cells die in the non-infected cells (control group).</li>
	<li>After the selection is complete (usually 4-6 days), split stable cells (1:4) and expand for cryopreservation and further analysis.</li>
	<li>Perform single-cell selection and clonal expansion using cells expressing L2HGDH-sgRNA-16.</li>
	<li>For this purpose, prepare a cell suspension equivalent to 500 cells/10 mL of complete growth media and seed 100 &#181;L of this suspension in each well of a 96-well plate.</li>
	<li>Leave the cells undisturbed for 3 days and then observe.</li>
	<li>Mark the wells that yield single clones and change the media every other day until a sufficient size is achieved for the colonies (usually 2 weeks) to expand further, cryopreserve, and analyze.</li>
</ol>
3. gDNA extraction, MS-BSP PCR, and Sanger sequencing
<ol>
	<li>Isolate gDNA from cells using the genomic DNA isolation Kit following the manufacturer&#39;s instructions (see Table of Materials).</li>
	<li>Proceed with the mapping of mutation sites upstream of the PAM recognition sequences using Mutation Sites Based Specific Primers (MS-BSP) analysis8.</li>
	<li>For this, an unbiased right primer L2H-UMSBSP-R1 is designed to amplify the region outside the Exon1 to amplify any targets.</li>
	<li>Design a biased left primer L2H-BMSBSP-F1 with an identical sequence to sgRNA to amplify the target sequence close to PAM recognition sequences. 
	NOTE: At very high stringent conditions of PCR, the product will be observed on the gel in unmutated clones. No product would be observed in CRISPR-knockout clones exhibiting mutations close to upstream of PAM recognition sequences.</li>
	<li>In order to map single base pair mutations, PCR amplify a 468 bp sequence spanning the whole exon 1 of L2HGDH and subject to Sanger sequencing followed by multiple sequence alignment analysis using clustalw8.</li>
</ol>
4. hESC-differentiation and embryoid body (EB) formation assay
<ol>
	<li>Proceed with the directed differentiation of control and different CRISPR clones of hESCs (H9) towards neuro-ectoderm fate following established protocols as previously described using dual smad inhibition method9,10,11.</li>
	<li>When at 90% confluency, treat the cells with LDN193189 (200 nM) and SB431542 (10 &#181;M) for an initial 24 h in 100% KSR media followed by the addition of XAV939 (2 &#181;M) for additional 2 days.</li>
	<li>After 3 days, reduce the percentage of KSR media (Knockout DMEM supplemented with 15% (v/v) KSR, 1% (v/v) L-glutamine, 1% (v/v) P/S, 1% (v/v) 10 mM MEM, and 0.1% (v/v) 2-mercaptoethanol (75%, 50%, 25%) by combining with N2 media (DMEM/F12 supplemented with 1x N2 supplement, 1x P/S,) to 100% N2 media over a period of 8 days.</li>
	<li>At the beginning of Day 12, fix the cells for immunostaining using PAX6 as a neuro-ectoderm marker.</li>
	<li>For mesoderm and endodermal fate determination studies, employ a small molecule CHIR99021-based approach described in previous publications12,13.</li>
	<li>For this, when the cells reach 70% confluency, treat with 3 &#181;M of CHIR99021 in Definitive Endoderm (DE) media for 24 h followed by fixation for immunostaining using Brachuary as mesoderm-specific marker.</li>
	<li>For the endodermal stage, culture the cells for an additional 24 h in DE media alone without the addition of CHIR99021 before fixing for immunostaining using FOXA2.</li>
	<li>For EB formation assay, seed the cells on low attachment cell surfaces without using Matrigel to culture cells under suspension conditions for 24 h before taking micrographs.</li>
</ol>
5. Western blot analysis
<ol>
	<li>Wash the cells twice using PBS and lyse using 1x RIPA buffer containing 1% SDS and 1x protease and phosphatase inhibitor cocktail.</li>
	<li>Clear the lysates by centrifugation at 16,000 x g for 10 min at 4 &#176;C followed by collection of the supernatants.</li>
	<li>Quantify the total cell protein using the BCA protein assay kit following the manufacturer&#39;s instructions. Adjust the samples to 2 &#181;g/&#181;L using 4&#215; loading dye sample buffer.</li>
	<li>Denature the protein samples at 70 &#176;C for 10 min, load equal amounts of each sample, and resolve using 4%-12% gradient SDS-PAGE gels7 followed by transfer to PVDF membrane at a constant voltage of 100 V for 1 h at 4 &#176;C.</li>
	<li>Block the membranes using 5% non-fat milk and incubate in primary antibody dilutions at 4 &#176;C overnight with rotation.</li>
	<li>Next, wash the membranes 5x using PBST buffer and incubate in HRP-conjugated appropriate secondary antibodies for 1 h at room temperature.</li>
	<li>Wash the membranes again with PBST 5x, incubate with chemiluminescent substrate, and develop using X-ray films.</li>
</ol>
6. Immunostaining
<ol>
	<li>Seed the cells on P4 well plates and incubate for at least 24 h before fixation to allow proper attachment of cells to surfaces.</li>
	<li>Wash the cells 3x with PBS to remove any dead cells as well as media components, followed by fixation using 4% PFA for 15 min at room temperature.</li>
	<li>Permeabilize the cells by using 0.3% triton X-100 followed by blocking for nonspecific binding by using 2% BSA in PBS for 1 h at room temperature.</li>
	<li>Incubate the samples with primary antibodies (OCT4, NANOG, SOX2, KI67, PAX6, Brachuary, FOXA2) diluted in 1% BSA overnight at 4 &#176;C.</li>
	<li>Wash the cells 3x with PBS and incubate with appropriate secondary antibodies (Goat anti-mouse 488, Goat anti-rabbit 488, Goat anti-mouse 546, Goat anti-rabbit 546) diluted in 1% BSA for 1 h at room temperature.</li>
	<li>Finally, wash the samples with PBS 3x and counterstain them with DAPI and image using a fluorescence microscope.</li>
</ol>

<ol>
	<li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Jiang, F., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9+structures+and+mechanisms.">CRISPR-Cas9 structures and mechanisms.</a> Annu Rev Biophys. 46 (1), 505-529 (2017).</li><li>Mali, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-guided+human+genome+engineering+via+Cas9.">RNA-guided human genome engineering via Cas9.</a> Science. 339 (6121), 823-826 (2013).</li><li>Xue, C., Greene, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+repair+pathway+choices+in+CRISPR-Cas9-mediated+genome+editing.">DNA repair pathway choices in CRISPR-Cas9-mediated genome editing.</a> Trends Genet. 37 (7), 639-656 (2021).</li><li>Zhang, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9+genome-editing+system+in+human+stem+cells:+Current+status+and+future+prospects.">CRISPR/Cas9 genome-editing system in human stem cells: Current status and future prospects.</a> Mol Ther Nucleic Acids. 9, 230-241 (2017).</li><li>Qiu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MYC+regulation+of+D2HGDH+and+L2HGDH+influences+the+epigenome+and+epitranscriptome.">MYC regulation of D2HGDH and L2HGDH influences the epigenome and epitranscriptome.</a> Cell Chem Biol. 27 (5), 538-550.e537 (2020).</li><li>Sheikh, M. A., Ansari, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+mediated+delivery+of+shRNAs+to+hESCs+and+NPCs+using+low-cost+cationic+polymer+polyethylenimine+(PEI).">Lentiviral mediated delivery of shRNAs to hESCs and NPCs using low-cost cationic polymer polyethylenimine (PEI).</a> J Vis Exp. (183), e63953 (2022).</li><li>Guo, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple+and+cost-effective+method+for+screening+of+CRISPR/Cas9-induced+homozygous/biallelic+mutants.">A simple and cost-effective method for screening of CRISPR/Cas9-induced homozygous/biallelic mutants.</a> Plant Methods. 14 (1), 40 (2018).</li><li>Ardah, M. T., Parween, S., Varghese, D. S., Emerald, B. S., Ansari, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Saturated+fatty+acid+alters+embryonic+cortical+neurogenesis+through+modulation+of+gene+expression+in+neural+stem+cells.">Saturated fatty acid alters embryonic cortical neurogenesis through modulation of gene expression in neural stem cells.</a> J Nutr Biochem. 62, 230-246 (2018).</li><li>Parween, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Higher+O-GlcNAc+levels+are+associated+with+defects+in+progenitor+proliferation+and+premature+neuronal+differentiation.">Higher O-GlcNAc levels are associated with defects in progenitor proliferation and premature neuronal differentiation.</a> Front Cell Neurosci. 11, 415 (2017).</li><li>Parween, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nutrient-sensitive+protein+O-GlcNAcylation+modulates+the+transcriptome+through+epigenetic+mechanisms+during+embryonic+neurogenesis.">Nutrient-sensitive protein O-GlcNAcylation modulates the transcriptome through epigenetic mechanisms during embryonic neurogenesis.</a> Life Sci Alliance. 5 (8), e202201385 (2022).</li><li>Varghese, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Developmental+modeling+of+hepatogenesis+using+obese+iPSCs-hepatocyte+differentiation+uncovers+pathological+features.">Developmental modeling of hepatogenesis using obese iPSCs-hepatocyte differentiation uncovers pathological features.</a> Cell Death Dis. 13 (7), 670 (2022).</li><li>Varghese, D. S., Alawathugoda, T. T., Ansari, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fine-tuning+of+hepatocyte+differentiation+from+human+embryonic+stem+cells:+Growth+factor.">Fine-tuning of hepatocyte differentiation from human embryonic stem cells: Growth factor.</a> Stem Cells Int. 2019 (5), 5968236 (2019).</li><li>Jacobs, E. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9-mediated+genome+editing+in+na&#239;ve+human+embryonic+stem+cells.">CRISPR/Cas9-mediated genome editing in na&#239;ve human embryonic stem cells.</a> Sci Rep. 7 (1), 16650 (2017).</li><li>Cuevas-Oca&#241;a, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cell-based+optimized+approach+for+rapid+and+efficient+gene+editing+of+human+pluripotent+stem+cells.">A cell-based optimized approach for rapid and efficient gene editing of human pluripotent stem cells.</a> Int J Mol Sci. 24 (3), 12345 (2023).</li><li>Veres, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Low+incidence+of+off-target+mutations+in+individual+CRISPR-Cas9+and+TALEN-targeted+human+stem+cell+clones+detected+by+whole-genome+sequencing.">Low incidence of off-target mutations in individual CRISPR-Cas9 and TALEN-targeted human stem cell clones detected by whole-genome sequencing.</a> Cell Stem Cell. 15 (1), 27-30 (2014).</li><li>Smith, C., Gore, A., Yan, W., Abalde-Atristain, L., Li, Z., He, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole-genome+sequencing+analysis+reveals+high+specificity+of+CRISPR/Cas9+and+TALEN-based+genome+editing+in+human+iPSCs.">Whole-genome sequencing analysis reveals high specificity of CRISPR/Cas9 and TALEN-based genome editing in human iPSCs.</a> Cell Stem Cell. 15 (1), 12-13 (2014).</li><li>Zhang, X. H., Tee, L. Y., Wang, X. G., Huang, Q. S., Yang, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Off-target+effects+in+CRISPR/Cas9-mediated+genome+engineering.">Off-target effects in CRISPR/Cas9-mediated genome engineering.</a> Mol Ther Nucleic Acids. 4 (7), e264 (2015).</li></ol>

The authors declare that there is no conflict of interest.

This study has standardized a method that enables highly efficient and cost-effective gene deletions in hESCs through CRISPR-Cas9 technology. This method successfully achieved homozygous deletion of the L2HGDH gene in hESCs within 3-4 weeks, starting from hESC infection to single-cell clonal selection and propagation (Table 1). Although CRISPR-Cas9-mediated gene manipulations can be achieved by transient transfections in most cells, this becomes challenging in stem cells due to poor transfection efficien...

Human embryonic stem cells (hESCs) and induced pluripotent stem cells (iPSCs) are stem cells with the potential to differentiate into all cell types in the body. These cells serve as valuable tools for studying human development, as well as for understanding the underlying mechanisms of various diseases, thus offering tremendous promise for regenerative medicine, disease modeling, and drug discovery. Such studies involve investigating how specific genes contribute to the development, functioning, and regulation of organisms1,2.
Various techniques and approaches are employed to decipher gene function, including genetic manipulation, such as gene knockout or overexpression, and genome editing. Among these, CRISPR-Cas9 technology has emerged as the most efficient approach for gene knockout and gene editing studies1,2,3. The CRISPR-Cas9 system works by utilizing a single guide RNA (sgRNA) molecule specifically designed to identify and bind to a particular DNA sequence of interest. Acting as a molecular guide, the sgRNA directs the Cas9 enzyme to the precise location in the genome that requires modification. Once bound, Cas9 initiates a double-stranded break in the DNA at the designated site. Following the cleavage of DNA, the cell&#39;s inherent repair mechanisms are activated. These include two main repair pathways: non-homologous end joining (NHEJ) and homology-directed repair (HDR). NHEJ often results in insertions or deletions (indels) at the break site, leading to gene disruption or inactivation. Conversely, HDR enables the insertion of new DNA sequences at the break site, facilitating the introduction of targeted genetic alterations4.
Given the importance of gene deletions in pluripotent stem cells, several protocols have been published on CRISPR-Cas9-mediated gene knockouts in hESCs/iPSCs. However, many of these protocols face significant limitations, such as being extremely time-consuming, labor-intensive, and having low efficiency due to the use of non-viral gene delivery methods5. These challenges are even more pronounced in hESCs/iPSCs, as these cells are known to have lower editing efficiency compared to other cell types5. Some of these limitations can be addressed by increasing the efficiency of plasmid delivery containing Cas9 and sgRNAs. This can be successfully achieved using a lentiviral vector system, which can significantly improve gene editing outcomes. Lentivirus packaging protocols are well-established and straightforward, allowing easy adoption in laboratories, even by researchers with limited experience. Lentiviruses exhibit high infection efficiency across various cell types, including hESCs and iPSCs. Therefore, utilizing a lentiviral system for Cas9-sgRNA expression is ideal for routine gene editing experiments in hESCs/iPSCs for gene function studies.
Here, we provide a simple and straightforward method for highly efficient CRISPR-Cas9-based gene deletions in hESCs in a comparatively shorter time duration than conventional protocols (Figure 1). Although a lentiviral vector with constitutive expression of Cas9 and sgRNA has been used, it could easily be replaced with drug-inducible Cas9 expression for controllable Cas9 expression.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2-MERCAPTOETHANOL&#160;</td>
			<td>Invitrogen</td>
			<td>31350010</td>
			<td></td>
		</tr>
		<tr>
			<td>38.5 mL, Sterile + Certified Free Open-Top 
			Thinwall Ultra-Clear Tubes</td>
			<td>Beckman Coulter</td>
			<td>C14292</td>
			<td></td>
		</tr>
		<tr>
			<td>Accutase</td>
			<td>Stem cell technologies</td>
			<td>7920</td>
			<td></td>
		</tr>
		<tr>
			<td>bFGF Recombinant human</td>
			<td>Invitrogen</td>
			<td>PHG0261</td>
			<td></td>
		</tr>
		<tr>
			<td>Brachyury Rabbit mAb</td>
			<td>Abclonal</td>
			<td>A5078</td>
			<td></td>
		</tr>
		<tr>
			<td>BsmBI-v2</td>
			<td>NEB</td>
			<td>R0739S</td>
			<td></td>
		</tr>
		<tr>
			<td>chir99021</td>
			<td>Tocris</td>
			<td>4423/10</td>
			<td></td>
		</tr>
		<tr>
			<td>Corning Matrigel Basement Membrane Matrix, LDEV-free</td>
			<td>Corning</td>
			<td>354234</td>
			<td></td>
		</tr>
		<tr>
			<td>Cyclopamine</td>
			<td>Stem cell technologies</td>
			<td>72074</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM media</td>
			<td>Invitrogen</td>
			<td>11995073</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM NUTRIENT MIX F12&#160;</td>
			<td>Invitrogen</td>
			<td>11320033</td>
			<td></td>
		</tr>
		<tr>
			<td>DPBS w/o: Ca and Mg</td>
			<td>PAN Biotech</td>
			<td>P04-36500</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal bovie serum</td>
			<td>Invitrogen</td>
			<td>10270106</td>
			<td></td>
		</tr>
		<tr>
			<td>FoxA2/HNF3&#946;&#160;</td>
			<td>CST</td>
			<td>8186</td>
			<td></td>
		</tr>
		<tr>
			<td>GAPDH (14C10) Rabbit mAb Antibody</td>
			<td>CST</td>
			<td>2118S</td>
			<td></td>
		</tr>
		<tr>
			<td>Gentle Cell Dissociation Reagent</td>
			<td>Stem cell technologies</td>
			<td>7174</td>
			<td></td>
		</tr>
		<tr>
			<td>HyClone Non Essential Amino Acids (NEAA) 100x Solution</td>
			<td>GE healthcare</td>
			<td>SH30238.01</td>
			<td></td>
		</tr>
		<tr>
			<td>Ki-67 (D3B5) Rabbit mAb</td>
			<td>CST</td>
			<td>9129</td>
			<td></td>
		</tr>
		<tr>
			<td>KnockOut Serum Replacement</td>
			<td>Invitrogen</td>
			<td>10828028</td>
			<td></td>
		</tr>
		<tr>
			<td>L GLUTAMINE, 100x</td>
			<td>Invitrogen</td>
			<td>2924190090</td>
			<td></td>
		</tr>
		<tr>
			<td>L2H-BMSBSP-F1</td>
			<td>Macrogen</td>
			<td></td>
			<td>CGTGCGGGTTCGCGTCTGGG</td>
		</tr>
		<tr>
			<td>L2HGDH Polyclonal antibody</td>
			<td>Proteintech</td>
			<td>15707-1-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>L2HGDH-SgRNA1-F</td>
			<td>Macrogen</td>
			<td></td>
			<td>CACCGCGTGCGG 
			GTTCGCGTCTGGG</td>
		</tr>
		<tr>
			<td>L2HGDH-SgRNA1-R</td>
			<td>Macrogen</td>
			<td></td>
			<td>AAACCCCAGACGC 
			GAACCCGCACGC</td>
		</tr>
		<tr>
			<td>L2HGDH-SgRNA2-F</td>
			<td>Macrogen</td>
			<td></td>
			<td>CACCGCCCGCGG 
			GCTTTTCGCCGG</td>
		</tr>
		<tr>
			<td>L2HGDH-SgRNA2-R</td>
			<td>Macrogen</td>
			<td></td>
			<td>AAACCCGGCGAA 
			AAGCCCGCGGGC</td>
		</tr>
		<tr>
			<td>L2H-SeqF1</td>
			<td>Macrogen</td>
			<td></td>
			<td>GCTAAAGAGCGC 
			GGGTCCTCGG</td>
		</tr>
		<tr>
			<td>L2H-SeqR1</td>
			<td>Macrogen</td>
			<td></td>
			<td>GTGGACGGGTTG 
			TTCAAAGCCAGAG</td>
		</tr>
		<tr>
			<td>L2H-UMSBSP-R1</td>
			<td>Macrogen</td>
			<td></td>
			<td>GTGGACGGGTTG 
			TTCAAAGCCAGAG</td>
		</tr>
		<tr>
			<td>LentiCRISPRv2</td>
			<td>Addgene</td>
			<td>52961</td>
			<td></td>
		</tr>
		<tr>
			<td>mTesR1 complete media</td>
			<td>Stem cell technologies</td>
			<td>85850</td>
			<td></td>
		</tr>
		<tr>
			<td>Nanog Antibody</td>
			<td>CST</td>
			<td>3580</td>
			<td></td>
		</tr>
		<tr>
			<td>NEUROBASAL MEDIUM 1x CTS</td>
			<td>Invitrogen</td>
			<td>A1371201</td>
			<td></td>
		</tr>
		<tr>
			<td>Neuropan 2 Supplement 100x</td>
			<td>PAN Biotech</td>
			<td>P07-11050</td>
			<td></td>
		</tr>
		<tr>
			<td>Neuropan 27 Supplement 50x</td>
			<td>PAN Biotech</td>
			<td>P07-07200</td>
			<td></td>
		</tr>
		<tr>
			<td>Oct-4 Antibody</td>
			<td>CST</td>
			<td>2750</td>
			<td></td>
		</tr>
		<tr>
			<td>Pax6 (D3A9V) XP Rabbit mAb</td>
			<td>CST</td>
			<td>60433</td>
			<td></td>
		</tr>
		<tr>
			<td>PENICILLIN STREPTOMYCIN SOL</td>
			<td>Invitrogen</td>
			<td>15140122</td>
			<td></td>
		</tr>
		<tr>
			<td>pMD2.G</td>
			<td>Addgene</td>
			<td>12259</td>
			<td></td>
		</tr>
		<tr>
			<td>Polybrene infection reagent</td>
			<td>Sigma</td>
			<td>TR1003- G</td>
			<td></td>
		</tr>
		<tr>
			<td>Polyethylenimine, branched</td>
			<td>Sigma</td>
			<td>408727</td>
			<td></td>
		</tr>
		<tr>
			<td>psPAX2.0</td>
			<td>Addgene</td>
			<td>12260</td>
			<td></td>
		</tr>
		<tr>
			<td>Puromycin</td>
			<td>Invitrogen</td>
			<td>A1113802</td>
			<td></td>
		</tr>
		<tr>
			<td>qPCR Lentivirus Titer Kit</td>
			<td>Abm</td>
			<td>LV900</td>
			<td></td>
		</tr>
		<tr>
			<td>Rock inhibitor Y-27632 
			dihydrochloride&#160;</td>
			<td>Tocris</td>
			<td>1254</td>
			<td></td>
		</tr>
		<tr>
			<td>SB 431542</td>
			<td>Tocris</td>
			<td>1614/10</td>
			<td></td>
		</tr>
		<tr>
			<td>Sox2 Antibody</td>
			<td>CST</td>
			<td>2748</td>
			<td></td>
		</tr>
		<tr>
			<td>Sucrose</td>
			<td>Sigma</td>
			<td>57-50-1</td>
			<td></td>
		</tr>
		<tr>
			<td>TRYPSIN .05% EDTA&#160;</td>
			<td>Invitrogen</td>
			<td>25300062</td>
			<td></td>
		</tr>
		<tr>
			<td>U6-459F</td>
			<td>Macrogen</td>
			<td></td>
			<td>GAGGGCCTATT 
			TCCCATGATTC</td>
		</tr>
		<tr>
			<td>Wizard Genomic DNA Purification Kit&#160;</td>
			<td>Promega</td>
			<td>A1120</td>
			<td></td>
		</tr>
		<tr>
			<td>XAV 939</td>
			<td>Tocris</td>
			<td>3748/10</td>
			<td></td>
		</tr>
	</tbody>
</table>

crispr-cas9 mediated gene deletion in human pluripotent stem cells cultured under feeder-free conditions

The CRISPR-Cas9 system for genome editing has revolutionized gene function studies in mammalian cells, including stem cells. However, the practical application of this technique, particularly in pluripotent stem cells, presents certain challenges, such as being time- and labor-intensive and having low editing efficiency. Here, we describe the generation of a CRISPR-mediated gene knockout in a human embryonic stem cell (hESC) line stably expressing sgRNAs for the L2HGDH gene, using a highly efficient and stable lentiviral-mediated gene delivery system. The sgRNAs targeting exon 1 of the L2HGDH gene were chemically synthesized and cloned into the lentiCRISPR v2-puro vector, which combines the constitutive expression of sgRNAs with Cas9 in a highly efficient single-vector system to achieve higher lentiviral titers for hESC infection and stable selection using puromycin. Puromycin-selected cells were further expanded, and single-cell clones were obtained using the limited dilution method. The single clones were expanded, and several homozygous knockout clones for the L2HGDH gene were obtained, as confirmed by a 100% reduction in L2HGDH expression using Western blot analysis. Furthermore, using MSBSP-PCR, the CRISPR mutation site was mapped upstream of the PAM recognition sequence of Cas9 in the selected homozygous clones. Sanger sequencing was performed to analyze the exact insertions/deletions, and functional characterization of the clones was conducted. This method produced a significantly higher percentage of homozygous deletions compared to previously reported non-viral gene delivery methods. Although this report focuses on the L2HGDH gene, this robust and cost-effective approach can be used to create homozygous knockouts for other genes in pluripotent stem cells for gene function studies.

Cloning of L2HGDH sgRNAs in lentiCRISPRv2 puro 
lentiCRISPRv2 puro vector was commercially obtained (see Table of Materials) and digested with BsmB1, which resulted in the release of a 1.8 Kb stuffer fragment. As shown in Figure 2A, a complete digestion of the vector was observed. For each construct, six clones were screened for the presence or absence of insert using reverse sgRNA sequence as a primer and a forward primer (U6-459F) from within the vect...

CRISPR-Cas9 Mediated Gene Deletion in Human Pluripotent Stem Cells Cultured Under Feeder-Free Conditions

The presented method describes the generation of a CRISPR-mediated gene knockout in the human embryonic stem cell (hESC) line H9, which stably expresses sgRNAs targeting the L2HGDH gene using a highly efficient lentiviral-mediated gene delivery system.

The CRISPR-Cas9 system for genome editing has revolutionized gene function studies in mammalian cells, including stem cells. However, the practical ...

crispr-cas9-mediated-gene-deletion-human-pluripotent-stem-cells

Research

JoVE Journal

Biology

494 Views.  United Arab Emirates University. The presented method describes the generation of a CRISPR-mediated gene knockout in the human embryonic stem cell (hESC) line H9, which stably expresses sgRNAs targeting the L2HGDH gene using a highly efficient lentiviral-mediated gene delivery system.

Video: CRISPR-Cas9 Mediated Gene Deletion in Human Pluripotent Stem Cells Cultured Under Feeder-Free Conditions

Feeder-Free Adaptation, Culture and Passaging of Human IPS Cells using Complete KnockOut Serum Replacement Feeder-Free Medium

The discovery in 2006 that human and mouse fibroblasts could be reprogrammed to generate iPS cells 1-3 with qualities remarkably similar to embryonic stem cells has created a valuable new source of pluripotent cells for drug discovery, cell therapy, and basic research.
GIBCO media and reagents have been at the forefront of pluripotent stem cell research for years. Knockout DMEM supplemented with Knockout Serum Replacement is the media of choice for embryonic stem cell growth and now iPS cell culture 3-9. This gold standard media system can now be used for feeder-free culture with the addition of Knockout SR Growth Factor Cocktail.
Traditional human ES and iPS cell culture methods require the use of mouse or human fibroblast feeder layers, or feeder-conditioned medium. These culture methods are labor-intensive, hard to scale and it is difficult to maintain hiPS cells undifferentiated due to the undefined conditions. Invitrogen has developed Knockout SR Growth Factor Cocktail to allow you to easily transition your hiPS cell cultures to feeder-free while still maintaining your use of Knockout SR.

The following protocol provides instruction for adapting human induced Pluripotent Stem (iPS) Cells to feeder-free culture using complete KnockOut Serum Replacement Feeder-Free medium (KSR-FF). Once adapted, instructions for continual maintenance are also provided.

The discovery in 2006 that human and mouse fibroblasts could be reprogrammed to generate iPS cells 1-3 with qualities remarkably similar to embryonic stem ...

Transfecting and Nucleofecting Human Induced Pluripotent Stem Cells

Genetic modification is continuing to be an essential tool in studying stem cell biology and in setting forth potential clinical applications of human embryonic stem cells (HESCs)1. While improvements in several gene delivery methods have been described2-9, transfection remains a capricious process for HESCs, and has not yet been reported in human induced pluripotent stem cells (iPSCs). In this video, we demonstrate how our lab routinely transfects and nucleofects human iPSCs using plasmid with an enhanced green fluorescence protein (eGFP) reporter. Human iPSCs are adapted and maintained as feeder-free cultures to eliminate the possibility of feeder cell transfection and to allow efficient selection of stable transgenic iPSC clones following transfection. For nucleofection, human iPSCs are pre-treated with ROCK inhibitor11, trypsinized into small clumps of cells, nucleofected and replated on feeders in feeder cell-conditioned medium to enhance cell recovery. Transgene-expressing human iPSCs can be obtained after 6 hours. Antibiotic selection is applied after 24 hours and stable transgenic lines appear within 1 week. Our protocol is robust and reproducible for human iPSC lines without altering pluripotency of these cells.

Despite recent advancements in genetic modification, transfection of human embryonic stem cells (HESCs) remains a capricious process. To our knowledge, systematic and efficient methods to transfect human induced pluripotent stem cells (iPSCs) have not been reported. Here, we describe robust protocols to efficiently transfect and nucleofect human iPSCs.

Genetic modification is continuing to be an essential tool in studying stem cell biology and in setting forth potential clinical applications of human ...

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells (iPSCs) Using Retroviral Vector with GFP

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has been previously shown that human somatic cells can be reprogrammed to pluripotency by ectopic expression of four transcription factors (Oct4, Sox2, Klf4 and Myc) and become induced pluripotent stem cells (iPSCs)2-4 . Like hESCs, human iPSCs are pluripotent and a potential source for autologous cells. Here we describe the protocol to reprogram human fibroblast cells with the four reprogramming factors cloned into GFP-containing retroviral backbone4. Using the following protocol, we generate human iPSCs in 3-4 weeks under human ESC culture condition. Human iPSC colonies closely resemble hESCs in morphology and display the loss of GFP fluorescence as a result of retroviral transgene silencing. iPSC colonies isolated mechanically under a fluorescence microscope behave in a similar fashion as hESCs. In these cells, we detect the expression of multiple pluripotency genes and surface markers.

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells iPSCs Using Retroviral Vector with GFP

A method to generate human induced pluripotent stem cells (iPSCs) via retrovirus-mediated ectopic expression of OCT4, SOX2, KLF4 and MYC is described. A practical way to identify human iPSC colonies based on GFP expression is also discussed.

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has ...

Generation of Human Cardiomyocytes: A Differentiation Protocol from Feeder-free Human Induced Pluripotent Stem Cells

In order to investigate the events driving heart development and to determine the molecular mechanisms leading to myocardial diseases in humans, it is essential first to generate functional human cardiomyocytes (CMs). The use of these cells in drug discovery and toxicology studies would also be highly beneficial, allowing new pharmacological molecules for the treatment of cardiac disorders to be validated pre-clinically on cells of human origin. Of the possible sources of CMs, induced pluripotent stem (iPS) cells are among the most promising, as they can be derived directly from readily accessible patient tissue and possess an intrinsic capacity to give rise to all cell types of the body 1. Several methods have been proposed for differentiating iPS cells into CMs, ranging from the classical embryoid bodies (EBs) aggregation approach to chemically defined protocols 2,3. In this article we propose an EBs-based protocol and show how this method can be employed to efficiently generate functional CM-like cells from feeder-free iPS cells.

Pluripotent stem cells, either embryonic or induced pluripotent stem (iPS) cells, constitute a valuable source of human differentiated cells, including cardiomyocytes. Here, we will focus on cardiac induction of iPS cells, showing how to use them to obtain functional human cardiomyocytes through an embryoid bodies-based protocol.

In order to investigate the events driving heart development and to determine the molecular mechanisms leading to myocardial diseases in humans, it is ...

Efficient Generation Human Induced Pluripotent Stem Cells from Human Somatic Cells with Sendai-virus

A few years ago, the establishment of human induced pluripotent stem cells (iPSCs) ushered in a new era in biomedicine. Potential uses of human iPSCs include modeling pathogenesis of human genetic diseases, autologous cell therapy after gene correction, and personalized drug screening by providing a source of patient-specific and symptom relevant cells. However, there are several hurdles to overcome, such as eliminating the remaining reprogramming factor transgene expression after human iPSCs production. More importantly, residual transgene expression in undifferentiated human iPSCs could hamper proper differentiations and misguide the interpretation of disease-relevant in vitro phenotypes. With this reason, integration-free and/or transgene-free human iPSCs have been developed using several methods, such as adenovirus, the piggyBac system, minicircle vector, episomal vectors, direct protein delivery and synthesized mRNA. However, efficiency of reprogramming using integration-free methods is quite low in most cases.
Here, we present a method to isolate human iPSCs by using Sendai-virus (RNA virus) based reprogramming system. This reprogramming method shows consistent results and high efficiency in cost-effective manner.

Here, we present our established method to reprogram human somatic cells into transgene-free human iPSCs with Sendai virus, which shows consistent outcome and enhanced efficiency.

A few years ago, the establishment of human induced pluripotent stem cells (iPSCs) ushered in a new era in biomedicine. Potential uses of human iPSCs ...

Co-immunoprecipitation Assay Using Endogenous Nuclear Proteins from Cells Cultured Under Hypoxic Conditions

Low oxygen levels (hypoxia) trigger a variety of adaptive responses with the Hypoxia-inducible factor 1 (HIF-1) complex acting as a master regulator. HIF-1 consists of a heterodimeric oxygen-regulated &#945; subunit (HIF-1&#945;) and constitutively expressed &#946; subunit (HIF-1&#946;) also known as aryl hydrocarbon receptor nuclear translocator (ARNT), regulating genes involved in diverse processes including angiogenesis, erythropoiesis and glycolysis. The identification of HIF-1 interacting proteins is key to the understanding of the hypoxia signaling pathway. Besides the regulation of HIF-1&#945; stability, hypoxia also triggers the nuclear translocation of many transcription factors including HIF-1&#945; and ARNT. Notably, most of the current methods used to study such protein-protein interactions (PPIs) are based on systems where protein levels are artificially increased through protein overexpression. Protein overexpression often leads to non-physiological results arising from temporal and spatial artifacts. Here we describe a modified co-immunoprecipitation protocol following hypoxia treatment using endogenous nuclear proteins, and as a proof of concept, to show the interaction between HIF-1&#945; and ARNT. In this protocol, the hypoxic cells were harvested under hypoxic conditions and the Dulbecco's Phosphate-Buffered Saline (DPBS) wash buffer was also pre-equilibrated to hypoxic conditions before usage to mitigate protein degradation or protein complex dissociation during reoxygenation. In addition, the nuclear fractions were subsequently extracted to concentrate and stabilize endogenous nuclear proteins and avoid possible spurious results often seen during protein overexpression. This protocol can be used to demonstrate endogenous and native interactions between transcription factors and transcriptional co-regulators under hypoxic conditions.

Here we describe a co-immunoprecipitation protocol to study protein-protein interactions between endogenous nuclear proteins under hypoxic conditions. This method is suitable for demonstration of the interactions between transcription factors and transcriptional co-regulators at hypoxia.

Low oxygen levels (hypoxia) trigger a variety of adaptive responses with the Hypoxia-inducible factor 1 (HIF-1) complex acting as a master regulator. ...

Genome Engineering of Primary Human B Cells Using CRISPR/Cas9

B cells are lymphocytes derived from hematopoietic stem cells and are a key component of the humoral arm of the adaptive immune system. They make attractive candidates for cell-based therapies because of their ease of isolation from peripheral blood, their ability to expand in vitro, and their longevity in vivo. Additionally, their normal biological function&#8212;to produce large amounts of antibodies&#8212;can be utilized to express very large amounts of a therapeutic protein, such as a recombinant antibody to fight infection, or an enzyme for the treatment of enzymopathies. Here, we provide detailed methods for isolating primary human B cells from peripheral blood mononuclear cells (PBMCs) and activating/expanding isolated B cells in vitro. We then demonstrate the steps involved in using the CRISPR/Cas9 system for site-specific KO of endogenous genes in B cells. This method allows for efficient KO of various genes, which can be used to study the biological functions of genes of interest. We then demonstrate the steps for using the CRISPR/Cas9 system together with a recombinant, adeno-associated, viral (rAAV) vector for efficient site-specific integration of a transgene expression cassette in B cells. Together, this protocol provides a step-by-step engineering platform that can be used in primary human B cells to study biological functions of genes as well as for the development of B-cell therapeutics.

Here we provide a detailed, step-by-step protocol for CRISPR/Cas9-based genome engineering of primary human B cells for gene knockout (KO) and knock-in (KI) to study biological functions of genes in B cells and the development of B-cell therapeutics.

B cells are lymphocytes derived from hematopoietic stem cells and are a key component of the humoral arm of the adaptive immune system. They make ...

CRISPR/Cas9 Gene Editing of Hematopoietic Stem and Progenitor Cells for Gene Therapy Applications

CRISPR/Cas9 is a highly versatile and efficient gene-editing tool adopted widely to correct various genetic mutations. The feasibility of gene manipulation of hematopoietic stem and progenitor cells (HSPCs) in vitro makes HSPCs an ideal target cell for gene therapy. However, HSPCs moderately lose their engraftment and multilineage repopulation potential in ex vivo culture. In the present study, ideal culture conditions are described that improves HSPC engraftment and generate an increased number of gene-modified cells in vivo. The current report displays optimized in vitro culture conditions, including the type of culture media, unique small molecule cocktail supplementation, cytokine concentration, cell culture plates, and culture density. In addition to that, an optimized HSPC gene-editing procedure, along with the validation of the gene-editing events, are provided. For in vivo validation, the gene-edited HSPCs infusion and post-engraftment analysis in mouse recipients are displayed. The results demonstrated that the culture system increased the frequency of functional HSCs in vitro, resulting in robust engraftment of gene-edited cells in vivo.

The present protocol describes an optimized hematopoietic stem and progenitor cell (HSPC) culture procedure for the robust engraftment of gene-edited cells in vivo.

CRISPR/Cas9 is a highly versatile and efficient gene-editing tool adopted widely to correct various genetic mutations. The feasibility of gene ...

CRISPR-Cas9-Mediated Precise Knock-In Edits in Zebrafish Hearts

Clustered regularly interspaced short palindromic repeats (CRISPR) in animal models enable precise genetic manipulation for the study of physiological phenomena. Zebrafish have been used as an effective genetic model to study numerous questions related to heritable disease, development, and toxicology at the whole-organ and -organism level. Due to the well-annotated and mapped zebrafish genome, numerous tools for gene editing have been developed. However, the efficacy of generating and ease of detecting precise knock-in edits using CRISPR is a limiting factor. Described here is a CRISPR-Cas9-based knock-in approach with the simple detection of precise edits in a gene responsible for cardiac repolarization and associated with the electrical disorder, Long QT Syndrome (LQTS). This two-single-guide RNA (sgRNA) approach excises and replaces the target sequence and links a genetically encoded reporter gene. The utility of this approach is demonstrated by describing non-invasive phenotypic measurements of cardiac electrical function in wild-type and gene-edited zebrafish larvae. This approach enables the efficient study of disease-associated variants in a whole organism. Furthermore, this strategy offers possibilities for the insertion of exogenous sequences of choice, such as reporter genes, orthologs, or gene editors.

This protocol describes an approach to facilitate precise knock-in edits in zebrafish embryos using CRISPR-Cas9 technology. A phenotyping pipeline is presented to demonstrate the applicability of these techniques to model a Long QT Syndrome-associated gene variant.

Clustered regularly interspaced short palindromic repeats (CRISPR) in animal models enable precise genetic manipulation for the study of physiological ...

Centromere-Associated Protein-E Gene Editing Using the CRISPR/Cas9 System

Generation of Centromere-Associated Protein-E CENP-E-/- Knockout Cell Lines using the CRISPR/Cas9 System

The CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 system has emerged as a powerful tool for precise and efficient gene editing in a variety of organisms. Centromere-associated protein-E (CENP-E) is a plus-end-directed kinesin required for kinetochore-microtubule capture, chromosome alignment, and spindle assembly checkpoint. Although cellular functions of the CENP-E proteins have been well studied, it has been difficult to study the direct functions of CENP-E proteins using traditional protocols because CENP-E ablation usually leads to spindle assembly checkpoint activation, cell cycle arrest, and cell death. In this study, we have completely knocked out the CENP-E gene in human HeLa cells and successfully generated the CENP-E-/- HeLa cells using the CRISPR/Cas9 system.
Three optimized phenotype-based screening strategies were established, including cell colony screening, chromosome alignment phenotypes, and the fluorescent intensities of CENP-E proteins, which effectively improve the screening efficiency and experimental success rate of the CENP-E knockout cells. Importantly, CENP-E deletion results in chromosome misalignment, the abnormal location of the BUB1 mitotic checkpoint serine/threonine kinase B (BubR1) proteins, and mitotic defects. Furthermore, we have utilized the CENP-E knockout HeLa cell model to develop an identification method for CENP-E-specific inhibitors.
In this study, a useful approach to validate the specificity and toxicity of CENP-E inhibitors has been established. Moreover, this paper presents the protocols of CENP-E gene editing using the CRISPR/Cas9 system, which could be a powerful tool to investigate the mechanisms of CENP-E in cell division. Moreover, the CENP-E&#160;knockout cell line would contribute to the discovery and validation of CENP-E inhibitors, which have important implications for antitumor drug development, studies of cell division mechanisms in cell biology, and clinical applications.

Author Spotlight: Establishing CENP-E Knockout HeLa Cells &#8211; A Novel Approach to Study Kinesin-7 CENP-E Biology and its Inhibitors

This article reports the construction of centromere-associated protein-E (CENP-E) knockout cells using the CRISPR/Cas9 system and three phenotype-based screening strategies. We have utilized the CENP-E&#160;knockout cell line to establish a novel approach to validate the specificity and toxicity of the CENP-E inhibitors, which is useful for drug development and biological research.

The CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 system has emerged as a powerful tool for precise and efficient gene editing ...