Name: reconstruct human retinoblastoma in vitro
Uploaded: 2022-10-11T12:30:00
Description: Watch this Scientific Journal Video about Reconstruct Human Retinoblastoma In Vitro at JoVE.com

We thank the 502 team for all the help. This work is partly supported by the Beijing Municipal Natural Science Foundation (Z200014) and National Key R&#38;D Program of China (2017YFA0105300).

This study is approved by the institutional Ethics Committee of Beijing Tongren Hospital, Capital Medical University. H9 hESCs are obtained from the WiCell Research Institute.
1. Generation of RB1 mutated hESC
<ol>
	<li>CRISPR/Cas9 targeting vector for the knockout (KO) of RB1.
	<ol>
		<li>Design a pair of sgRNA. For the ablation of RB1, target the first exon of this gene. The forward primer sequence is CACCGCGGTGGCGGCCGTTTTTCGG, and the reverse primer sequence is...

<ol>
	<li>Liu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+embryonic+stem+cell-derived+organoid+retinoblastoma+reveals+a+cancerous+origin.">Human embryonic stem cell-derived organoid retinoblastoma reveals a cancerous origin.</a> Proceedings of the National Academy of Sciences of the United States of America. 117 (52), 33628-33638 (2020).</li><li>Singh, H. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Developmental+stage-specific+proliferation+and+retinoblastoma+genesis+in+RB-deficient+human+but+not+mouse+cone+precursors.">Developmental stage-specific proliferation and retinoblastoma genesis in RB-deficient human but not mouse cone precursors.</a> Proceedings of the National Academy of Sciences of the United States of America. 115 (40), 9391-9400 (2018).</li><li>Xu, X. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rb+suppresses+human+cone-precursor-derived+retinoblastoma+tumours.">Rb suppresses human cone-precursor-derived retinoblastoma tumours.</a> Nature. 514 (7522), 385-388 (2014).</li><li>Mendoza, P. R., Grossniklaus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biology+of+retinoblastoma.">The biology of retinoblastoma.</a> Progress in Molecular Biology and Translational Science. 134, 503-516 (2015).</li><li>Benavente, C. A., Dyer, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetics+and+epigenetics+of+human+retinoblastoma.">Genetics and epigenetics of human retinoblastoma.</a> Annual Review of Pathology. 10, 547-562 (2015).</li><li>Wu, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mouse+model+of+MYCN-driven+retinoblastoma+reveals+MYCN-independent+tumor+reemergence.">A mouse model of MYCN-driven retinoblastoma reveals MYCN-independent tumor reemergence.</a> The Journal of Clinical Investigation. 127 (3), 888-898 (2017).</li><li>Boucherie, C., Sowden, J. C., Ali, R. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induced+pluripotent+stem+cell+technology+for+generating+photoreceptors.">Induced pluripotent stem cell technology for generating photoreceptors.</a> Regenerative Medicine. 6 (4), 469-479 (2011).</li><li>Nakano, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Self-formation+of+optic+cups+and+storable+stratified+neural+retina+from+human+ESCs.">Self-formation of optic cups and storable stratified neural retina from human ESCs.</a> Cell Stem Cell. 10 (6), 771-785 (2012).</li><li>Lowe, A., Harris, R., Bhansali, P., Cvekl, A., Liu, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intercellular+adhesion-dependent+cell+survival+and+rock-regulated+actomyosin-driven+forces+mediate+self-formation+of+a+retinal+organoid.">Intercellular adhesion-dependent cell survival and rock-regulated actomyosin-driven forces mediate self-formation of a retinal organoid.</a> Stem Cell Reports. 6 (5), 743-756 (2016).</li><li>Zheng, C., Schneider, J. W., Hsieh, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+RB1+in+human+embryonic+stem+cell-derived+retinal+organoids.">Role of RB1 in human embryonic stem cell-derived retinal organoids.</a> Developmental Biology. 462 (2), 197-207 (2020).</li><li>Dimaras, H., Corson, T. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retinoblastoma,+the+visible+CNS+tumor:+A+review.">Retinoblastoma, the visible CNS tumor: A review.</a> Journal of Neuroscience Research. 97 (1), 29-44 (2019).</li><li>Xu, X. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retinoblastoma+has+properties+of+a+cone+precursor+tumor+and+depends+upon+cone-specific+MDM2+signaling.">Retinoblastoma has properties of a cone precursor tumor and depends upon cone-specific MDM2 signaling.</a> Cell. 137 (6), 1018-1031 (2009).</li><li>Qi, D. L., Cobrinik, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MDM2+but+not+MDM4+promotes+retinoblastoma+cell+proliferation+through+p53-independent+regulation+of+MYCN+translation.">MDM2 but not MDM4 promotes retinoblastoma cell proliferation through p53-independent regulation of MYCN translation.</a> Oncogene. 36 (13), 1760-1769 (2017).</li></ol>

Human retinoblastoma (RB) is caused by the inactivation of RB1 and the dysfunction of Rb protein. In this protocol, the RB1-KO hESC is the pivotal step for the generation of RB in a dish. While even with RB1-/- hESC, it is possible that there is no RB formation due to the methods of retinal organoid differentiation10. In this protocol, the transfer from adherent culture to floating culture is essential in the process of differentiation. The density of the cyst...

Human retinoblastoma (RB) is a rare, fatal tumor derived from the retinal cone-precursors1,2,3, is the most common type of intraocular malignancy in childhood4. Homozygous inactivation of RB1 gene is the initiating genetic lesion in RB5. However, mice with RB1 mutations fail to form the retinal tumor2. Although the mouse tumors could be generated with the combination of Rb1 mutations and other genetic modifications, they still lack the features of human RB6. Thanks to the development of retinal organoid differentiation, the hESC-derived RB could be obtained, displaying the characters of human RB1.
Numerous protocols for retinal organoid differentiation have been established in the past decade, including 2D7, 3D8, and a combination of 2D and 3D9. The method used here to generate the human RB is the consolidation of adherent culture and floating culture9. By differentiating the RB1 mutated hESC into retinal organoids, the formation of RB is detected at around day 45, and then it proliferates rapidly at around day 60. On day 90, isolation of RBs, and generation of the RB cell line is possible; furthermore, RB surrounds almost all retinal organoids at day 120.
hESC-derived RB is an innovative model for exploring the origin, tumorigenesis, and treatments for RB. In this protocol, the generation of gene-editing hESC, the differentiation of RB, and characterization for RB are described in detail.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2-mercaptoethanol</td>
			<td>Life Technologies</td>
			<td>21985-023</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-ARR3</td>
			<td>Sigma</td>
			<td>HPA063129</td>
			<td>Antibody</td>
		</tr>
		<tr>
			<td>Anti-CRX (M02)</td>
			<td>Abnove</td>
			<td>ABN-H00001406-M02</td>
			<td>Antibody</td>
		</tr>
		<tr>
			<td>Anti-Ki67</td>
			<td>Abcam</td>
			<td>&#160;ab15580</td>
			<td>Antibody</td>
		</tr>
		<tr>
			<td>Anti-Syk (D3Z1E)</td>
			<td>Cell Signaling Technology</td>
			<td>13198</td>
			<td>Antibody</td>
		</tr>
		<tr>
			<td>BbsI</td>
			<td>NEB</td>
			<td>R3539S</td>
			<td>Restriction enzymes</td>
		</tr>
		<tr>
			<td>Dispase (1U/mL)</td>
			<td>Stemcell Technologies</td>
			<td>7923</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM basic</td>
			<td>Gibco</td>
			<td>10566-016</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM/F-12-GlutaMAX</td>
			<td>Gibco</td>
			<td>10565-042</td>
			<td></td>
		</tr>
		<tr>
			<td>DMSO</td>
			<td>Sigma</td>
			<td>D2650</td>
			<td></td>
		</tr>
		<tr>
			<td>DPBS</td>
			<td>Gibco</td>
			<td>C141905005BT</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Thermo</td>
			<td>15575020</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS), Qualified for Human Embryonic Stem Cells</td>
			<td>Biological Industry</td>
			<td>04-002-1A</td>
			<td></td>
		</tr>
		<tr>
			<td>Glutamine</td>
			<td>Gibco</td>
			<td>35050-061</td>
			<td></td>
		</tr>
		<tr>
			<td>Ham&#39;s F-12 Nutrient Mix (Hams F12)</td>
			<td>Gibco</td>
			<td>11765-054</td>
			<td></td>
		</tr>
		<tr>
			<td>MEM Non-essential Amino Acid Solution (100X)</td>
			<td>Sigma</td>
			<td>M7145</td>
			<td></td>
		</tr>
		<tr>
			<td>Neurobasal Medium</td>
			<td>Gibco</td>
			<td>21103-049</td>
			<td></td>
		</tr>
		<tr>
			<td>P3 Primary Cell 4D-Nucleofector X Kit S</td>
			<td>Lonza</td>
			<td>V4XP-3032</td>
			<td>Nucleofection kit</td>
		</tr>
		<tr>
			<td>Pen Strep</td>
			<td>Gibco</td>
			<td>15140-122</td>
			<td></td>
		</tr>
		<tr>
			<td>Puromycin</td>
			<td>Gene Operation</td>
			<td>ISY1130- 0025MG</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAquick PCR Purification Kit</td>
			<td>QIAGEN</td>
			<td>28104</td>
			<td></td>
		</tr>
		<tr>
			<td>ncEpic-hiPSC/hESC culture medium</td>
			<td>Nuwacell</td>
			<td>RP01001</td>
			<td>ncEpic-hiPSC/hESC culture medium in 1.2.1</td>
		</tr>
		<tr>
			<td>Growth factor reduced basement membrane matrix</td>
			<td>BD</td>
			<td>356231</td>
			<td>Matrigel in 1.2.1</td>
		</tr>
		<tr>
			<td>Cell dissociation enzyme</td>
			<td>Gibco</td>
			<td>12563-011</td>
			<td>TrypLE Express in 1.2.8</td>
		</tr>
		<tr>
			<td>RNeasy Midi Kit</td>
			<td>QIAGEN</td>
			<td>75144</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini Kit</td>
			<td>QIAGEN</td>
			<td>74104</td>
			<td></td>
		</tr>
		<tr>
			<td>Supplement A</td>
			<td>Life Technologies</td>
			<td>17502-048</td>
			<td>N-2 Supplement (100X), liquid, supplemet in medum I</td>
		</tr>
		<tr>
			<td>Supplement B</td>
			<td>Life Technologies</td>
			<td>17105-041</td>
			<td>B-27 Supplement (50X),liquid, supplemet in medum I,II,III</td>
		</tr>
		<tr>
			<td>T4 Polynucleotide Kinase</td>
			<td>Life Technologies</td>
			<td>EK0032</td>
			<td></td>
		</tr>
		<tr>
			<td>Taurine</td>
			<td>Sigma</td>
			<td>T-8691-25G</td>
			<td></td>
		</tr>
		<tr>
			<td>Y-27632 2HCl</td>
			<td>Selleck</td>
			<td>S1049</td>
			<td></td>
		</tr>
		<tr>
			<td>pX330-U6- Chimeric BB-CBh-hSpCas9-2A-Puro</td>
			<td>Addgene</td>
			<td>42230</td>
			<td></td>
		</tr>
		<tr>
			<td>Nucleofector 4D</td>
			<td>Lonza</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI</td>
			<td>Sigma</td>
			<td>R0883-500ML</td>
			<td></td>
		</tr>
	</tbody>
</table>

reconstruct human retinoblastoma in vitro

Human RB is pediatric cancer, which is lethal if no treatment is administered. As RB originates from cone precursors, which is relatively rare in rodent models, meanwhile regarding the interspecies differences between humans and rodents, a disease model derived from humans is more beneficial for uncovering the mechanisms of human RB and seeking the targets of therapy. Herein, the protocol describes the generation of two gene-edited hESC lines with a biallelic RB1 point mutation (RB1Mut/Mut) and an RB1 knockout mutation (RB1-/-), respectively. During the process of retinal development, the formation of RB is observed. The RB cell lines are also established by segregating from the RB organoids. Altogether, by differentiating the gene-edited hESC lines into the retinal organoids using a 2D and 3D combined differentiation protocol, we have successfully reconstructed the human RB in a dish and identified its cone-precursor origin. It would provide a helpful disease model for observing the retinoblastoma genesis, proliferation, and growth as well as further developing novel therapeutic agents.

The procedure of RB generation is elucidated in the Figure 1, which combines the adherent and floating culture. It was possible to harvest the human RB from RB1-KO hESC, and obtain the RB cell line by isolating the RB organoids.
Here, the protocol provides the details of the differentiation in different stages (Figure 2). Hollow spheres are formed in the first 3 days which attach to the culture surface and then expand (<stron...

Watch this Scientific Journal Video about Reconstruct Human Retinoblastoma In Vitro at JoVE.com

Reconstruct Human Retinoblastoma In Vitro

We describe a method for generating human retinoblastoma (RB) by introducing biallelic RB1 mutations in human embryonic stem cells (hESC). RB cell lines could also be successfully cultured using the isolated RB in a dish.

Human RB is pediatric cancer, which is lethal if no treatment is administered. As RB originates from cone precursors, which is relatively rare in rodent ...

Human retinoblastoma is the most common type of intraocular cancer in childhood. Clinical samples are hard to obtain and mice models cannot form the retinoblastoma. Therefore, in vitro retinoblastoma generation is essential for observing retinoblastoma genesis, proliferation, and growth, and for developing novel therapeutic agents.The efficiency of this protocol can reach about 100%though the duration for retinoblastoma generation is variable from day 45 to day 120. For maintenance of retinoblastoma one or RB one knockout human embryonic stem cells, culture the gene edited H nine cells in a six well plate coated with growth factor reduced basement membrane matrix and change the medium everyday. To passage the cells, incubate them in EDTA buffer for 3.5 minutes at 37 degree Celsius or five minutes at room temperature.Culture the cells until they reach 80%confluence. Then, to initiate retinal cell differentiation, remove the medium and rinse the cells with one milliliter of DPBS. Next, elevate the cell colonies by adding one milliliter of Dispase buffer and incubating at 37 degree Celsius for five minutes.Observe the cell colonies under a microscope. Once the edges of the colonies begin to roll out, aspirate the Dispase buffer and gently rinse the cells once with one milliliter of DPBS. Then add one milliliter of medium one into the well and using a 10 microliter standard pipette tip, cut the colonies into pieces.Use a cell scraper to scrape the remaining cells in the medium. Harvest the cells by centrifugation in a 15 milliliter tube. After centrifugation, leave around 50 microliters of the supernatant to disperse the cells in the medium.Then add 250 microliters of growth factor reduced basement membrane matrix and mix by gentle agitation. After mixing, place the 15 milliliter tube with the suspended cells into a 37 degree Celsius incubator. After a 20 minute incubation, the cells and growth factor reduced basement membrane matrix should form a solidified gel.Next, add one milliliter of medium one to the 15 milliliter tube. Using a one milliliter pipette, pipette the solidified gel two to three times to disperse the clump. Then add another nine milliliters of medium one and transfer the cell suspension into a 10 centimeter cell culture dish.Incubate the dish at 37 degree Celsius and 5%carbon dioxide. This is considered day zero. On day one, examine the cells using a microscope.On average, three to four cysts are observed in one piece of gel. On day five, change the medium by collecting the supernatant into a 15 milliliter tube, allowing the cysts to settle at the bottom and replacing the supernatant with fresh medium one. Disperse the cysts in the tube into two 10 centimeter dishes, ensuring at least 300 cysts in each dish.On day seven, most cysts attached to the dish spread out and form adherent colonies. On day 10, change the medium with fresh medium one, ensuring that all the cysts remain attached to the dish. Observe the cells under a microscope from days 13 to 17 to ensure that the cells are spreading out.On day 15, after rinsing the cells once with one milliliter of DPBS, add one milliliter of Dispase solution and incubate at 37 degree Celsius. After five minutes, remove the Dispase buffer and gently rinse the cultures with one milliliter of DPBS. Then add 10 milliliters of medium two to each 10 centimeter dish and incubate in a 37 degree Celsius and 5%carbon dioxide incubator.After 24 hours, adherent cultures spontaneously detach and assemble into retinal organoids. Three days after detachment, collect the cells from the cell culture dish in a 15 milliliter tube. When the organoids settle, remove the supernatant from the tube and transfer the organoids to a new non-adherent Petri dish with 10 milliliters of medium two for the following four days.A week after the detachment, change the medium to medium three and from this day onward, culture the organoids in medium three. On day 27 of the retinal organoid culture, the optic vesicle architecture is evident and around 90%of organoids display this structure. The first detection of the retinoblastoma occurs on day 45 and it becomes palpable on day 50.When it grows to day 90, the optic vesicle structures are principally enfolded by the retinoblastoma. The retinoblastoma can now be isolated and cultured further as a cell line. On day 105, more than 80%of the retinal organoids are fully enveloped by the retinoblastoma.These organoids highly express the proliferation marker Ki67 and the oncogene marker SYK compared to the H nine derived retinal organoids, indicating tumorigenesis. Additionally, high expression of the cone precursor marker ARR3 and photoreceptor precursor marker CRX in the retinoblastoma organoids demonstrates that they originate from cone precursor cells. Inferior and superior results during the three morphological stages of retinoblastoma generation are depicted here.Differentiated and undifferentiated human embryonic stem cells can be easily distinguished based on their morphology. The undifferentiated cells are chosen for retinoblastoma formation. On day five, the sphere generated should be hollow rather than solid.The retinoblastoma is derived from the retinal organoids that display optic vesicle architecture. No retinoblastoma is generated from the inferior organoids. While performing the procedure, all tips should be cooled and the basement membrane matrix should be melted at four degrees before adding it into the tube.This is a key step for this differentiation protocol.

reconstruct-human-retinoblastoma-in-vitro

Research

JoVE Journal

Cancer Research

A General Method for Detecting Nitrosamide Formation in the In Vitro Metabolism of Nitrosamines by Cytochrome P450s

N-nitrosamines are a well-established group of environmental carcinogens, which require cytochrome P450 oxidation to exhibit activity. The accepted mechanism of metabolic activation involves formation of &#945;-hydroxynitrosamines that spontaneously decompose to DNA alkylating agents. Accumulation of DNA damage and the resulting mutations can ultimately lead to cancer. New evidence indicates that &#945;-hydroxynitrosamines can be further oxidized to nitrosamides processively by cytochrome P450s. Because nitrosamides are generally more stable than &#945;-hydroxynitrosamines and can also alkylate DNA, nitrosamides may play a role in carcinogenesis. In this report, we describe a general protocol for evaluating nitrosamide production from in vitro cytochrome P450-catalyzed metabolism of nitrosamines. This protocol utilizes a general approach to the synthesis of the relevant nitrosamides and an in vitro cytochrome P450 metabolism assay using liquid chromatography-nanospray ionization-high resolution tandem mass spectrometry for detection. This method detected N&#8242;-nitrosonorcotinine as a minor metabolite of N&#8242;-nitrosonornicotine in the example study. The method has high sensitivity and selectively due to accurate mass detection. Application of this method to a wide variety of nitrosamine-cytochrome P450 systems will help determine the generality of this transformation. Because cytochrome P450s are polymorphic and vary in activity, a better understanding of nitrosamide formation could aid in individual cancer risk assessment.

A General Method for Detecting Nitrosamide Formation in the In Vitro Metabolism of Nitrosamines by Cytochrome P450s

&#945;-hydroxylation of carcinogenic nitrosamines by cytochrome P450s is the accepted metabolic pathway that produces DNA-damaging intermediates, which cause mutations. However, new data indicates further oxidation to nitrosamides can occur. We describe a general method for detecting nitrosamides produced from in vitro cytochrome P450-catalyzed metabolism of nitrosamines.

N-nitrosamines are a well-established group of environmental carcinogens, which require cytochrome P450 oxidation to exhibit activity. The accepted ...

Evaluating In Vitro DNA Damage Using Comet Assay

DNA damage is a common phenomenon for each cell during its lifespan, and is defined as an alteration of the chemical structure of genomic DNA. Cancer therapies, such as radio- and chemotherapy, introduce enormous amount of additional DNA damage, leading to cell cycle arrest and apoptosis to limit cancer progression. Quantitative assessment of DNA damage during experimental cancer therapy is a key step to justify the effectiveness of a genotoxic agent. In this study, we focus on a single cell electrophoresis assay, also known as the comet assay, which can quantify single and double-strand DNA breaks in vitro. The comet assay is a DNA damage quantification method that is efficient and easy to perform, and has low time/budget demands and high reproducibility. Here, we highlight the utility of the comet assay for a preclinical study by evaluating the genotoxic effect of olaparib/temozolomide combination therapy to U251 glioma cells.

Evaluating In Vitro DNA Damage Using Comet Assay

The comet assay is an efficient method to detect DNA damage including single and double-stranded DNA breaks. We describe alkaline and neutral comet assays to measure DNA damage in cancer cells to evaluate the therapeutic effect of chemotherapy.

DNA damage is a common phenomenon for each cell during its lifespan, and is defined as an alteration of the chemical structure of genomic DNA. Cancer ...

Moving Upwards: A Simple and Flexible In Vitro Three-dimensional Invasion Assay Protocol

Although 3D invasion assays have been developed, the challenge remains to study cells without affecting the integrity of their microenvironment. Traditional 3D assays such as the Boyden Chamber require that cells are displaced from the original culture location and moved to a new environment. Not only does this disrupt the cellular processes that are intrinsic to the microenvironment, but it often results in a loss of cells. These problems are especially challenging when dealing with cells that are either rare, or extremely sensitive to their microenvironment. Here, we describe the development of a 3D invasion assay that avoids both concerns. In this assay, cells are plated within a small well and an ECM matrix containing a chemoattractant is laid atop the cells. This requires no cell displacement, and allows the cells to invade upwards into the matrix. In this assay, cell invasion as well as cell morphology can be assessed within the collagen gel. Using this assay, we characterize the invasive capacity of rare and sensitive cells; the hybrid cells resulting from fusion between breast cancer cells MCF7 and mesenchymal/multipotent stem/stroma cells (MSCs).

Moving Upwards: A Simple and Flexible In Vitro Three-dimensional Invasion Assay Protocol

This protocol describes an inverted vertical invasion assay that could be used to quantify the migration and invasion capabilities of cells in a three-dimensional setting while preserving the cell microenvironment. This assay is suitable for rare and/or sensitive cells.

Although 3D invasion assays have been developed, the challenge remains to study cells without affecting the integrity of their microenvironment. ...

Fabrication of Tongue Extracellular Matrix and Reconstitution of Tongue Squamous Cell Carcinoma In Vitro

In order to construct an effective and realistic model for tongue squamous cell carcinoma (TSCC) in vitro, the methods were created to produce decellularized tongue extracellular matrix (TEM) which provides functional scaffolds for TSCC construction. TEM provides an in vitro niche for cell growth, differentiation, and cell migration. The microstructures of native extracellular matrix (ECM) and biochemical compositions retained in the decellularized matrix provide tissue-specific niches for anchoring cells. The fabrication of TEM can be realized by deoxyribonuclease (DNase) digestion accompanied with a serious of organic or inorganic pretreatment. This protocol is easy to operate and ensures high efficiency for the decellularization. The TEM showed favorable cytocompatibility for TSCC cells under static or stirred culture conditions, which enables the construction of the TSCC model. A self-made bioreactor was also used for the persistent stirred condition for cell culture. Reconstructed TSCC using TEM showed the characteristics and properties resembling clinical TSCC histopathology, suggesting the potential in TSCC research.

Fabrication of Tongue Extracellular Matrix and Reconstitution of Tongue Squamous Cell Carcinoma In Vitro

A method is shown here for the preparation of the tongue extracellular matrix (TEM) with efficient decellularization. The TEM can be used as functional scaffolds for the reconstruction of a tongue squamous cell carcinoma (TSCC) model under static or stirred culture conditions.

In order to construct an effective and realistic model for tongue squamous cell carcinoma (TSCC) in vitro, the methods were created to produce ...

In Vitro Assay to Study Tumor-macrophage Interaction

Tumor associated macrophages (TAMs) account for a large percentage of cells in the tumor mass for different types of cancers. Glioblastoma (GBM), a malignant brain tumor with no cure, has up to a half the tumor mass TAMs. TAMs can be pro-tumoral or anti-tumoral, depending on the activation of specific genes in the cells. Genetic mutations in the tumors, through regulating cytokine expression, can affect recruitment of TAMs to the tumor microenvironment. Here, we describe a quantitative cell-based assay to assess macrophage recruitment by the conditioned medium from the tumor cells. This assay uses the human macrophage cell line MV-4-11 to study macrophage attraction by the conditioned medium from glioblastoma, allowing for high reproducibility and low variability. Data generated with this assay can contribute to a better understanding of the interaction between the tumor and the tumor microenvironment. Similar assay can be used to assess interaction between the tumor cells and other immune cells, including T cells and natural killer (NK) cells.

This article represents a useful in vitro assay to evaluate the capability of conditioned medium from tumor cells to attract macrophages.

Tumor associated macrophages (TAMs) account for a large percentage of cells in the tumor mass for different types of cancers. Glioblastoma (GBM), a ...

In Vitro Establishment of a Genetically Engineered Murine Head and Neck Cancer Cell Line using an Adeno-Associated Virus-Cas9 System

The use of primary normal epithelial cells makes it possible to reproducibly induce genomic alterations required for cellular transformation by introducing specific mutations in oncogenes and tumor suppressor genes, using clustered regulatory interspaced short palindromic repeat (CRISPR)-based genome editing technology in mice. This technology allows us to accurately mimic the genetic changes that occur in human cancers using mice. By genetically transforming murine primary cells, we can better study cancer development, progression, treatment, and diagnosis. In this study, we used Cre-inducible Cas9 mouse tongue epithelial cells to enable genome editing using adeno-associated virus (AAV) in vitro. Specifically, by altering KRAS, p53, and APC in normal tongue epithelial cells, we generated a murine head and neck cancer (HNC) cell line in vitro,which is tumorigenic in syngeneic mice. The method presented here describes in detail how to generate HNC cell lines with specific genomic alterations and explains their suitability for predicting tumor progression in syngeneic mice. We envision that this promising method will be informative and useful to study tumor biology and therapy of HNC.

Development of murine models with specific genes mutated in head and neck cancer patients is required for understanding of neoplasia. Here, we present a protocol for in vitro transformation of primary murine tongue cells using an adeno-associated virus-Cas9 system to generate murine HNC cell lines with specific genomic alterations.

The use of primary normal epithelial cells makes it possible to reproducibly induce genomic alterations required for cellular transformation by ...

Measuring Real-time Drug Response in Organotypic Tumor Tissue Slices

Tumor tissues are composed of cancerous cells, infiltrated immune cells, endothelial cells, fibroblasts, and extracellular matrix. This complex milieu constitutes the tumor microenvironment (TME) and can modulate response to therapy in vivo or drug response ex vivo. Conventional cancer drug discovery screens are carried out on cells cultured in a monolayer, a system critically lacking the influence of TME. Thus, experimental systems that integrate sensitive and high-throughput assays with physiological TME will strengthen the preclinical drug discovery process. Here, we introduce ex vivo tumor tissue slice culture as a platform for medium-high-throughput drug screening. Organotypic tissue slice culture constitutes precisely-cut, thin tumor sections that are maintained with the support of a porous membrane in a liquid-air interface. In this protocol, we describe the preparation and maintenance of tissue slices prepared from mouse tumors and tumors from patient-derived xenograft (PDX) models. To assess changes in tissue viability in response to drug treatment, we leveraged a biocompatible luminescence-based viability assay that enables real-time, rapid, and sensitive measurement of viable cells in the tissue. Using this platform, we evaluated dose-dependent responses of tissue slices to the multi-kinase inhibitor, staurosporine, and cytotoxic agent, doxorubicin. Further, we demonstrate the application of tissue slices for ex vivo pharmacology by screening 17 clinical and preclinical drugs on tissue slices prepared from a single PDX tumor. Our physiologically-relevant, highly-sensitive, and robust ex vivo screening platform will greatly strengthen preclinical oncology drug discovery and treatment decision making.&#160;

We introduce a protocol for measuring real-time drug response in organotypic tumor tissue slices. The experimental strategy outlined here provides a platform to carry out medium-high throughput drug screens on tissue slices derived from clinical or mouse tumors in ex vivo conditions.

Tumor tissues are composed of cancerous cells, infiltrated immune cells, endothelial cells, fibroblasts, and extracellular matrix. This complex milieu ...

In Vitro Evaluation of Oncogenic Transformation in Human Mammary Epithelial Cells

Tumorigenesis is a multi-step process in which cells acquire capabilities&#160;that allow their growth, survival, and dissemination under hostile conditions. Different tests seek to identify and quantify these hallmarks of cancerous cells; however, they often focus on a single aspect of cellular transformation and, in fact, multiple tests are required for their proper characterization. The purpose of this work is to provide researchers with a set of tools to assess cellular transformation in vitro from a broad perspective, thereby making it possible to draw sound conclusions.
A sustained proliferative signaling activation is the major feature of tumoral tissues and can be easily monitored under in vitro conditions by calculating the number of population doublings achieved over time. Besides, the growth of cells in 3D cultures allows their interaction with surrounding cells, resembling what occurs in vivo. This enables the evaluation of cellular aggregation and, together with immunofluorescent labeling of distinctive cellular markers, to obtain information on another relevant feature of tumoral transformation: the loss of proper organization. Another remarkable characteristic of transformed cells is their capacity to grow without attachment to other cells and to the extracellular matrix, which can be evaluated with the anchorage assay.
Detailed experimental procedures to evaluate cell growth rate, to perform immunofluorescent labeling of cell lineage markers in 3D cultures, and to test anchorage-independent cell growth in soft agar are provided. These methodologies are optimized for Breast Primary Epithelial Cells (BPEC) due to its relevance in breast cancer; however, procedures can be applied to other cell types after some adjustments.

This protocol provides experimental in vitro tools to evaluate the transformation of human mammary cells. Detailed steps to follow-up cell proliferation rate, anchorage-independent growth capacity, and distribution of cell lineages in 3D cultures with basement membrane matrix are described.

Tumorigenesis is a multi-step process in which cells acquire capabilities&#160;that allow their growth, survival, and dissemination under hostile ...

Three-Dimensional In Vitro Biomimetic Model of Neuroblastoma Using Collagen-Based Scaffolds

Neuroblastoma is the most common extracranial solid tumor in children, accounting for 15% of overall pediatric cancer deaths. The native tumor tissue is a complex three-dimensional (3D) microenvironment involving layers of cancerous and non-cancerous cells surrounded by an extracellular matrix (ECM). The ECM provides physical and biological support and contributes to disease progression, patient prognosis, and therapeutic response.
This paper describes a protocol for assembling a 3D scaffold-based system to mimic the neuroblastoma microenvironment using neuroblastoma cell lines and collagen-based scaffolds. The scaffolds are supplemented with either nanohydroxyapatite (nHA) or glycosaminoglycans (GAGs), naturally found at high concentrations in the bone and bone marrow, the most common metastatic sites of neuroblastoma. The 3D porous structure of these scaffolds allows neuroblastoma cell attachment, proliferation and migration, and the formation of cell clusters. In this 3D matrix, the cell response to therapeutics is more reflective of the in vivo situation.
The scaffold-based culture system can maintain higher cell densities than conventional two-dimensional (2D) cell culture. Therefore, optimization protocols for initial seeding cell numbers are dependent on the desired experimental timeframes. The model is monitored by assessing cell growth via DNA quantification, cell viability via metabolic assays, and cell distribution within the scaffolds via histological staining.
This model&#39;s applications include the assessment of gene and protein expression profiles as well as cytotoxicity testing using conventional drugs and miRNAs. The 3D culture system allows for the precise manipulation of cell and ECM components, creating an environment more physiologically similar to native tumor tissue. Therefore, this 3D in vitro model will advance the understanding of the disease pathogenesis and improve the correlation between results obtained in vitro, in vivo in&#160;animal models, and human subjects.

Three-Dimensional In Vitro Biomimetic Model of Neuroblastoma Using Collagen-Based Scaffolds

This paper lists the steps required to seed neuroblastoma cell lines on previously described three-dimensional collagen-based scaffolds, maintain cell growth for a predetermined timeframe, and retrieve scaffolds for several cell growth and cell behavior analyses and downstream applications, adaptable to satisfy a range of experimental aims.

Neuroblastoma is the most common extracranial solid tumor in children, accounting for 15% of overall pediatric cancer deaths. The native tumor tissue is a ...

High-Throughput In Vitro Assay using Patient-Derived Tumor Organoids

Patient-derived tumor organoids (PDOs) are expected to be a preclinical cancer model with better reproducibility of disease than traditional cell culture models. PDOs have been successfully generated from a variety of human tumors to recapitulate the architecture and function of tumor tissue accurately and efficiently. However, PDOs are unsuitable for an in vitro high-throughput assay system (HTS) or cell analysis using 96-well or 384-well plates when evaluating anticancer drugs because they are heterogeneous in size and form large clusters in culture. These cultures and assays use extracellular matrices, such as Matrigel, to create tumor tissue scaffolds. Therefore, PDOs have a low throughput and high cost, and it has been difficult to develop a suitable assay system. To address this issue, a simpler and more accurate HTS was established using PDOs to evaluate the potency of anticancer drugs and immunotherapy. An in vitro HTS was created that uses PDOs established from solid tumors cultured in 384-well plates. An HTS was also developed for assessment of antibody-dependent cellular cytotoxicity activity to represent the immune response using PDOs cultured in 96-well plates.

High-Throughput In Vitro Assay using Patient-Derived Tumor Organoids

A highly accurate in vitro high-throughput assay system was developed to evaluate anticancer drugs using patient-derived tumor organoids (PDOs), similar to cancer tissues but are unsuitable for in vitro high-throughput assay systems with 96-well and 384-well plates.

Patient-derived tumor organoids (PDOs) are expected to be a preclinical cancer model with better reproducibility of disease than traditional cell culture ...