We thank the 502 team for all the help. This work is partly supported by the Beijing Municipal Natural Science Foundation (Z200014) and National Key R&#38;D Program of China (2017YFA0105300).

This study is approved by the institutional Ethics Committee of Beijing Tongren Hospital, Capital Medical University. H9 hESCs are obtained from the WiCell Research Institute.
1. Generation of RB1 mutated hESC
<ol>
	<li>CRISPR/Cas9 targeting vector for the knockout (KO) of RB1.
	<ol>
		<li>Design a pair of sgRNA. For the ablation of RB1, target the first exon of this gene. The forward primer sequence is CACCGCGGTGGCGGCCGTTTTTCGG, and the reverse primer sequence is AAACCCGAAAAACGGCCGCCACCGC. 
		NOTE: For the specific RB1 mutation, a repaired template is also required. In this protocol, RB1-KO cell line is used as an example.</li>
		<li>Digest 1 &#181;g of pX330-U6-Chimeric BB-CBh-hSpCas9-2A-Puro with BbsI restriction enzymes (see Table of Materials) for 30 min at 37 &#176;C by following the manufacturer&#39;s instructions.</li>
		<li>Purify the digested plasmids using a purification kit according to the manufacturers&#39; instructions. 
		NOTE: Enzymatic reactions could be directly cleaned up without agarose gel using the purification kit (see Table of Materials).</li>
		<li>Phosphorylate and anneal each pair of oligos using the T4 polynucleotide kinase (PNK) (Table of Materials) with the reaction comprising 1 &#181;L of oligo1 (100 &#181;M), 1 &#181;L of oligo2 (100 &#181;M), 1 &#181;L of 10x T4 Ligation Buffer, 6.5 &#181;L of ddH2O, and 0.5 &#181;L of T4 PNK. 
		NOTE: The forward and reverse primers in step 1.1.1 are a pair of oligos. Phosphorylate and anneal the oligos in a thermocycler using the following parameters: 37 &#176;C for 30 min; 95 &#176;C for 5 min; ramp down to 25 &#176;C at 5 &#176;C per minute.</li>
		<li>Dilute the phosphorylated and annealed oligos 200 times by adding 1 &#181;L of oligo reagent to 199 &#181;L of nuclease-free water at room temperature (RT).</li>
		<li>Set up the ligation reaction and incubate at RT for 10 min by mixing the following: 50 ng of Bbs1 digested plasmid from step 1.1.3, 1 &#181;L of oligo duplex from step 1.1.5, 5 &#181;L of 2x ligation buffer, 1 &#181;L of ligase, and top up to 10 &#181;L using nuclease-free water.</li>
		<li>Transform the ligation mixture and sequence the positive colonies for the next step. 
		NOTE: Use U6 forward or reverse primer for sequencing.
		<ol>
			<li>Thaw the competent cells on ice.</li>
			<li>Take 50 &#181;L of the competent cells in a 1.5 mL microcentrifuge tube.</li>
			<li>Add 1 &#181;L of the ligation mixture from step 1.1.6 into the competent cells.</li>
			<li>Mix gently by pipetting up and down the tube three times. 
			NOTE: Do not vortex.</li>
			<li>Place the mixture on ice for 30 min.</li>
			<li>Heat shock the mixture at 42 &#176;C for 90 s.</li>
			<li>Add 950 &#181;L of room temperature Luria-Bertani (LB) broth without antibiotic to the tube.</li>
			<li>Place the tube in a shaker at 300 rpm at 37 &#176;C for 60 min.</li>
			<li>Warm the LB plates (peptone, peptone from casein, sodium chloride, agar-agar, and ampicillin) to 37 &#176;C in advance.</li>
			<li>Spread 50-100 &#181;L of the cells and ligation mixture onto the plates at RT.</li>
			<li>Incubate the plates overnight at 37 &#176;C.</li>
			<li>Pick up 12 colonies from the plate and transfer them to the LB medium with ampicillin. Place the medium on a shaker at 300 rpm for 60 min.</li>
			<li>Use 1 &#181;L of the bacteria solution (from step 1.1.7.12) as template for PCR and select the positive colonies.</li>
			<li>Sequence the positive colonies by the U6 primers, use the colony with the designed sgRNA sequences in the next step.</li>
		</ol>
		</li>
		<li>Extract the plasmid using a midi kit (see Table of Materials). 
		NOTE: The quality and the quantity of the plasmid using a mini kit are not enough for the following nucleofection experiment. Midi or maxi kit is more suitable than the mini kit.</li>
	</ol>
	</li>
	<li>HESC culture and nucleofection. 
	NOTE: Prewarm all the reagents to RT.
	<ol>
		<li>Thaw 1 x 106 H9 cells into a pre-coated 6-well plate with 10 &#181;M Y-27632 (ROCK inhibitor) and 2 mL of fresh ncEpic-hiPSC/hESC culture medium. 
		NOTE: Coat the 6-well plate with 1% Growth factor reduced basement membrane matrix for at least 30 min at 37 &#176;C before use.</li>
		<li>The next day, remove the supernatant, rinse the cells with 1x Dulbecco&#39;s Phosphate-Buffered Saline (DPBS), and then add 2 mL of fresh ncEpic-hiPSC/hESC culture medium.</li>
		<li>Change the medium every day with 2 mL of fresh ncEpic-hiPSC/hESC culture medium in the following 3-5 days until the cells grow to around 80% confluency.</li>
		<li>Passage once or twice to adjust the state of the hESC. 
		NOTE: The easiest way to identify the state of the hESC is the morphology.</li>
		<li>Culture the undifferentiated H9 cells in a 6-well plate until they reach 80% confluency.</li>
		<li>Change the medium 2 h before the nucleofection with 2 mL of fresh ncEpic-hiPSC/hESC culture medium mixed with 10 &#181;M of Y-27632 and precoat one well of a 12-well plate using 1% Growth factor reduced basement membrane matrix.</li>
		<li>Aspirate the medium and rinse with 1 mL of prewarmed DPBS.</li>
		<li>Remove the DPBS and incubate with 1 mL of cell dissociation enzyme (see Table of Materials) for 3.5 min at 37 &#176;C.</li>
		<li>Add 1 mL of fresh ncEpic-hiPSC/hESC culture medium to the cells and pipette twice to make the H9 cells into a single cell suspension.</li>
		<li>Take out 100 &#181;L of the mixture for cell counting and transfer the remaining to a 15 mL centrifuge tube containing another 2 mL of ncEpic-hiPSC/hESC culture medium inside.</li>
		<li>Centrifuge at 200 x g for 5 min. Remove the supernatant and resuspend around 2 x 106 cells into a 100 &#181;L reaction volume. According to the manufacturer&#39;s protocol, optimize the volume for the cells, plasmids, nucleofector, and reaction conditions. See Table of Materials for the nucleofection system used in this protocol. 
		NOTE: Generally, bubbles are not allowed during the nucleofection.</li>
		<li>After transfection, transfer the cells to the precoated 12-well plate, supplement with 1.5 mL of ncEpic-hiPSC/hESC culture medium and 10 &#181;M of Y-27632, and then culture the cells in a 37 &#176;C, 5% CO2 incubator.</li>
		<li>Change the medium daily. After 48 h, add 2 &#181;g/mL of puromycin for cell selection around one week. 
		NOTE: Numerous cells die during the first 3 days. The remaining cells may proliferate and generate into colonies in the following week after the puromycin selection. In the selection week, ensure that the medium always contains 2 &#181;g/mL of puromycin.</li>
		<li>Pick the colonies manually under a microscope. 
		NOTE: The colony morphology is the same as the hES colony. Cut the colonies into pieces (2-6 pieces per colony) with a 10 &#181;L white/normal pipette tip in the medium and transfer one colony into one precoated well of a 12-well plate.</li>
		<li>First, Identify the RB1 mutations and the off-target situations (Table 1), and then pluripotency to characterize the RB1 knockout H9 cell line. 
		&#8203;NOTE: Detect the RB1 mutations and the off-target situations using PCR and sanger sequencing. Identify the pluripotency markers by RT-PCR and Immunofluorescence.</li>
	</ol>
	</li>
</ol>
2. Generation of human retinoblastoma
<ol>
	<li>Maintenance of RB1-KO hESC.
	<ol>
		<li>Culture the gene-edited H9 cells in a Growth factor reduced basement membrane matrix coated 6-well plate with 2 mL of ncEpic-hiPSC/hESC culture medium and change the medium every day.</li>
		<li>Passage using EDTA buffer for 3.5 min at 37 &#176;C or 5 min at RT. 
		&#8203;NOTE: EDTA buffer is the mixture of 1x DPBS, 5 mM EDTA, and 0.9 mg/mL of NaCl.</li>
	</ol>
	</li>
	<li>Retinal cell differentiation. 
	NOTE: Prepare Medium I before the differentiation. To prepare Medium I, mix 24.5 mL of Dulbecco&#39;s Modified Eagle Medium (DMEM)/Nutrient Mixture F-12(F12)-Glutamine (1x), 24.5 mL of Neuronal basal medium, 250 &#181;L of 100x supplement A, 500 &#181;L of 50x supplement B, 0.1 mM &#223;-mercaptoethanol, and 250 &#181;L of 100x L-glutamine. Prewarm all the mixtures to RT before use.
	<ol>
		<li>Grow the RB1-KO hESC to 80% confluence in one well of a 6-well plate.</li>
		<li>Remove the medium and rinse the cells with 1 mL of 1x DPBS.</li>
		<li>Elevate the cell colonies using 1 mL of dispase buffer (see Table of Materials) for 5 min at 37 &#176;C. 
		NOTE: Check the cell colonies under a microscope. Usually, it takes 5 min for the edge of the colonies to roll out.</li>
		<li>Aspirate the dispase buffer and gently rinse the cells once with 1 mL of 1x DPBS.</li>
		<li>Add 1 mL of Medium I into the well.</li>
		<li>Cut the colonies into pieces (6-9 pieces per colony) with a 10 &#181;L white/normal pipette tip in the medium. 
		NOTE: Generally, around 60%-70% of cells detach from the well. Use a cell scraper to scrape the remaining cells in the medium.</li>
		<li>Harvest all the cells by centrifuging in a 15 mL tube at 200 x g for 5 min.</li>
		<li>Leave around 50 &#181;L of the supernatant to disperse the cells in the medium, and then mix the cells with 250 &#181;L of Growth factor reduced basement membrane matrix by gentle agitation. 
		NOTE: Keep the Growth factor reduced basement membrane matrix either at 4 &#176;C or on the ice before use. If it is aliquoted and stored at -20 &#176;C, place it at 4 &#176;C overnight or at least 1 h before use.</li>
		<li>Keep the 15 mL tube with the suspended cells into a 37 &#176;C incubator for 20 min. 
		NOTE: Ensure that the cells and Growth factor reduced basement membrane matrix form a solidified gel.</li>
		<li>Add 1 mL of Medium I into the 15 mL tube, and then lightly pipet the solidified gel two to three times to disperse the clump with a 1 mL pipette.</li>
		<li>Add 9 mL of Medium I and transfer the cell suspension into a 10 cm cell culture dish.</li>
		<li>Move the dish to a 37 &#176;C incubator with 5% CO2 and set the day as day 0.</li>
		<li>Examine the cells using a microscope on day 1. 
		NOTE: Thousands of hollow cysts could be observed in the dish. On average, 3 to 4 cysts are observed in one piece of gel.</li>
		<li>Change the medium on day 5. Collect the supernatant into a 15 mL tube, wait for the cysts to settle to the bottom, and then remove the medium and replace it with fresh Medium I. 
		NOTE: If the medium becomes yellow on day 4, change the medium on day 4, otherwise on day 5. Add 10 mL of fresh Medium I into the original dish. Hundreds of cysts have already attached to the culture surface; keep them there.</li>
		<li>Disperse the cysts in the tube into two 10 cm dishes. 
		NOTE: Make sure at least 300 cysts are in a dish. If the cysts are not confluent, do not separate the cysts into other dishes; return them to the original 10 cm dish.</li>
		<li>On day 7, most cysts (above 95%) attach to the dish, spread out, and form adherent colonies. 
		NOTE: As early as day 3, the adherent colonies can be observed.</li>
		<li>On day 10, change the medium with fresh Medium I. Ensure that all the cysts are attached to the dish.</li>
		<li>Prepare Medium II before the next step by mixing the following: 36 mL of DMEM, 12 mL of F12, 2% of supplement B (v/v), 0.1 mM MEM Non-Essential Amino Acids Solution (NEAA).</li>
		<li>Ensure that the cells are spread out by day 13-17. Perform the next step on day 15 when the cells are spread out but not interacting with the neighboring colonies.</li>
		<li>Rinse the cells once with 1 mL of DPBS and add 1 mL of dispase solution for 5 min at 37 &#176;C. 
		NOTE: Within 5 min, the edge of the cells elevate.</li>
		<li>Remove the dispase buffer and gently rinse the cultures with 1 mL of 1x DPBS.</li>
		<li>Add 10 mL of Medium II to each 10 cm dish and culture in a 37 &#176;C, 5% CO2 incubator.</li>
		<li>The adherent cultures spontaneously detach after 24 h and assemble into retinal organoids. 
		NOTE: Numerous cells that do not form the organoids would die in the following 2 days.</li>
		<li>Three days after detachment, collect the cells from the cell culture dish and allow the organoids to settle in a 15 mL tube.</li>
		<li>Remove the supernatant from the tube and transfer the organoids to a new non-adherent dish (Petri dish) with 10 mL of Medium II for the following four days.</li>
		<li>Prepare Medium III by mixing DMEM: F12 at 3:1 ratio (v/v), 2% supplement B (v/v), 0.1 mM MEM Non-Essential Amino Acids Solution (NEAA), 8% Fetal Bovine Serum (FBS) (v/v), 100 &#181;M of Taurine, and 2 mM Glutamine.</li>
		<li>A week after the detachment, change the medium to Medium III.</li>
		<li>From this day onward, culture the organoids in Medium III and refresh the medium twice a week.</li>
	</ol>
	</li>
	<li>Establishment of RB cell line. 
	NOTE: All the reagents are prewarmed at RT.
	<ol>
		<li>On day 90, the RBs (80%-90%) encompass the retinal organoids. Therefore, choose the 90-day RB organoids for the generation of the RB cell line.</li>
		<li>Prepare the 1640 medium by mixing the Roswell Park Memorial Institute (RPMI)-1640 medium with 10% FBS.</li>
		<li>Cut the RB into pieces (20-25 pieces per RB) with a microsurgical knife under a microscope in RPMI-1640 medium.</li>
		<li>Remove the RPMI-1640 medium and treat the pieces with 0.25% Trypsin/EDTA for 10 min at 37 &#176;C.</li>
		<li>Add the RPMI-1640 medium to end the reaction and centrifuge at 200 x g for 5 min.</li>
		<li>Remove the supernatant and resuspend the cells in 1640 medium in a non-adherent dish.</li>
		<li>The RB cell line is a floating culture. Change the medium twice a week and passage the RB cells within 2 weeks. 
		NOTE: The proliferation rate of primary RB cells is quite slow.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Liu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+embryonic+stem+cell-derived+organoid+retinoblastoma+reveals+a+cancerous+origin.">Human embryonic stem cell-derived organoid retinoblastoma reveals a cancerous origin.</a> Proceedings of the National Academy of Sciences of the United States of America. 117 (52), 33628-33638 (2020).</li><li>Singh, H. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Developmental+stage-specific+proliferation+and+retinoblastoma+genesis+in+RB-deficient+human+but+not+mouse+cone+precursors.">Developmental stage-specific proliferation and retinoblastoma genesis in RB-deficient human but not mouse cone precursors.</a> Proceedings of the National Academy of Sciences of the United States of America. 115 (40), 9391-9400 (2018).</li><li>Xu, X. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rb+suppresses+human+cone-precursor-derived+retinoblastoma+tumours.">Rb suppresses human cone-precursor-derived retinoblastoma tumours.</a> Nature. 514 (7522), 385-388 (2014).</li><li>Mendoza, P. R., Grossniklaus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biology+of+retinoblastoma.">The biology of retinoblastoma.</a> Progress in Molecular Biology and Translational Science. 134, 503-516 (2015).</li><li>Benavente, C. A., Dyer, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetics+and+epigenetics+of+human+retinoblastoma.">Genetics and epigenetics of human retinoblastoma.</a> Annual Review of Pathology. 10, 547-562 (2015).</li><li>Wu, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mouse+model+of+MYCN-driven+retinoblastoma+reveals+MYCN-independent+tumor+reemergence.">A mouse model of MYCN-driven retinoblastoma reveals MYCN-independent tumor reemergence.</a> The Journal of Clinical Investigation. 127 (3), 888-898 (2017).</li><li>Boucherie, C., Sowden, J. C., Ali, R. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induced+pluripotent+stem+cell+technology+for+generating+photoreceptors.">Induced pluripotent stem cell technology for generating photoreceptors.</a> Regenerative Medicine. 6 (4), 469-479 (2011).</li><li>Nakano, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Self-formation+of+optic+cups+and+storable+stratified+neural+retina+from+human+ESCs.">Self-formation of optic cups and storable stratified neural retina from human ESCs.</a> Cell Stem Cell. 10 (6), 771-785 (2012).</li><li>Lowe, A., Harris, R., Bhansali, P., Cvekl, A., Liu, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intercellular+adhesion-dependent+cell+survival+and+rock-regulated+actomyosin-driven+forces+mediate+self-formation+of+a+retinal+organoid.">Intercellular adhesion-dependent cell survival and rock-regulated actomyosin-driven forces mediate self-formation of a retinal organoid.</a> Stem Cell Reports. 6 (5), 743-756 (2016).</li><li>Zheng, C., Schneider, J. W., Hsieh, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+RB1+in+human+embryonic+stem+cell-derived+retinal+organoids.">Role of RB1 in human embryonic stem cell-derived retinal organoids.</a> Developmental Biology. 462 (2), 197-207 (2020).</li><li>Dimaras, H., Corson, T. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retinoblastoma,+the+visible+CNS+tumor:+A+review.">Retinoblastoma, the visible CNS tumor: A review.</a> Journal of Neuroscience Research. 97 (1), 29-44 (2019).</li><li>Xu, X. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retinoblastoma+has+properties+of+a+cone+precursor+tumor+and+depends+upon+cone-specific+MDM2+signaling.">Retinoblastoma has properties of a cone precursor tumor and depends upon cone-specific MDM2 signaling.</a> Cell. 137 (6), 1018-1031 (2009).</li><li>Qi, D. L., Cobrinik, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MDM2+but+not+MDM4+promotes+retinoblastoma+cell+proliferation+through+p53-independent+regulation+of+MYCN+translation.">MDM2 but not MDM4 promotes retinoblastoma cell proliferation through p53-independent regulation of MYCN translation.</a> Oncogene. 36 (13), 1760-1769 (2017).</li></ol>

The authors are not aware of any affiliations, memberships, funding, or financial holdings that might affect the objectivity of this study.

Human retinoblastoma (RB) is caused by the inactivation of RB1 and the dysfunction of Rb protein. In this protocol, the RB1-KO hESC is the pivotal step for the generation of RB in a dish. While even with RB1-/- hESC, it is possible that there is no RB formation due to the methods of retinal organoid differentiation10. In this protocol, the transfer from adherent culture to floating culture is essential in the process of differentiation. The density of the cyst...

Human retinoblastoma (RB) is a rare, fatal tumor derived from the retinal cone-precursors1,2,3, is the most common type of intraocular malignancy in childhood4. Homozygous inactivation of RB1 gene is the initiating genetic lesion in RB5. However, mice with RB1 mutations fail to form the retinal tumor2. Although the mouse tumors could be generated with the combination of Rb1 mutations and other genetic modifications, they still lack the features of human RB6. Thanks to the development of retinal organoid differentiation, the hESC-derived RB could be obtained, displaying the characters of human RB1.
Numerous protocols for retinal organoid differentiation have been established in the past decade, including 2D7, 3D8, and a combination of 2D and 3D9. The method used here to generate the human RB is the consolidation of adherent culture and floating culture9. By differentiating the RB1 mutated hESC into retinal organoids, the formation of RB is detected at around day 45, and then it proliferates rapidly at around day 60. On day 90, isolation of RBs, and generation of the RB cell line is possible; furthermore, RB surrounds almost all retinal organoids at day 120.
hESC-derived RB is an innovative model for exploring the origin, tumorigenesis, and treatments for RB. In this protocol, the generation of gene-editing hESC, the differentiation of RB, and characterization for RB are described in detail.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2-mercaptoethanol</td>
			<td>Life Technologies</td>
			<td>21985-023</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-ARR3</td>
			<td>Sigma</td>
			<td>HPA063129</td>
			<td>Antibody</td>
		</tr>
		<tr>
			<td>Anti-CRX (M02)</td>
			<td>Abnove</td>
			<td>ABN-H00001406-M02</td>
			<td>Antibody</td>
		</tr>
		<tr>
			<td>Anti-Ki67</td>
			<td>Abcam</td>
			<td>&#160;ab15580</td>
			<td>Antibody</td>
		</tr>
		<tr>
			<td>Anti-Syk (D3Z1E)</td>
			<td>Cell Signaling Technology</td>
			<td>13198</td>
			<td>Antibody</td>
		</tr>
		<tr>
			<td>BbsI</td>
			<td>NEB</td>
			<td>R3539S</td>
			<td>Restriction enzymes</td>
		</tr>
		<tr>
			<td>Dispase (1U/mL)</td>
			<td>Stemcell Technologies</td>
			<td>7923</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM basic</td>
			<td>Gibco</td>
			<td>10566-016</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM/F-12-GlutaMAX</td>
			<td>Gibco</td>
			<td>10565-042</td>
			<td></td>
		</tr>
		<tr>
			<td>DMSO</td>
			<td>Sigma</td>
			<td>D2650</td>
			<td></td>
		</tr>
		<tr>
			<td>DPBS</td>
			<td>Gibco</td>
			<td>C141905005BT</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Thermo</td>
			<td>15575020</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS), Qualified for Human Embryonic Stem Cells</td>
			<td>Biological Industry</td>
			<td>04-002-1A</td>
			<td></td>
		</tr>
		<tr>
			<td>Glutamine</td>
			<td>Gibco</td>
			<td>35050-061</td>
			<td></td>
		</tr>
		<tr>
			<td>Ham&#39;s F-12 Nutrient Mix (Hams F12)</td>
			<td>Gibco</td>
			<td>11765-054</td>
			<td></td>
		</tr>
		<tr>
			<td>MEM Non-essential Amino Acid Solution (100X)</td>
			<td>Sigma</td>
			<td>M7145</td>
			<td></td>
		</tr>
		<tr>
			<td>Neurobasal Medium</td>
			<td>Gibco</td>
			<td>21103-049</td>
			<td></td>
		</tr>
		<tr>
			<td>P3 Primary Cell 4D-Nucleofector X Kit S</td>
			<td>Lonza</td>
			<td>V4XP-3032</td>
			<td>Nucleofection kit</td>
		</tr>
		<tr>
			<td>Pen Strep</td>
			<td>Gibco</td>
			<td>15140-122</td>
			<td></td>
		</tr>
		<tr>
			<td>Puromycin</td>
			<td>Gene Operation</td>
			<td>ISY1130- 0025MG</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAquick PCR Purification Kit</td>
			<td>QIAGEN</td>
			<td>28104</td>
			<td></td>
		</tr>
		<tr>
			<td>ncEpic-hiPSC/hESC culture medium</td>
			<td>Nuwacell</td>
			<td>RP01001</td>
			<td>ncEpic-hiPSC/hESC culture medium in 1.2.1</td>
		</tr>
		<tr>
			<td>Growth factor reduced basement membrane matrix</td>
			<td>BD</td>
			<td>356231</td>
			<td>Matrigel in 1.2.1</td>
		</tr>
		<tr>
			<td>Cell dissociation enzyme</td>
			<td>Gibco</td>
			<td>12563-011</td>
			<td>TrypLE Express in 1.2.8</td>
		</tr>
		<tr>
			<td>RNeasy Midi Kit</td>
			<td>QIAGEN</td>
			<td>75144</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini Kit</td>
			<td>QIAGEN</td>
			<td>74104</td>
			<td></td>
		</tr>
		<tr>
			<td>Supplement A</td>
			<td>Life Technologies</td>
			<td>17502-048</td>
			<td>N-2 Supplement (100X), liquid, supplemet in medum I</td>
		</tr>
		<tr>
			<td>Supplement B</td>
			<td>Life Technologies</td>
			<td>17105-041</td>
			<td>B-27 Supplement (50X),liquid, supplemet in medum I,II,III</td>
		</tr>
		<tr>
			<td>T4 Polynucleotide Kinase</td>
			<td>Life Technologies</td>
			<td>EK0032</td>
			<td></td>
		</tr>
		<tr>
			<td>Taurine</td>
			<td>Sigma</td>
			<td>T-8691-25G</td>
			<td></td>
		</tr>
		<tr>
			<td>Y-27632 2HCl</td>
			<td>Selleck</td>
			<td>S1049</td>
			<td></td>
		</tr>
		<tr>
			<td>pX330-U6- Chimeric BB-CBh-hSpCas9-2A-Puro</td>
			<td>Addgene</td>
			<td>42230</td>
			<td></td>
		</tr>
		<tr>
			<td>Nucleofector 4D</td>
			<td>Lonza</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI</td>
			<td>Sigma</td>
			<td>R0883-500ML</td>
			<td></td>
		</tr>
	</tbody>
</table>

reconstruct human retinoblastoma in vitro

Human RB is pediatric cancer, which is lethal if no treatment is administered. As RB originates from cone precursors, which is relatively rare in rodent models, meanwhile regarding the interspecies differences between humans and rodents, a disease model derived from humans is more beneficial for uncovering the mechanisms of human RB and seeking the targets of therapy. Herein, the protocol describes the generation of two gene-edited hESC lines with a biallelic RB1 point mutation (RB1Mut/Mut) and an RB1 knockout mutation (RB1-/-), respectively. During the process of retinal development, the formation of RB is observed. The RB cell lines are also established by segregating from the RB organoids. Altogether, by differentiating the gene-edited hESC lines into the retinal organoids using a 2D and 3D combined differentiation protocol, we have successfully reconstructed the human RB in a dish and identified its cone-precursor origin. It would provide a helpful disease model for observing the retinoblastoma genesis, proliferation, and growth as well as further developing novel therapeutic agents.

The procedure of RB generation is elucidated in the Figure 1, which combines the adherent and floating culture. It was possible to harvest the human RB from RB1-KO hESC, and obtain the RB cell line by isolating the RB organoids.
Here, the protocol provides the details of the differentiation in different stages (Figure 2). Hollow spheres are formed in the first 3 days which attach to the culture surface and then expand (<stron...

Watch this Scientific Journal Video about Reconstruct Human Retinoblastoma In Vitro at JoVE.com

Reconstruct Human Retinoblastoma In Vitro

We describe a method for generating human retinoblastoma (RB) by introducing biallelic RB1 mutations in human embryonic stem cells (hESC). RB cell lines could also be successfully cultured using the isolated RB in a dish.

Human RB is pediatric cancer, which is lethal if no treatment is administered. As RB originates from cone precursors, which is relatively rare in rodent ...

reconstruct-human-retinoblastoma-in-vitro

Research

JoVE Journal

Cancer Research

1.3K Views.  Capital Medical University, Beijing Ophthalmology & Visual Science Key Laboratory. We describe a method for generating human retinoblastoma (RB) by introducing biallelic RB1 mutations in human embryonic stem cells (hESC). RB cell lines could also be successfully cultured using the isolated RB in a dish.

Video: Reconstruct Human Retinoblastoma In Vitro

Intra-iliac Artery Injection for Efficient and Selective Modeling of Microscopic Bone Metastasis

Intra-iliac artery (IIA) injection is an efficient approach to introduce metastatic lesions of various cancer cells in animals. Compared to the widely used intra-cardiac and intra-tibial injections, IIA injection brings several advantages. First, it can deliver a large quantity of cancer cells specifically to hind limb bones, thereby providing spatiotemporally synchronized early-stage colonization events and allowing robust quantification and swift detection of disseminated tumor cells. Second, it injects cancer cells into the circulation without damaging the local tissues, thereby avoiding inflammatory and wound-healing processes that confound the bone colonization process. Third, IIA injection causes very little metastatic growth in non-bone organs, thereby preventing animals from succumbing to other vital metastases, and allowing continuous monitoring of indolent bone lesions. These advantages are especially useful for the inspection of progression from single cancer cells to multi-cell micrometastases, which has largely been elusive in the past. When combined with cutting-edge approaches of biological imaging and bone histology, IIA injection can be applied to various research purposes related to bone metastases.

This manuscript provides the detailed procedure of intra-iliac artery (IIA) injection, a technique to deliver cancer cells specifically to hind limb tissues including bones to establish experimental bone metastases. Although initially established with breast tumor models, this protocol can be easily extended to other cancer types.

Intra-iliac artery (IIA) injection is an efficient approach to introduce metastatic lesions of various cancer cells in animals. Compared to the widely ...

Evaluating In Vitro DNA Damage Using Comet Assay

DNA damage is a common phenomenon for each cell during its lifespan, and is defined as an alteration of the chemical structure of genomic DNA. Cancer therapies, such as radio- and chemotherapy, introduce enormous amount of additional DNA damage, leading to cell cycle arrest and apoptosis to limit cancer progression. Quantitative assessment of DNA damage during experimental cancer therapy is a key step to justify the effectiveness of a genotoxic agent. In this study, we focus on a single cell electrophoresis assay, also known as the comet assay, which can quantify single and double-strand DNA breaks in vitro. The comet assay is a DNA damage quantification method that is efficient and easy to perform, and has low time/budget demands and high reproducibility. Here, we highlight the utility of the comet assay for a preclinical study by evaluating the genotoxic effect of olaparib/temozolomide combination therapy to U251 glioma cells.

Evaluating In Vitro DNA Damage Using Comet Assay

The comet assay is an efficient method to detect DNA damage including single and double-stranded DNA breaks. We describe alkaline and neutral comet assays to measure DNA damage in cancer cells to evaluate the therapeutic effect of chemotherapy.

DNA damage is a common phenomenon for each cell during its lifespan, and is defined as an alteration of the chemical structure of genomic DNA. Cancer ...

Moving Upwards: A Simple and Flexible In Vitro Three-dimensional Invasion Assay Protocol

Although 3D invasion assays have been developed, the challenge remains to study cells without affecting the integrity of their microenvironment. Traditional 3D assays such as the Boyden Chamber require that cells are displaced from the original culture location and moved to a new environment. Not only does this disrupt the cellular processes that are intrinsic to the microenvironment, but it often results in a loss of cells. These problems are especially challenging when dealing with cells that are either rare, or extremely sensitive to their microenvironment. Here, we describe the development of a 3D invasion assay that avoids both concerns. In this assay, cells are plated within a small well and an ECM matrix containing a chemoattractant is laid atop the cells. This requires no cell displacement, and allows the cells to invade upwards into the matrix. In this assay, cell invasion as well as cell morphology can be assessed within the collagen gel. Using this assay, we characterize the invasive capacity of rare and sensitive cells; the hybrid cells resulting from fusion between breast cancer cells MCF7 and mesenchymal/multipotent stem/stroma cells (MSCs).

Moving Upwards: A Simple and Flexible In Vitro Three-dimensional Invasion Assay Protocol

This protocol describes an inverted vertical invasion assay that could be used to quantify the migration and invasion capabilities of cells in a three-dimensional setting while preserving the cell microenvironment. This assay is suitable for rare and/or sensitive cells.

Although 3D invasion assays have been developed, the challenge remains to study cells without affecting the integrity of their microenvironment. ...

In Vitro Assay to Study Tumor-macrophage Interaction

Tumor associated macrophages (TAMs) account for a large percentage of cells in the tumor mass for different types of cancers. Glioblastoma (GBM), a malignant brain tumor with no cure, has up to a half the tumor mass TAMs. TAMs can be pro-tumoral or anti-tumoral, depending on the activation of specific genes in the cells. Genetic mutations in the tumors, through regulating cytokine expression, can affect recruitment of TAMs to the tumor microenvironment. Here, we describe a quantitative cell-based assay to assess macrophage recruitment by the conditioned medium from the tumor cells. This assay uses the human macrophage cell line MV-4-11 to study macrophage attraction by the conditioned medium from glioblastoma, allowing for high reproducibility and low variability. Data generated with this assay can contribute to a better understanding of the interaction between the tumor and the tumor microenvironment. Similar assay can be used to assess interaction between the tumor cells and other immune cells, including T cells and natural killer (NK) cells.

This article represents a useful in vitro assay to evaluate the capability of conditioned medium from tumor cells to attract macrophages.

Tumor associated macrophages (TAMs) account for a large percentage of cells in the tumor mass for different types of cancers. Glioblastoma (GBM), a ...

In Vitro Establishment of a Genetically Engineered Murine Head and Neck Cancer Cell Line using an Adeno-Associated Virus-Cas9 System

The use of primary normal epithelial cells makes it possible to reproducibly induce genomic alterations required for cellular transformation by introducing specific mutations in oncogenes and tumor suppressor genes, using clustered regulatory interspaced short palindromic repeat (CRISPR)-based genome editing technology in mice. This technology allows us to accurately mimic the genetic changes that occur in human cancers using mice. By genetically transforming murine primary cells, we can better study cancer development, progression, treatment, and diagnosis. In this study, we used Cre-inducible Cas9 mouse tongue epithelial cells to enable genome editing using adeno-associated virus (AAV) in vitro. Specifically, by altering KRAS, p53, and APC in normal tongue epithelial cells, we generated a murine head and neck cancer (HNC) cell line in vitro,which is tumorigenic in syngeneic mice. The method presented here describes in detail how to generate HNC cell lines with specific genomic alterations and explains their suitability for predicting tumor progression in syngeneic mice. We envision that this promising method will be informative and useful to study tumor biology and therapy of HNC.

Development of murine models with specific genes mutated in head and neck cancer patients is required for understanding of neoplasia. Here, we present a protocol for in vitro transformation of primary murine tongue cells using an adeno-associated virus-Cas9 system to generate murine HNC cell lines with specific genomic alterations.

The use of primary normal epithelial cells makes it possible to reproducibly induce genomic alterations required for cellular transformation by ...

Measuring Real-time Drug Response in Organotypic Tumor Tissue Slices

Tumor tissues are composed of cancerous cells, infiltrated immune cells, endothelial cells, fibroblasts, and extracellular matrix. This complex milieu constitutes the tumor microenvironment (TME) and can modulate response to therapy in vivo or drug response ex vivo. Conventional cancer drug discovery screens are carried out on cells cultured in a monolayer, a system critically lacking the influence of TME. Thus, experimental systems that integrate sensitive and high-throughput assays with physiological TME will strengthen the preclinical drug discovery process. Here, we introduce ex vivo tumor tissue slice culture as a platform for medium-high-throughput drug screening. Organotypic tissue slice culture constitutes precisely-cut, thin tumor sections that are maintained with the support of a porous membrane in a liquid-air interface. In this protocol, we describe the preparation and maintenance of tissue slices prepared from mouse tumors and tumors from patient-derived xenograft (PDX) models. To assess changes in tissue viability in response to drug treatment, we leveraged a biocompatible luminescence-based viability assay that enables real-time, rapid, and sensitive measurement of viable cells in the tissue. Using this platform, we evaluated dose-dependent responses of tissue slices to the multi-kinase inhibitor, staurosporine, and cytotoxic agent, doxorubicin. Further, we demonstrate the application of tissue slices for ex vivo pharmacology by screening 17 clinical and preclinical drugs on tissue slices prepared from a single PDX tumor. Our physiologically-relevant, highly-sensitive, and robust ex vivo screening platform will greatly strengthen preclinical oncology drug discovery and treatment decision making.&#160;

We introduce a protocol for measuring real-time drug response in organotypic tumor tissue slices. The experimental strategy outlined here provides a platform to carry out medium-high throughput drug screens on tissue slices derived from clinical or mouse tumors in ex vivo conditions.

Tumor tissues are composed of cancerous cells, infiltrated immune cells, endothelial cells, fibroblasts, and extracellular matrix. This complex milieu ...

In Vitro Evaluation of Oncogenic Transformation in Human Mammary Epithelial Cells

Tumorigenesis is a multi-step process in which cells acquire capabilities&#160;that allow their growth, survival, and dissemination under hostile conditions. Different tests seek to identify and quantify these hallmarks of cancerous cells; however, they often focus on a single aspect of cellular transformation and, in fact, multiple tests are required for their proper characterization. The purpose of this work is to provide researchers with a set of tools to assess cellular transformation in vitro from a broad perspective, thereby making it possible to draw sound conclusions.
A sustained proliferative signaling activation is the major feature of tumoral tissues and can be easily monitored under in vitro conditions by calculating the number of population doublings achieved over time. Besides, the growth of cells in 3D cultures allows their interaction with surrounding cells, resembling what occurs in vivo. This enables the evaluation of cellular aggregation and, together with immunofluorescent labeling of distinctive cellular markers, to obtain information on another relevant feature of tumoral transformation: the loss of proper organization. Another remarkable characteristic of transformed cells is their capacity to grow without attachment to other cells and to the extracellular matrix, which can be evaluated with the anchorage assay.
Detailed experimental procedures to evaluate cell growth rate, to perform immunofluorescent labeling of cell lineage markers in 3D cultures, and to test anchorage-independent cell growth in soft agar are provided. These methodologies are optimized for Breast Primary Epithelial Cells (BPEC) due to its relevance in breast cancer; however, procedures can be applied to other cell types after some adjustments.

This protocol provides experimental in vitro tools to evaluate the transformation of human mammary cells. Detailed steps to follow-up cell proliferation rate, anchorage-independent growth capacity, and distribution of cell lineages in 3D cultures with basement membrane matrix are described.

Tumorigenesis is a multi-step process in which cells acquire capabilities&#160;that allow their growth, survival, and dissemination under hostile ...

Three-Dimensional In Vitro Biomimetic Model of Neuroblastoma Using Collagen-Based Scaffolds

Neuroblastoma is the most common extracranial solid tumor in children, accounting for 15% of overall pediatric cancer deaths. The native tumor tissue is a complex three-dimensional (3D) microenvironment involving layers of cancerous and non-cancerous cells surrounded by an extracellular matrix (ECM). The ECM provides physical and biological support and contributes to disease progression, patient prognosis, and therapeutic response.
This paper describes a protocol for assembling a 3D scaffold-based system to mimic the neuroblastoma microenvironment using neuroblastoma cell lines and collagen-based scaffolds. The scaffolds are supplemented with either nanohydroxyapatite (nHA) or glycosaminoglycans (GAGs), naturally found at high concentrations in the bone and bone marrow, the most common metastatic sites of neuroblastoma. The 3D porous structure of these scaffolds allows neuroblastoma cell attachment, proliferation and migration, and the formation of cell clusters. In this 3D matrix, the cell response to therapeutics is more reflective of the in vivo situation.
The scaffold-based culture system can maintain higher cell densities than conventional two-dimensional (2D) cell culture. Therefore, optimization protocols for initial seeding cell numbers are dependent on the desired experimental timeframes. The model is monitored by assessing cell growth via DNA quantification, cell viability via metabolic assays, and cell distribution within the scaffolds via histological staining.
This model&#39;s applications include the assessment of gene and protein expression profiles as well as cytotoxicity testing using conventional drugs and miRNAs. The 3D culture system allows for the precise manipulation of cell and ECM components, creating an environment more physiologically similar to native tumor tissue. Therefore, this 3D in vitro model will advance the understanding of the disease pathogenesis and improve the correlation between results obtained in vitro, in vivo in&#160;animal models, and human subjects.

Three-Dimensional In Vitro Biomimetic Model of Neuroblastoma Using Collagen-Based Scaffolds

This paper lists the steps required to seed neuroblastoma cell lines on previously described three-dimensional collagen-based scaffolds, maintain cell growth for a predetermined timeframe, and retrieve scaffolds for several cell growth and cell behavior analyses and downstream applications, adaptable to satisfy a range of experimental aims.

Neuroblastoma is the most common extracranial solid tumor in children, accounting for 15% of overall pediatric cancer deaths. The native tumor tissue is a ...

High-Throughput In Vitro Assay using Patient-Derived Tumor Organoids

Patient-derived tumor organoids (PDOs) are expected to be a preclinical cancer model with better reproducibility of disease than traditional cell culture models. PDOs have been successfully generated from a variety of human tumors to recapitulate the architecture and function of tumor tissue accurately and efficiently. However, PDOs are unsuitable for an in vitro high-throughput assay system (HTS) or cell analysis using 96-well or 384-well plates when evaluating anticancer drugs because they are heterogeneous in size and form large clusters in culture. These cultures and assays use extracellular matrices, such as Matrigel, to create tumor tissue scaffolds. Therefore, PDOs have a low throughput and high cost, and it has been difficult to develop a suitable assay system. To address this issue, a simpler and more accurate HTS was established using PDOs to evaluate the potency of anticancer drugs and immunotherapy. An in vitro HTS was created that uses PDOs established from solid tumors cultured in 384-well plates. An HTS was also developed for assessment of antibody-dependent cellular cytotoxicity activity to represent the immune response using PDOs cultured in 96-well plates.

High-Throughput In Vitro Assay using Patient-Derived Tumor Organoids

A highly accurate in vitro high-throughput assay system was developed to evaluate anticancer drugs using patient-derived tumor organoids (PDOs), similar to cancer tissues but are unsuitable for in vitro high-throughput assay systems with 96-well and 384-well plates.

Patient-derived tumor organoids (PDOs) are expected to be a preclinical cancer model with better reproducibility of disease than traditional cell culture ...

Evaluation of the In vivo Antitumor Activity of Polyanhydride IL-1&#945; Nanoparticles

Cytokine therapy is a promising immunotherapeutic strategy that can produce robust antitumor immune responses in cancer patients. The proinflammatory cytokine interleukin-1 alpha (IL-1&#945;) has been evaluated as an anticancer agent in several preclinical and clinical studies. However, dose-limiting toxicities, including flu-like symptoms and hypotension, have dampened the enthusiasm for this therapeutic strategy. Polyanhydride nanoparticle (NP)-based delivery of IL-1&#945; would represent an effective approach in this context since this may allow for a slow and controlled release of IL-1&#945; systemically while reducing toxic side effects. Here an analysis of the antitumor activity of IL-1&#945;-loaded polyanhydride NPs in a head and neck squamous cell carcinoma (HNSCC) syngeneic mouse model is described. Murine oropharyngeal epithelial cells stably expressing HPV16 E6/E7 together with hRAS and luciferase (mEERL) cells were injected subcutaneously into the right flank of C57BL/6J mice. Once tumors reached 3-4 mm in any direction, a 1.5% IL-1a - loaded 20:80 1,8-bis(p-carboxyphenoxy)-3,6-dioxaoctane:1,6-bis(p-carboxyphenoxy)hexane (CPTEG: CPH) nanoparticle (IL-1&#945;-NP) formulation was administered to mice intraperitoneally. Tumor size and body weight were continuously measured until tumor size or weight loss reached euthanasia criteria. Blood samples were taken to evaluate antitumor immune responses by submandibular venipuncture, and inflammatory cytokines were measured through cytokine multiplex assays. Tumor and inguinal lymph nodes were resected and homogenized into a single-cell suspension to analyze various immune cells through multicolor flow cytometry. These standard methods will allow investigators to study the antitumor immune response and potential mechanism of immunostimulatory NPs and other immunotherapy agents for cancer treatment.

Evaluation of the In vivo Antitumor Activity of Polyanhydride IL-1&#945; Nanoparticles

A standard protocol is described to study the antitumor activity and associated toxicity of IL-1&#945; in a syngeneic mouse model of HNSCC.

Cytokine therapy is a promising immunotherapeutic strategy that can produce robust antitumor immune responses in cancer patients. The proinflammatory ...

Reconstruct Human Retinoblastoma In Vitro

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

Intra-iliac Artery Injection for Efficient and Selective Modeling of Microscopic Bone Metastasis

Evaluating In Vitro DNA Damage Using Comet Assay

Moving Upwards: A Simple and Flexible In Vitro Three-dimensional Invasion Assay Protocol

In Vitro Assay to Study Tumor-macrophage Interaction

In Vitro Establishment of a Genetically Engineered Murine Head and Neck Cancer Cell Line using an Adeno-Associated Virus-Cas9 System

Measuring Real-time Drug Response in Organotypic Tumor Tissue Slices

In Vitro Evaluation of Oncogenic Transformation in Human Mammary Epithelial Cells

Three-Dimensional In Vitro Biomimetic Model of Neuroblastoma Using Collagen-Based Scaffolds

High-Throughput In Vitro Assay using Patient-Derived Tumor Organoids

Evaluation of the In vivo Antitumor Activity of Polyanhydride IL-1α Nanoparticles