Name: reconstruct human retinoblastoma in vitro
Uploaded: 2022-10-11T12:30:00
Description: Watch this Scientific Journal Video about Reconstruct Human Retinoblastoma In Vitro at JoVE.com

We thank the 502 team for all the help. This work is partly supported by the Beijing Municipal Natural Science Foundation (Z200014) and National Key R&#38;D Program of China (2017YFA0105300).

This study is approved by the institutional Ethics Committee of Beijing Tongren Hospital, Capital Medical University. H9 hESCs are obtained from the WiCell Research Institute.
1. Generation of RB1 mutated hESC
<ol>
	<li>CRISPR/Cas9 targeting vector for the knockout (KO) of RB1.
	<ol>
		<li>Design a pair of sgRNA. For the ablation of RB1, target the first exon of this gene. The forward primer sequence is CACCGCGGTGGCGGCCGTTTTTCGG, and the reverse primer sequence is...

<ol>
	<li>Liu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+embryonic+stem+cell-derived+organoid+retinoblastoma+reveals+a+cancerous+origin.">Human embryonic stem cell-derived organoid retinoblastoma reveals a cancerous origin.</a> Proceedings of the National Academy of Sciences of the United States of America. 117 (52), 33628-33638 (2020).</li><li>Singh, H. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Developmental+stage-specific+proliferation+and+retinoblastoma+genesis+in+RB-deficient+human+but+not+mouse+cone+precursors.">Developmental stage-specific proliferation and retinoblastoma genesis in RB-deficient human but not mouse cone precursors.</a> Proceedings of the National Academy of Sciences of the United States of America. 115 (40), 9391-9400 (2018).</li><li>Xu, X. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rb+suppresses+human+cone-precursor-derived+retinoblastoma+tumours.">Rb suppresses human cone-precursor-derived retinoblastoma tumours.</a> Nature. 514 (7522), 385-388 (2014).</li><li>Mendoza, P. R., Grossniklaus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biology+of+retinoblastoma.">The biology of retinoblastoma.</a> Progress in Molecular Biology and Translational Science. 134, 503-516 (2015).</li><li>Benavente, C. A., Dyer, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetics+and+epigenetics+of+human+retinoblastoma.">Genetics and epigenetics of human retinoblastoma.</a> Annual Review of Pathology. 10, 547-562 (2015).</li><li>Wu, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mouse+model+of+MYCN-driven+retinoblastoma+reveals+MYCN-independent+tumor+reemergence.">A mouse model of MYCN-driven retinoblastoma reveals MYCN-independent tumor reemergence.</a> The Journal of Clinical Investigation. 127 (3), 888-898 (2017).</li><li>Boucherie, C., Sowden, J. C., Ali, R. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induced+pluripotent+stem+cell+technology+for+generating+photoreceptors.">Induced pluripotent stem cell technology for generating photoreceptors.</a> Regenerative Medicine. 6 (4), 469-479 (2011).</li><li>Nakano, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Self-formation+of+optic+cups+and+storable+stratified+neural+retina+from+human+ESCs.">Self-formation of optic cups and storable stratified neural retina from human ESCs.</a> Cell Stem Cell. 10 (6), 771-785 (2012).</li><li>Lowe, A., Harris, R., Bhansali, P., Cvekl, A., Liu, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intercellular+adhesion-dependent+cell+survival+and+rock-regulated+actomyosin-driven+forces+mediate+self-formation+of+a+retinal+organoid.">Intercellular adhesion-dependent cell survival and rock-regulated actomyosin-driven forces mediate self-formation of a retinal organoid.</a> Stem Cell Reports. 6 (5), 743-756 (2016).</li><li>Zheng, C., Schneider, J. W., Hsieh, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+RB1+in+human+embryonic+stem+cell-derived+retinal+organoids.">Role of RB1 in human embryonic stem cell-derived retinal organoids.</a> Developmental Biology. 462 (2), 197-207 (2020).</li><li>Dimaras, H., Corson, T. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retinoblastoma,+the+visible+CNS+tumor:+A+review.">Retinoblastoma, the visible CNS tumor: A review.</a> Journal of Neuroscience Research. 97 (1), 29-44 (2019).</li><li>Xu, X. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retinoblastoma+has+properties+of+a+cone+precursor+tumor+and+depends+upon+cone-specific+MDM2+signaling.">Retinoblastoma has properties of a cone precursor tumor and depends upon cone-specific MDM2 signaling.</a> Cell. 137 (6), 1018-1031 (2009).</li><li>Qi, D. L., Cobrinik, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MDM2+but+not+MDM4+promotes+retinoblastoma+cell+proliferation+through+p53-independent+regulation+of+MYCN+translation.">MDM2 but not MDM4 promotes retinoblastoma cell proliferation through p53-independent regulation of MYCN translation.</a> Oncogene. 36 (13), 1760-1769 (2017).</li></ol>

Human retinoblastoma (RB) is caused by the inactivation of RB1 and the dysfunction of Rb protein. In this protocol, the RB1-KO hESC is the pivotal step for the generation of RB in a dish. While even with RB1-/- hESC, it is possible that there is no RB formation due to the methods of retinal organoid differentiation10. In this protocol, the transfer from adherent culture to floating culture is essential in the process of differentiation. The density of the cyst...

Human retinoblastoma (RB) is a rare, fatal tumor derived from the retinal cone-precursors1,2,3, is the most common type of intraocular malignancy in childhood4. Homozygous inactivation of RB1 gene is the initiating genetic lesion in RB5. However, mice with RB1 mutations fail to form the retinal tumor2. Although the mouse tumors could be generated with the combination of Rb1 mutations and other genetic modifications, they still lack the features of human RB6. Thanks to the development of retinal organoid differentiation, the hESC-derived RB could be obtained, displaying the characters of human RB1.
Numerous protocols for retinal organoid differentiation have been established in the past decade, including 2D7, 3D8, and a combination of 2D and 3D9. The method used here to generate the human RB is the consolidation of adherent culture and floating culture9. By differentiating the RB1 mutated hESC into retinal organoids, the formation of RB is detected at around day 45, and then it proliferates rapidly at around day 60. On day 90, isolation of RBs, and generation of the RB cell line is possible; furthermore, RB surrounds almost all retinal organoids at day 120.
hESC-derived RB is an innovative model for exploring the origin, tumorigenesis, and treatments for RB. In this protocol, the generation of gene-editing hESC, the differentiation of RB, and characterization for RB are described in detail.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2-mercaptoethanol</td>
			<td>Life Technologies</td>
			<td>21985-023</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-ARR3</td>
			<td>Sigma</td>
			<td>HPA063129</td>
			<td>Antibody</td>
		</tr>
		<tr>
			<td>Anti-CRX (M02)</td>
			<td>Abnove</td>
			<td>ABN-H00001406-M02</td>
			<td>Antibody</td>
		</tr>
		<tr>
			<td>Anti-Ki67</td>
			<td>Abcam</td>
			<td>&#160;ab15580</td>
			<td>Antibody</td>
		</tr>
		<tr>
			<td>Anti-Syk (D3Z1E)</td>
			<td>Cell Signaling Technology</td>
			<td>13198</td>
			<td>Antibody</td>
		</tr>
		<tr>
			<td>BbsI</td>
			<td>NEB</td>
			<td>R3539S</td>
			<td>Restriction enzymes</td>
		</tr>
		<tr>
			<td>Dispase (1U/mL)</td>
			<td>Stemcell Technologies</td>
			<td>7923</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM basic</td>
			<td>Gibco</td>
			<td>10566-016</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM/F-12-GlutaMAX</td>
			<td>Gibco</td>
			<td>10565-042</td>
			<td></td>
		</tr>
		<tr>
			<td>DMSO</td>
			<td>Sigma</td>
			<td>D2650</td>
			<td></td>
		</tr>
		<tr>
			<td>DPBS</td>
			<td>Gibco</td>
			<td>C141905005BT</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Thermo</td>
			<td>15575020</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS), Qualified for Human Embryonic Stem Cells</td>
			<td>Biological Industry</td>
			<td>04-002-1A</td>
			<td></td>
		</tr>
		<tr>
			<td>Glutamine</td>
			<td>Gibco</td>
			<td>35050-061</td>
			<td></td>
		</tr>
		<tr>
			<td>Ham&#39;s F-12 Nutrient Mix (Hams F12)</td>
			<td>Gibco</td>
			<td>11765-054</td>
			<td></td>
		</tr>
		<tr>
			<td>MEM Non-essential Amino Acid Solution (100X)</td>
			<td>Sigma</td>
			<td>M7145</td>
			<td></td>
		</tr>
		<tr>
			<td>Neurobasal Medium</td>
			<td>Gibco</td>
			<td>21103-049</td>
			<td></td>
		</tr>
		<tr>
			<td>P3 Primary Cell 4D-Nucleofector X Kit S</td>
			<td>Lonza</td>
			<td>V4XP-3032</td>
			<td>Nucleofection kit</td>
		</tr>
		<tr>
			<td>Pen Strep</td>
			<td>Gibco</td>
			<td>15140-122</td>
			<td></td>
		</tr>
		<tr>
			<td>Puromycin</td>
			<td>Gene Operation</td>
			<td>ISY1130- 0025MG</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAquick PCR Purification Kit</td>
			<td>QIAGEN</td>
			<td>28104</td>
			<td></td>
		</tr>
		<tr>
			<td>ncEpic-hiPSC/hESC culture medium</td>
			<td>Nuwacell</td>
			<td>RP01001</td>
			<td>ncEpic-hiPSC/hESC culture medium in 1.2.1</td>
		</tr>
		<tr>
			<td>Growth factor reduced basement membrane matrix</td>
			<td>BD</td>
			<td>356231</td>
			<td>Matrigel in 1.2.1</td>
		</tr>
		<tr>
			<td>Cell dissociation enzyme</td>
			<td>Gibco</td>
			<td>12563-011</td>
			<td>TrypLE Express in 1.2.8</td>
		</tr>
		<tr>
			<td>RNeasy Midi Kit</td>
			<td>QIAGEN</td>
			<td>75144</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini Kit</td>
			<td>QIAGEN</td>
			<td>74104</td>
			<td></td>
		</tr>
		<tr>
			<td>Supplement A</td>
			<td>Life Technologies</td>
			<td>17502-048</td>
			<td>N-2 Supplement (100X), liquid, supplemet in medum I</td>
		</tr>
		<tr>
			<td>Supplement B</td>
			<td>Life Technologies</td>
			<td>17105-041</td>
			<td>B-27 Supplement (50X),liquid, supplemet in medum I,II,III</td>
		</tr>
		<tr>
			<td>T4 Polynucleotide Kinase</td>
			<td>Life Technologies</td>
			<td>EK0032</td>
			<td></td>
		</tr>
		<tr>
			<td>Taurine</td>
			<td>Sigma</td>
			<td>T-8691-25G</td>
			<td></td>
		</tr>
		<tr>
			<td>Y-27632 2HCl</td>
			<td>Selleck</td>
			<td>S1049</td>
			<td></td>
		</tr>
		<tr>
			<td>pX330-U6- Chimeric BB-CBh-hSpCas9-2A-Puro</td>
			<td>Addgene</td>
			<td>42230</td>
			<td></td>
		</tr>
		<tr>
			<td>Nucleofector 4D</td>
			<td>Lonza</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI</td>
			<td>Sigma</td>
			<td>R0883-500ML</td>
			<td></td>
		</tr>
	</tbody>
</table>

reconstruct human retinoblastoma in vitro

Human RB is pediatric cancer, which is lethal if no treatment is administered. As RB originates from cone precursors, which is relatively rare in rodent models, meanwhile regarding the interspecies differences between humans and rodents, a disease model derived from humans is more beneficial for uncovering the mechanisms of human RB and seeking the targets of therapy. Herein, the protocol describes the generation of two gene-edited hESC lines with a biallelic RB1 point mutation (RB1Mut/Mut) and an RB1 knockout mutation (RB1-/-), respectively. During the process of retinal development, the formation of RB is observed. The RB cell lines are also established by segregating from the RB organoids. Altogether, by differentiating the gene-edited hESC lines into the retinal organoids using a 2D and 3D combined differentiation protocol, we have successfully reconstructed the human RB in a dish and identified its cone-precursor origin. It would provide a helpful disease model for observing the retinoblastoma genesis, proliferation, and growth as well as further developing novel therapeutic agents.

The procedure of RB generation is elucidated in the Figure 1, which combines the adherent and floating culture. It was possible to harvest the human RB from RB1-KO hESC, and obtain the RB cell line by isolating the RB organoids.
Here, the protocol provides the details of the differentiation in different stages (Figure 2). Hollow spheres are formed in the first 3 days which attach to the culture surface and then expand (<stron...

Watch this Scientific Journal Video about Reconstruct Human Retinoblastoma In Vitro at JoVE.com

Reconstruct Human Retinoblastoma In Vitro

We describe a method for generating human retinoblastoma (RB) by introducing biallelic RB1 mutations in human embryonic stem cells (hESC). RB cell lines could also be successfully cultured using the isolated RB in a dish.

Human RB is pediatric cancer, which is lethal if no treatment is administered. As RB originates from cone precursors, which is relatively rare in rodent ...

Research

JoVE Journal

Cancer Research

Intra-iliac Artery Injection for Efficient and Selective Modeling of Microscopic Bone Metastasis

Intra-iliac artery (IIA) injection is an efficient approach to introduce metastatic lesions of various cancer cells in animals. Compared to the widely ...

Evaluating In Vitro DNA Damage Using Comet Assay

Evaluating In Vitro DNA Damage Using Comet Assay

DNA damage is a common phenomenon for each cell during its lifespan, and is defined as an alteration of the chemical structure of genomic DNA. Cancer ...

Moving Upwards: A Simple and Flexible In Vitro Three-dimensional Invasion Assay Protocol

Moving Upwards: A Simple and Flexible In Vitro Three-dimensional Invasion Assay Protocol

Although 3D invasion assays have been developed, the challenge remains to study cells without affecting the integrity of their microenvironment. ...

In Vitro Assay to Study Tumor-macrophage Interaction

Tumor associated macrophages (TAMs) account for a large percentage of cells in the tumor mass for different types of cancers. Glioblastoma (GBM), a ...

Prostate Organoid Cultures as Tools to Translate Genotypes and Mutational Profiles to Pharmacological Responses

Presented here is a protocol to study pharmacodynamics, stem cell potential, and cancer differentiation in prostate epithelial organoids. Prostate ...

In Vitro Establishment of a Genetically Engineered Murine Head and Neck Cancer Cell Line using an Adeno-Associated Virus-Cas9 System

The use of primary normal epithelial cells makes it possible to reproducibly induce genomic alterations required for cellular transformation by ...

Measuring Real-time Drug Response in Organotypic Tumor Tissue Slices

Tumor tissues are composed of cancerous cells, infiltrated immune cells, endothelial cells, fibroblasts, and extracellular matrix. This complex milieu ...

In Vitro Evaluation of Oncogenic Transformation in Human Mammary Epithelial Cells

Tumorigenesis is a multi-step process in which cells acquire capabilities&#160;that allow their growth, survival, and dissemination under hostile ...

Three-Dimensional In Vitro Biomimetic Model of Neuroblastoma Using Collagen-Based Scaffolds

Three-Dimensional In Vitro Biomimetic Model of Neuroblastoma Using Collagen-Based Scaffolds

Neuroblastoma is the most common extracranial solid tumor in children, accounting for 15% of overall pediatric cancer deaths. The native tumor tissue is a ...

High-Throughput In Vitro Assay using Patient-Derived Tumor Organoids

High-Throughput In Vitro Assay using Patient-Derived Tumor Organoids

Patient-derived tumor organoids (PDOs) are expected to be a preclinical cancer model with better reproducibility of disease than traditional cell culture ...