We thank the 502 team for all the help. This work is partly supported by the Beijing Municipal Natural Science Foundation (Z200014) and National Key R&#38;D Program of China (2017YFA0105300).

This study is approved by the institutional Ethics Committee of Beijing Tongren Hospital, Capital Medical University. H9 hESCs are obtained from the WiCell Research Institute.
1. Generation of RB1 mutated hESC
<ol>
	<li>CRISPR/Cas9 targeting vector for the knockout (KO) of RB1.
	<ol>
		<li>Design a pair of sgRNA. For the ablation of RB1, target the first exon of this gene. The forward primer sequence is CACCGCGGTGGCGGCCGTTTTTCGG, and the reverse primer sequence is...

<ol>
	<li>Liu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+embryonic+stem+cell-derived+organoid+retinoblastoma+reveals+a+cancerous+origin.">Human embryonic stem cell-derived organoid retinoblastoma reveals a cancerous origin.</a> Proceedings of the National Academy of Sciences of the United States of America. 117 (52), 33628-33638 (2020).</li><li>Singh, H. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Developmental+stage-specific+proliferation+and+retinoblastoma+genesis+in+RB-deficient+human+but+not+mouse+cone+precursors.">Developmental stage-specific proliferation and retinoblastoma genesis in RB-deficient human but not mouse cone precursors.</a> Proceedings of the National Academy of Sciences of the United States of America. 115 (40), 9391-9400 (2018).</li><li>Xu, X. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rb+suppresses+human+cone-precursor-derived+retinoblastoma+tumours.">Rb suppresses human cone-precursor-derived retinoblastoma tumours.</a> Nature. 514 (7522), 385-388 (2014).</li><li>Mendoza, P. R., Grossniklaus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biology+of+retinoblastoma.">The biology of retinoblastoma.</a> Progress in Molecular Biology and Translational Science. 134, 503-516 (2015).</li><li>Benavente, C. A., Dyer, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetics+and+epigenetics+of+human+retinoblastoma.">Genetics and epigenetics of human retinoblastoma.</a> Annual Review of Pathology. 10, 547-562 (2015).</li><li>Wu, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mouse+model+of+MYCN-driven+retinoblastoma+reveals+MYCN-independent+tumor+reemergence.">A mouse model of MYCN-driven retinoblastoma reveals MYCN-independent tumor reemergence.</a> The Journal of Clinical Investigation. 127 (3), 888-898 (2017).</li><li>Boucherie, C., Sowden, J. C., Ali, R. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induced+pluripotent+stem+cell+technology+for+generating+photoreceptors.">Induced pluripotent stem cell technology for generating photoreceptors.</a> Regenerative Medicine. 6 (4), 469-479 (2011).</li><li>Nakano, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Self-formation+of+optic+cups+and+storable+stratified+neural+retina+from+human+ESCs.">Self-formation of optic cups and storable stratified neural retina from human ESCs.</a> Cell Stem Cell. 10 (6), 771-785 (2012).</li><li>Lowe, A., Harris, R., Bhansali, P., Cvekl, A., Liu, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intercellular+adhesion-dependent+cell+survival+and+rock-regulated+actomyosin-driven+forces+mediate+self-formation+of+a+retinal+organoid.">Intercellular adhesion-dependent cell survival and rock-regulated actomyosin-driven forces mediate self-formation of a retinal organoid.</a> Stem Cell Reports. 6 (5), 743-756 (2016).</li><li>Zheng, C., Schneider, J. W., Hsieh, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+RB1+in+human+embryonic+stem+cell-derived+retinal+organoids.">Role of RB1 in human embryonic stem cell-derived retinal organoids.</a> Developmental Biology. 462 (2), 197-207 (2020).</li><li>Dimaras, H., Corson, T. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retinoblastoma,+the+visible+CNS+tumor:+A+review.">Retinoblastoma, the visible CNS tumor: A review.</a> Journal of Neuroscience Research. 97 (1), 29-44 (2019).</li><li>Xu, X. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retinoblastoma+has+properties+of+a+cone+precursor+tumor+and+depends+upon+cone-specific+MDM2+signaling.">Retinoblastoma has properties of a cone precursor tumor and depends upon cone-specific MDM2 signaling.</a> Cell. 137 (6), 1018-1031 (2009).</li><li>Qi, D. L., Cobrinik, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MDM2+but+not+MDM4+promotes+retinoblastoma+cell+proliferation+through+p53-independent+regulation+of+MYCN+translation.">MDM2 but not MDM4 promotes retinoblastoma cell proliferation through p53-independent regulation of MYCN translation.</a> Oncogene. 36 (13), 1760-1769 (2017).</li></ol>

Human retinoblastoma (RB) is caused by the inactivation of RB1 and the dysfunction of Rb protein. In this protocol, the RB1-KO hESC is the pivotal step for the generation of RB in a dish. While even with RB1-/- hESC, it is possible that there is no RB formation due to the methods of retinal organoid differentiation10. In this protocol, the transfer from adherent culture to floating culture is essential in the process of differentiation. The density of the cyst...

Human retinoblastoma (RB) is a rare, fatal tumor derived from the retinal cone-precursors1,2,3, is the most common type of intraocular malignancy in childhood4. Homozygous inactivation of RB1 gene is the initiating genetic lesion in RB5. However, mice with RB1 mutations fail to form the retinal tumor2. Although the mouse tumors could be generated with the combination of Rb1 mutations and other genetic modifications, they still lack the features of human RB6. Thanks to the development of retinal organoid differentiation, the hESC-derived RB could be obtained, displaying the characters of human RB1.
Numerous protocols for retinal organoid differentiation have been established in the past decade, including 2D7, 3D8, and a combination of 2D and 3D9. The method used here to generate the human RB is the consolidation of adherent culture and floating culture9. By differentiating the RB1 mutated hESC into retinal organoids, the formation of RB is detected at around day 45, and then it proliferates rapidly at around day 60. On day 90, isolation of RBs, and generation of the RB cell line is possible; furthermore, RB surrounds almost all retinal organoids at day 120.
hESC-derived RB is an innovative model for exploring the origin, tumorigenesis, and treatments for RB. In this protocol, the generation of gene-editing hESC, the differentiation of RB, and characterization for RB are described in detail.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2-mercaptoethanol</td>
			<td>Life Technologies</td>
			<td>21985-023</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-ARR3</td>
			<td>Sigma</td>
			<td>HPA063129</td>
			<td>Antibody</td>
		</tr>
		<tr>
			<td>Anti-CRX (M02)</td>
			<td>Abnove</td>
			<td>ABN-H00001406-M02</td>
			<td>Antibody</td>
		</tr>
		<tr>
			<td>Anti-Ki67</td>
			<td>Abcam</td>
			<td>&#160;ab15580</td>
			<td>Antibody</td>
		</tr>
		<tr>
			<td>Anti-Syk (D3Z1E)</td>
			<td>Cell Signaling Technology</td>
			<td>13198</td>
			<td>Antibody</td>
		</tr>
		<tr>
			<td>BbsI</td>
			<td>NEB</td>
			<td>R3539S</td>
			<td>Restriction enzymes</td>
		</tr>
		<tr>
			<td>Dispase (1U/mL)</td>
			<td>Stemcell Technologies</td>
			<td>7923</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM basic</td>
			<td>Gibco</td>
			<td>10566-016</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM/F-12-GlutaMAX</td>
			<td>Gibco</td>
			<td>10565-042</td>
			<td></td>
		</tr>
		<tr>
			<td>DMSO</td>
			<td>Sigma</td>
			<td>D2650</td>
			<td></td>
		</tr>
		<tr>
			<td>DPBS</td>
			<td>Gibco</td>
			<td>C141905005BT</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Thermo</td>
			<td>15575020</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS), Qualified for Human Embryonic Stem Cells</td>
			<td>Biological Industry</td>
			<td>04-002-1A</td>
			<td></td>
		</tr>
		<tr>
			<td>Glutamine</td>
			<td>Gibco</td>
			<td>35050-061</td>
			<td></td>
		</tr>
		<tr>
			<td>Ham&#39;s F-12 Nutrient Mix (Hams F12)</td>
			<td>Gibco</td>
			<td>11765-054</td>
			<td></td>
		</tr>
		<tr>
			<td>MEM Non-essential Amino Acid Solution (100X)</td>
			<td>Sigma</td>
			<td>M7145</td>
			<td></td>
		</tr>
		<tr>
			<td>Neurobasal Medium</td>
			<td>Gibco</td>
			<td>21103-049</td>
			<td></td>
		</tr>
		<tr>
			<td>P3 Primary Cell 4D-Nucleofector X Kit S</td>
			<td>Lonza</td>
			<td>V4XP-3032</td>
			<td>Nucleofection kit</td>
		</tr>
		<tr>
			<td>Pen Strep</td>
			<td>Gibco</td>
			<td>15140-122</td>
			<td></td>
		</tr>
		<tr>
			<td>Puromycin</td>
			<td>Gene Operation</td>
			<td>ISY1130- 0025MG</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAquick PCR Purification Kit</td>
			<td>QIAGEN</td>
			<td>28104</td>
			<td></td>
		</tr>
		<tr>
			<td>ncEpic-hiPSC/hESC culture medium</td>
			<td>Nuwacell</td>
			<td>RP01001</td>
			<td>ncEpic-hiPSC/hESC culture medium in 1.2.1</td>
		</tr>
		<tr>
			<td>Growth factor reduced basement membrane matrix</td>
			<td>BD</td>
			<td>356231</td>
			<td>Matrigel in 1.2.1</td>
		</tr>
		<tr>
			<td>Cell dissociation enzyme</td>
			<td>Gibco</td>
			<td>12563-011</td>
			<td>TrypLE Express in 1.2.8</td>
		</tr>
		<tr>
			<td>RNeasy Midi Kit</td>
			<td>QIAGEN</td>
			<td>75144</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini Kit</td>
			<td>QIAGEN</td>
			<td>74104</td>
			<td></td>
		</tr>
		<tr>
			<td>Supplement A</td>
			<td>Life Technologies</td>
			<td>17502-048</td>
			<td>N-2 Supplement (100X), liquid, supplemet in medum I</td>
		</tr>
		<tr>
			<td>Supplement B</td>
			<td>Life Technologies</td>
			<td>17105-041</td>
			<td>B-27 Supplement (50X),liquid, supplemet in medum I,II,III</td>
		</tr>
		<tr>
			<td>T4 Polynucleotide Kinase</td>
			<td>Life Technologies</td>
			<td>EK0032</td>
			<td></td>
		</tr>
		<tr>
			<td>Taurine</td>
			<td>Sigma</td>
			<td>T-8691-25G</td>
			<td></td>
		</tr>
		<tr>
			<td>Y-27632 2HCl</td>
			<td>Selleck</td>
			<td>S1049</td>
			<td></td>
		</tr>
		<tr>
			<td>pX330-U6- Chimeric BB-CBh-hSpCas9-2A-Puro</td>
			<td>Addgene</td>
			<td>42230</td>
			<td></td>
		</tr>
		<tr>
			<td>Nucleofector 4D</td>
			<td>Lonza</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI</td>
			<td>Sigma</td>
			<td>R0883-500ML</td>
			<td></td>
		</tr>
	</tbody>
</table>

reconstruct human retinoblastoma in vitro

Human RB is pediatric cancer, which is lethal if no treatment is administered. As RB originates from cone precursors, which is relatively rare in rodent models, meanwhile regarding the interspecies differences between humans and rodents, a disease model derived from humans is more beneficial for uncovering the mechanisms of human RB and seeking the targets of therapy. Herein, the protocol describes the generation of two gene-edited hESC lines with a biallelic RB1 point mutation (RB1Mut/Mut) and an RB1 knockout mutation (RB1-/-), respectively. During the process of retinal development, the formation of RB is observed. The RB cell lines are also established by segregating from the RB organoids. Altogether, by differentiating the gene-edited hESC lines into the retinal organoids using a 2D and 3D combined differentiation protocol, we have successfully reconstructed the human RB in a dish and identified its cone-precursor origin. It would provide a helpful disease model for observing the retinoblastoma genesis, proliferation, and growth as well as further developing novel therapeutic agents.

The procedure of RB generation is elucidated in the Figure 1, which combines the adherent and floating culture. It was possible to harvest the human RB from RB1-KO hESC, and obtain the RB cell line by isolating the RB organoids.
Here, the protocol provides the details of the differentiation in different stages (Figure 2). Hollow spheres are formed in the first 3 days which attach to the culture surface and then expand (<stron...

Watch this Scientific Journal Video about Reconstruct Human Retinoblastoma In Vitro at JoVE.com

Reconstruct Human Retinoblastoma In Vitro

We describe a method for generating human retinoblastoma (RB) by introducing biallelic RB1 mutations in human embryonic stem cells (hESC). RB cell lines could also be successfully cultured using the isolated RB in a dish.

Human RB is pediatric cancer, which is lethal if no treatment is administered. As RB originates from cone precursors, which is relatively rare in rodent ...

Human retinoblastoma is the most common type of intraocular cancer in childhood. Clinical samples are hard to obtain and mice models cannot form the retinoblastoma. Therefore, in vitro retinoblastoma generation is essential for observing retinoblastoma genesis, proliferation, and growth, and for developing novel therapeutic agents.The efficiency of this protocol can reach about 100%though the duration for retinoblastoma generation is variable from day 45 to day 120. For maintenance of retinoblastoma one or RB one knockout human embryonic stem cells, culture the gene edited H nine cells in a six well plate coated with growth factor reduced basement membrane matrix and change the medium everyday. To passage the cells, incubate them in EDTA buffer for 3.5 minutes at 37 degree Celsius or five minutes at room temperature.Culture the cells until they reach 80%confluence. Then, to initiate retinal cell differentiation, remove the medium and rinse the cells with one milliliter of DPBS. Next, elevate the cell colonies by adding one milliliter of Dispase buffer and incubating at 37 degree Celsius for five minutes.Observe the cell colonies under a microscope. Once the edges of the colonies begin to roll out, aspirate the Dispase buffer and gently rinse the cells once with one milliliter of DPBS. Then add one milliliter of medium one into the well and using a 10 microliter standard pipette tip, cut the colonies into pieces.Use a cell scraper to scrape the remaining cells in the medium. Harvest the cells by centrifugation in a 15 milliliter tube. After centrifugation, leave around 50 microliters of the supernatant to disperse the cells in the medium.Then add 250 microliters of growth factor reduced basement membrane matrix and mix by gentle agitation. After mixing, place the 15 milliliter tube with the suspended cells into a 37 degree Celsius incubator. After a 20 minute incubation, the cells and growth factor reduced basement membrane matrix should form a solidified gel.Next, add one milliliter of medium one to the 15 milliliter tube. Using a one milliliter pipette, pipette the solidified gel two to three times to disperse the clump. Then add another nine milliliters of medium one and transfer the cell suspension into a 10 centimeter cell culture dish.Incubate the dish at 37 degree Celsius and 5%carbon dioxide. This is considered day zero. On day one, examine the cells using a microscope.On average, three to four cysts are observed in one piece of gel. On day five, change the medium by collecting the supernatant into a 15 milliliter tube, allowing the cysts to settle at the bottom and replacing the supernatant with fresh medium one. Disperse the cysts in the tube into two 10 centimeter dishes, ensuring at least 300 cysts in each dish.On day seven, most cysts attached to the dish spread out and form adherent colonies. On day 10, change the medium with fresh medium one, ensuring that all the cysts remain attached to the dish. Observe the cells under a microscope from days 13 to 17 to ensure that the cells are spreading out.On day 15, after rinsing the cells once with one milliliter of DPBS, add one milliliter of Dispase solution and incubate at 37 degree Celsius. After five minutes, remove the Dispase buffer and gently rinse the cultures with one milliliter of DPBS. Then add 10 milliliters of medium two to each 10 centimeter dish and incubate in a 37 degree Celsius and 5%carbon dioxide incubator.After 24 hours, adherent cultures spontaneously detach and assemble into retinal organoids. Three days after detachment, collect the cells from the cell culture dish in a 15 milliliter tube. When the organoids settle, remove the supernatant from the tube and transfer the organoids to a new non-adherent Petri dish with 10 milliliters of medium two for the following four days.A week after the detachment, change the medium to medium three and from this day onward, culture the organoids in medium three. On day 27 of the retinal organoid culture, the optic vesicle architecture is evident and around 90%of organoids display this structure. The first detection of the retinoblastoma occurs on day 45 and it becomes palpable on day 50.When it grows to day 90, the optic vesicle structures are principally enfolded by the retinoblastoma. The retinoblastoma can now be isolated and cultured further as a cell line. On day 105, more than 80%of the retinal organoids are fully enveloped by the retinoblastoma.These organoids highly express the proliferation marker Ki67 and the oncogene marker SYK compared to the H nine derived retinal organoids, indicating tumorigenesis. Additionally, high expression of the cone precursor marker ARR3 and photoreceptor precursor marker CRX in the retinoblastoma organoids demonstrates that they originate from cone precursor cells. Inferior and superior results during the three morphological stages of retinoblastoma generation are depicted here.Differentiated and undifferentiated human embryonic stem cells can be easily distinguished based on their morphology. The undifferentiated cells are chosen for retinoblastoma formation. On day five, the sphere generated should be hollow rather than solid.The retinoblastoma is derived from the retinal organoids that display optic vesicle architecture. No retinoblastoma is generated from the inferior organoids. While performing the procedure, all tips should be cooled and the basement membrane matrix should be melted at four degrees before adding it into the tube.This is a key step for this differentiation protocol.

reconstruct-human-retinoblastoma-in-vitro

Research

JoVE Journal

Cancer Research

1.2K visualizações.  Capital Medical University, Beijing Ophthalmology & Visual Science Key Laboratory. O retinoblastoma humano é o tipo mais comum de câncer intraocular na infância. Amostras clínicas são difíceis de obter e modelos de camundongos não podem formar o retinoblastoma. Portanto, a geração de retinoblastoma in vitro é essencial para observar a gênese, proliferação e crescimento do retinoblastoma e para o desenvolvimento de novos agentes terapêuticos.A eficiência deste protocolo pode chegar a cerca de 100%, embora a duração da geração de retinoblastoma seja ...